Rice RN85zN-eH and detection method thereof

Abstract

The invention relates to a nucleic acid molecule of a rice transformation event RN85zN-eH and a detection method. The nucleic acid molecule of the rice RN85zN-eH comprises a sequence shown in SEQ ID NO: 1 or a reverse complementary sequence thereof, or a sequence shown in SEQ ID NO: 2 or a reverse complementary sequence thereof. The rice transformation event RN85zN-eH disclosed by the invention has the characteristics of insect resistance and glufosinate-ammonium herbicide resistance, and the detection method can accurately and quickly identify whether a biological sample contains DNA molecules of the transgenic rice event RN85zN-eH or not.

Description

Technical Field

[0001] The present invention relates to the field of plant biotechnology. Specifically, it relates to a nucleic acid molecule and a detection method of a rice transformation event RN85zN-eH, and in particular to a transgenic rice event RN85zN-eH that is resistant to insects and tolerant to the application of glufosinate herbicide, and a nucleic acid molecule and a detection method thereof for detecting whether a biological sample contains a specific transgenic rice event RN85zN-eH. Background Art

[0002] Rice is one of the most widely planted crops in my country. The entire growth period of rice is affected by a variety of pests, among which the Chilo suppressalis is one of the main pests of rice. It has a wide range of damage and poses a serious threat to a large number of rice fields worldwide every year. Especially in the key seasons of rice growth, such as summer and autumn, the rampage of Chilo suppressalis often leads to a significant drop in rice yields. Cultivating insect-resistant and herbicide-resistant transgenic rice varieties and promoting transgenic rice will be an effective means for us to increase yields and ensure food security.

[0003] The use of a single Bt protein control strategy can easily cause target pests to develop resistance, so it is necessary to develop new insecticidal proteins to improve insecticidal efficiency and prolong control effects. LC85-Ac protein is a new insecticidal protein that can be used to control lepidopteran pests including fall armyworm, striped stem borer, oriental armyworm, beet armyworm, armyworm, cutworm, and two-spotted armyworm (patent application number 202410332785.6).

[0004] Field weeds compete with crops for water, fertilizer, light energy and growth space, directly affecting crop yield and quality. At the same time, many weeds are intermediate hosts for crop pathogens and pests, and are one of the important biological limiting factors for crop yield. According to statistics from the Food and Agriculture Organization of the United Nations, the global food production loss caused by weeds is as high as US$95 billion per year, equivalent to the loss of 380 million tons of wheat, which is about more than half of the global wheat production in 2009. Of the US$95 billion in economic losses, poor developing countries have borne about US$70 billion (FAO. The lurking menace of weeds [J / OL]. (http: / / www.fao.org / news / story / en / item / 29402 / icode / ), 2009-08-11.). Therefore, effective control of field weeds is one of the important measures to promote food production. In addition, with the acceleration of the migration of rural population to cities in my country, the scale and mechanization of agricultural planting is a foreseeable trend, which makes traditional manual weeding methods unrealistic. The promotion and use of herbicides can greatly reduce the difficulty of field management and reduce labor intensity. The development of new products of high-efficiency, low-toxic and residue-free herbicides is expensive, time-consuming and difficult. This problem can be overcome by cultivating herbicide-resistant rice through transgenic technology. Spraying 1-2 times during the rice growth period can effectively solve the weed problem, reducing the amount of herbicides used and the input cost. Therefore, herbicide-resistant transgenic rice has very broad application value and market potential.

[0005] The present invention connects the insect-resistant gene expression cassette and the herbicide-resistant gene expression cassette in series, so that they are efficiently expressed in transgenic rice, have both insect-resistant and herbicide-resistant traits, and further enhance the application and economic value of the product.

[0006] It is known that the expression of foreign genes in plants is affected by their chromosomal location, which may be due to chromatin structure (e.g., heterochromatin) or the proximity of transcriptional regulatory elements (e.g., enhancers) to the integration site. For this reason, it is often necessary to screen a large number of events before it is possible to identify events that are commercially viable (i.e., events in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the amount of expression of the introduced gene can vary greatly between events; there may also be differences in the spatial or temporal pattern of expression, such as differences in the relative expression of the transgene between different plant tissues, which can be manifested in the actual expression pattern being inconsistent with the expression pattern expected based on the transcriptional regulatory elements in the introduced gene construct, resulting in differences in the trait expression of the transformation events. Therefore, it is often necessary to generate hundreds or thousands of different events and screen these events to find a single event with the expected transgene expression amount and expression pattern for commercial purposes. Events with the expected transgene expression amount and expression pattern can be used to introgress the transgene into other genetic backgrounds using conventional breeding methods through sexual outcrossing. The progeny produced by this cross retain the transgene expression characteristics of the original transformation event. Applying this strategy model can ensure reliable gene expression in many varieties that are well adapted to local growing conditions. Therefore, more transformation events need to be identified and screened to obtain excellent transformation events with excellent comprehensive trait performance and commercial prospects.

[0007] It would be beneficial to be able to detect the presence of a specific event to determine whether the offspring of a sexual cross contains the target gene. In addition, methods for detecting specific events will also help to comply with relevant regulations, such as the need to obtain formal approval and labeling of foods derived from recombinant crops before they are put on the market. It is possible to detect the presence of transgenics by any well-known polynucleotide detection method, such as polymerase chain reaction (PCR). These detection methods usually focus on commonly used genetic elements, such as promoters, terminators, marker genes, etc. Therefore, unless the sequence of the chromosomal DNA ("flanking DNA") adjacent to the inserted transgenic DNA is known, the above method cannot be used to distinguish different events, especially those generated with the same DNA construct. Therefore, a pair of primers that span the junction of the inserted transgenic and flanking DNA are often used to identify transgenic specific events by PCR, specifically a first primer containing a flanking sequence and a second primer containing an inserted sequence. Summary of the invention

[0008] The purpose of the present invention is to provide a rice transformation event (also called transformant) with excellent insect resistance and herbicide tolerance, as well as a nucleic acid molecule for detecting rice RN85zN-eH and a detection method thereof. The transgenic rice event RN85zN-eH has excellent insect resistance and good tolerance to glufosinate herbicide, and the detection method can accurately and quickly identify whether a biological sample contains a DNA molecule of a specific transgenic rice event RN85zN-eH.

[0009] To achieve the above purpose, the present invention uses the pBWA(V)HS-bar-LC85AcA5 expression vector to transform rice Nipponbare by Agrobacterium-mediated method, and obtains a batch of positive transformation events. Through the identification of insect resistance and herbicide resistance traits, it was found that the transformation event RN85zN-eH is a transformant with excellent herbicide tolerance and insect resistance, which can be used to improve the insect resistance and herbicide resistance traits of rice.

[0010] In order to characterize the identity characteristics of RN85zN-eH, the present invention provides a nucleic acid molecule, which comprises the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, or its reverse complementary sequence.

[0011] Furthermore, the nucleic acid molecule comprises the sequence shown in SEQ ID NO: 3 and / or SEQ ID NO: 4, or its reverse complementary sequence.

[0012] Furthermore, the nucleic acid molecule comprises the sequence shown in SEQ ID NO: 6 and / or SEQ ID NO: 7, or its reverse complementary sequence.

[0013] Furthermore, the nucleic acid molecule comprises the sequence shown in SEQ ID NO: 5 or its reverse complementary sequence.

[0014] The present invention also provides a probe for detecting rice transformation events, characterized in that it comprises a sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 6 or SEQ ID NO: 7 or a fragment or variant thereof or a reverse complementary sequence thereof.

[0015] The present invention also provides a primer pair for detecting rice transformation events, characterized in that the amplification product of the primer pair comprises a sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 6 or SEQ ID NO: 7 or a fragment thereof or a variant thereof or a reverse complementary sequence thereof.

[0016] In some embodiments, the primer pair is the sequence shown in SEQ ID NO: 8 and SEQ ID NO: 9; or the sequence shown in SEQ ID NO: 10 and SEQ ID NO: 11.

[0017] The present invention also provides a kit or microarray for detecting rice transformation events, characterized in that it comprises the above-mentioned probe and / or primer pair.

[0018] The present invention also provides a method for detecting rice transformation events, characterized in that it comprises using the above-mentioned probe or the above-mentioned primer pair or the above-mentioned probe and primer pair or the above-mentioned kit or microarray to detect whether the transformation event exists in the sample to be tested.

[0019] The present invention also provides a method for breeding rice, characterized in that the method comprises the following steps: 1) obtaining rice containing the above nucleic acid molecule; 2) obtaining rice plants, seeds, plant cells, offspring plants or plant parts by pollen culture, unfertilized embryo culture, doubling culture, cell culture, tissue culture, selfing or hybridization or a combination thereof from the rice obtained in step 1); and optionally, 3) Identifying the insect resistance and / or herbicide resistance of the offspring plants obtained in step 2), and using the above-mentioned method to detect whether the transformation event exists therein.

[0020] Furthermore, the present invention also provides products made from the rice plants, seeds, plant cells, progeny plants or plant parts obtained by the above method, including food, feed or industrial raw materials.

[0021] The SEQ ID NO: 1 is a 22-nucleotide sequence located near the insertion junction at the 5' end of the insertion sequence in the transgenic rice event RN85zN-eH, and the SEQ ID NO: 1 spans the DNA sequence at the left flank of the rice insertion site and the DNA sequence at the 5' end of the left border of the insertion sequence. The presence of the transgenic rice event RN85zN-eH can be identified by including the SEQ ID NO: 1 or its reverse complementary sequence. The SEQ ID NO: 2 is a 22-nucleotide sequence located near the insertion junction at the 3' end of the insertion sequence in the transgenic rice event RN85zN-eH, and the SEQ ID NO: 2 spans the DNA sequence at the 3' end of the right border of the insertion sequence and the DNA sequence at the right flank of the rice insertion site. The presence of the transgenic rice event RN85zN-eH can be identified by including the SEQ ID NO: 2 or its reverse complementary sequence.

[0022] In the present invention, the nucleic acid sequence may be at least 11 or more continuous polynucleotides (first nucleic acid sequence) of any part of the transgenic insertion sequence in the SEQ ID NO: 3 or its reverse complementary sequence, or at least 11 or more continuous polynucleotides (second nucleic acid sequence) of any part of the 5' left wing rice genomic DNA region in the SEQ ID NO: 3 or its reverse complementary sequence. The nucleic acid sequence may further be a part homologous to or reverse complementary to the SEQ ID NO: 3, which part of the sequence must contain the complete SEQ ID NO: 1 or SEQ ID NO: 6 sequence. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences include a DNA primer pair in a DNA amplification method for producing an amplification product. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product including SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 6 or its reverse complementary sequence, the presence of the transgenic rice event RN85zN-eH or its progeny can be diagnosed.

[0023] The SEQ ID NO: 3 is a sequence with a length of 1685 nucleotides located near the insertion junction site at the 5' end of the insertion sequence in the transgenic rice event RN85zN-eH. The SEQ ID NO: 3 consists of a 653-nucleotide rice left flank genomic DNA sequence (nucleotides 1-653 of SEQ ID NO: 3), a 91-nucleotide pBWA(V)HS-bar-LC85AcA5 construct left border DNA sequence (nucleotides 654-744 of SEQ ID NO: 3), and a 941-nucleotide 5' end DNA sequence of the first expression cassette of the glufosinate-tolerant gene (nucleotides 745-1685 of SEQ ID NO: 3). The presence of SEQ ID NO: 3 or its reverse complementary sequence can be identified as the presence of the transgenic rice event RN85zN-eH.

[0024] The nucleic acid sequence may be at least 11 or more continuous polynucleotides of any part of the transgenic insertion sequence in the SEQ ID NO: 4 or its reverse complementary sequence (third nucleic acid sequence), or at least 11 or more continuous polynucleotides of any part of the 3' right wing rice genomic DNA region in the SEQ ID NO: 4 or its reverse complementary sequence (fourth nucleic acid sequence). The nucleic acid sequence may further be homologous to or reverse complementary to a part of the SEQ ID NO: 4 that includes the entire SEQ ID NO: 2 or SEQ ID NO: 7. When the third nucleic acid sequence and the fourth nucleic acid sequence are used together, these nucleic acid sequences include a DNA primer set in a DNA amplification method for producing an amplification product. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product including SEQ ID NO: 2 or SEQ ID NO: 4 or SEQ ID NO: 7 or its reverse complementary sequence, the presence of the transgenic rice event RN85zN-eH or its progeny can be diagnosed.

[0025] The SEQ ID NO: 4 is a sequence of 1691 nucleotides in length located near the insertion junction at the 3' end of the insertion sequence in the transgenic rice event RN85zN-eH, and the SEQ ID NO: 4 consists of a 645-nucleotide 3' end DNA sequence of the second expression cassette of the insect-resistant gene (nucleotides 1-645 of SEQ ID NO: 4), a 470-nucleotide pBWA(V)HS-bar-LC85AcA5 construct right border DNA sequence (nucleotides 646-1115 of SEQ ID NO: 4), and a 576-nucleotide rice integration site right flank genomic DNA sequence (nucleotides 1116-1691 of SEQ ID NO: 4). The presence of the transgenic rice event RN85zN-eH can be identified by the presence of the SEQ ID NO: 4 or its reverse complementary sequence.

[0026] The SEQ ID NO: 5 is a sequence of 7420 nucleotides in length that characterizes the transgenic rice event RN85zN-eH. The presence of the transgenic rice event RN85zN-eH can be identified by including the SEQ ID NO: 5 or its reverse complementary sequence.

[0027] The present invention also provides a method for protecting rice plants from damage caused by herbicides, characterized in that it includes applying an effective dose of glufosinate herbicide to a field planted with at least one transgenic rice plant, wherein the transgenic rice plant comprises SEQ ID NO: 1, the nucleic acid sequence of positions 654-6844 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence in its genome, or the genome of the transgenic rice plant comprises SEQ ID NO: 5; and the transgenic rice plant has tolerance to glufosinate herbicide.

[0028] The present invention also provides a method for protecting rice plants from insect attack, characterized in that it includes providing at least one transgenic rice plant cell in the diet of the target insect, wherein the transgenic rice plant cell comprises SEQ ID NO: 1, the nucleic acid sequence at positions 654-6844 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence in its genome, or the genome of the transgenic rice plant cell comprises SEQ ID NO: 5; the target insect that feeds on the transgenic rice plant cell is inhibited from further feeding on the rice plant.

[0029] In the nucleic acid molecules and detection methods for detecting rice plants of the present invention, the following definitions and methods can better define the present invention and guide ordinary technicians in the field to implement the present invention. Unless otherwise specified, the terms are understood according to the conventional usage of ordinary technicians in the field.

[0030] The present invention provides a nucleic acid molecule for detecting rice plants and a detection method thereof. The transgenic rice event RN85zN-eH has insect resistance and tolerance to glufosinate herbicides. The rice plant with this trait expresses LC85-Ac protein and phosphinothricin acetyltransferase (PAT) protein, which endows the plant with insect resistance and tolerance to glufosinate. At the same time, in the detection method of the present invention, SEQ ID NO: 1 or its reverse complementary sequence, SEQ ID NO: 2 or its reverse complementary sequence, SEQ ID NO: 3 or its reverse complementary sequence, SEQ ID NO: 4 or its reverse complementary sequence, SEQ ID NO: 6 or its reverse complementary sequence, or SEQ ID NO: 7 or its reverse complementary sequence can be used as a DNA primer or probe to produce an amplification product diagnosed as the transgenic rice event RN85zN-eH or its progeny, and the presence of plant materials derived from the transgenic rice event RN85zN-eH can be quickly, accurately and stably identified.

[0031] The transgenic rice event RN85zN-eH has strong tolerance to glufosinate and outstanding insect resistance. These characteristics make the RN85zN-eH transformant useful for improving the tolerance and insect resistance of rice to glufosinate, thereby breeding new rice varieties that are resistant to insects and herbicides.

[0032] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Physical map of the recombinant expression vector pBWA(V)HS-bar-LC85AcA5.

[0034] Figure 2 The effect of indoor biological testing on Chilo suppressalis.

[0035] A, D: Nipponbare (blades); B, C, E, F: RN85N-eH (blades).

[0036] Figure 3 RN85zN-eH transformation event-specific PCR validation results.

[0037] M: DNA Marker, with size marked next to it (unit: bp); N: blank control water; C: receptor control Nipponbare genomic DNA; 1, 2: genomic DNA of transformant RN85zN-eH; 3, 4: samples containing RN85zN-eH.

[0038] LB: The expected size of the left border PCR fragment is 1043 bp; RB: The expected size of the right border PCR fragment is 1382 bp. DETAILED DESCRIPTION

[0039] The transformation event RN85zN-eH involved in this application refers to a rice plant obtained by genetic transformation with rice Nipponbare as the recipient, in which a foreign gene insert (T-DNA insert) is inserted between specific genomic sequences. In a specific embodiment, the expression vector used for transgenic has Figure 1The physical map shown in FIG. 5 , and the resulting T-DNA insert has the sequence shown in nucleotides 654-6844 of SEQ ID NO: 5. The transformation event RN85zN-eH can refer to this transgenic process, or can refer to the T-DNA insert in the genome obtained by this process, or a combination of the T-DNA insert and flanking sequences, or can refer to the rice plant obtained by this transgenic process. In a specific example, the event is also applicable to plants obtained by transforming other recipient varieties with the same expression vector, thereby inserting the T-DNA insert into the same genomic position. The transformation event RN85zN-eH can also refer to offspring plants obtained by asexual reproduction, sexual reproduction, doubling or doubling reproduction of the above-mentioned plants, or a combination of the above.

[0040] Example 1 Acquisition of transformation events and character identification LC85-AcA5 The gene encodes a protein, LC85-Ac, which has a significant control effect on lepidopteran pests such as the Chilo suppressalis; bar The gene encodes phosphinothricin acetyltransferase, which can improve the tolerance of plants to glufosinate herbicides. The present invention uses the pBWA(V)HS-bar-LC85AcA5 expression vector (the physical map of the vector is shown in Figure 1 ,Include LC85-AcA5 Gene expression cassette and bar The receptor Nipponbare was transformed by Agrobacterium-mediated method, and 39 positive transformation events were obtained. The herbicide tolerance and insect resistance of the T1 generation plants of these transformed seedlings were identified and screened.

[0041] 1. Herbicide resistance screening Using Nipponbare as a reference, we screened transformants with better herbicide tolerance by spraying glufosinate at twice the recommended concentration in the field at the seedling stage. The results showed that the tolerance of 10 transformation events to glufosinate herbicide was significantly higher than that of the control (Table 1), and they were named RN85N-eA~RN85N-eJ.

[0042] Table 1 Herbicide tolerance performance

[0043] The values ​​are the mean ± standard deviation of three biological replicates. LSD was used for multiple comparisons in statistical analysis (α = 0.05), and different letters indicate significant differences in the same column of data at the same herbicide concentration.

[0044] 2. Identification of insect resistance Using Nipponbare as a reference, the transformants with better insect resistance were screened from the above 10 transformation events by leaf bioassay. The insect resistance of the materials was evaluated by feeding the newly hatched larvae of Chilo suppressalis with detached rice leaves.

[0045] The results of indoor bioassay are shown in Table 2. Among the 10 transformants, RN85zN-eH and RN85zN-eJ were highly resistant to Chilo suppressalis, and the others were resistant, moderately resistant, lowly resistant or susceptible.

[0046] Figure 2 The indoor bioassay effect of leaves of the transformant RN85zN-eH against Chilo suppressalis was demonstrated.

[0047] Table 2 Indoor bioassay

[0048] The values ​​are expressed as the mean ± SD of 4 biological replicates, and the significance of the differences between the data in the same column was analyzed using the LSD method (α = 0.05).

[0049] In summary, RN85zN-eH and RN85zN-eJ are transformants with excellent herbicide resistance and insect resistance, which can be used to improve the glufosinate herbicide tolerance and insect resistance of rice, thereby cultivating new rice varieties that are resistant to insects and herbicides.

[0050] Example 2 Molecular Characterization of Transformation Event RN85zN-eH In order to further clarify the identity characteristics of the transformation event RN85zN-eH, the present invention analyzed the insertion site of the RN85zN-eH exogenous sequence on the rice genome and the insertion structure of the exogenous sequence.

[0051] 1. Analysis of flanking sequences of the insertion site of exogenous sequences in the rice genome 100 mg of plant leaves were taken, quickly ground with liquid nitrogen, and total DNA was extracted using the CTAB method. After the concentration of genomic DNA was measured, the total amount of DNA was guaranteed to be >1 mg. Using genome resequencing, each Read was 150 bp long, at least 10 Gb of data was obtained, and the data quality indicator Q30 was guaranteed to be ≥80% (i.e., the proportion of bases with a sequencing error rate greater than 0.1% was less than 20%). According to the genome resequencing results, the BWA software was used to compare and screen the sequence homology with all the sequences obtained by sequencing using the transgenic vector T-DNA sequence as a template (BWA, http: / / bio-bwa.sourceforge.net / , default settings). The screened sequences were further assembled and screened, and the Reads whose sequences were all vector sequences were removed. Finally, a type of Read sequence was obtained, which was characterized by half of the genome sequence and the other half of the vector sequence. The obtained genome sequence was compared with the Nipponbare MSU7.0 reference genome (http: / / rice.uga.edu / pub / data / Eukaryotic_Projects / o_sativa / annotation_dbs / pseudomolecules / version_7.0 / all.dir / ) to obtain the specific location of the genome sequence on the genome, which is the possible insertion site.

[0052] The sequencing results were compared with the reference genome and exogenous T-DNA sequences to obtain the insertion position information of the exogenous insertion fragment, which was located at the rice genome Chr12: 13858270-13858330 bp. Subsequently, the forward and reverse primers were designed on the genome flanking sequences and exogenous insertion sequences at the left and right borders of the insertion site using the Primerblast software on the NCBI website (https: / / blast.ncbi.nlm.nih.gov / Blast) (as shown in Table 3). The insertion site was verified by PCR amplification using the genomic DNA of the transgenic rice line as a template. The amplified product fused a part of the rice genome sequence and a part of the T-DNA sequence, and the PCR product was sequenced and analyzed.

[0053] Table 3 Primer information

[0054] The PCR reaction system specifically includes 1.0 μL genomic DNA, 10.0 μL 2×PCR Mixture, 0.5 μL forward primer (10 μM) and 0.5 μL reverse primer (10 μM), and water is added to make up to 20 μL.

[0055] The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing for 30 s, extension at 72°C for a certain time (set at 60 s / kb), 30 cycles; and extension at 72°C for 7 min.

[0056] PCR amplification results are shown in Figure 3 The PCR amplification products of the left and right borders were sequenced to obtain the T-DNA insertion border sequence and flanking sequences of the RN85zN-eH transformant, which were assembled as follows (capital letters represent rice genome sequences, lowercase letters represent T-DNA sequences, and bold marks the positions of transformant-specific PCR primers): Left border: TTGTCAACCT TGGGTGATAA ATCGACTAGC TTGTGTTACT ATGATGACCT ATCTAGAACT 60 ATATGCTTAG TCATGCTTAA TTGCCACTAG CTCAGTTGAT GGTATAATTG CAGTATTAGA 120 CATTTTTAGT ATCATGACGA GCTGCTTGCT CGAGACACCC GACCATGTTT CATTGGTCGT 180 AATTATACAA CTAAAATGCG ACTGAATGGT GGGCTGTGGG TGCATGGTTT TGCTAGTCGC 240 ACCCATGGCA ATTAAGGACC GGTTCACGGG AAACCCTGGg tggtgtaaac aaattgacgc 300 ttagacaact taataacaca ttgcggacgt ttttaatgtt agactgaatt aacgccgaat 360 taattcgggg gatctggatt ttagtactgg attttggttt taggaattag aaattttatt 420 gatagaagta ttttacaaat acaaatacat actaagggtt tcttatatgc tcaacacatg 480 agcgaaaccc tataggaacc ctaattccct tatctgggaa ctactcacac attattatgg 540 agaaagcgat cgctcaaatc tcggtgacgg gcaggaccgg acggggcggt accggcaggc 600 tgaagtccag ctgccagaaa cccacgtcat gccagttccc gtgcttgaag ccggccgccc 660 gcagcatgcc gcggggggca tatccgagcg cctcgtgcat gcgcacgctc gggtcgttgg 720 gcagcccgat gacagcgacc acgctcttga agccctgtgc ctccagggac ttcagcaggt 780 gggtgtagag cgtggagccc agtcccgtcc gctggtggcg gggggagacg tacacggtcg 840 actcggccgt ccagtcgtag gcgttgcgtg ccttccaggg gcccgcgtag gcgatgccgg 900 cgacctcgcc gtccacctcg gcgacgagcc agggatagcg ctcccgcaga cggacgaggt 960 cgtccgtcca ctcctgcggt tcctgcggct cggtacggaa gttgaccgtg cttgtctcga 1020 tgtagtggtt gacgatggtg cag 1043 Right boundary: ccgactacgc ctccgcctat gaggaaaagg cctacactga cggccgcagg gataacccat 60 gcgagtcaaa tcgcggttac ggcgattaca ccccactgcc tgctggctac gtcaccaaag 120 agcttgagta cttccccgag actgacaagg tgtggatcga gatcggtgag actgagggca 180 cttcatcgt ggactccgtc gagctgctgc tcatggaaga gtgagagctc gggcccgaag 240 actgaccagc tcgaatttcc ccgatcgttc aaacatttgg caataaagtt tcttaagatt 300 gaatcctgtt gccggtcttg cgatgattat catataattt ctgttgaatt acgttaagca 360 tgtaataatt aacatgtaat gcatgacgtt attatgaga tgggttttta tgattagagt 420 cccgcaatta tacatttaat acgcgataga aaacaaaata tagcgcgcaa actaggataa 480 attatcgcgc gcggtgtcat ctatgttact agatcgggcc atccgcactg tagcggatgg 540 cctaaaaaaa aaactagaag agacgagtct gagactcagc gtctcggtcg cagtcataac 600 ttcgtatagc atacattata cgaagttatg ggccgcatta ccctgttatc cctagccgc 660 ataacttcgt atagcctaca ttataggatg gagggatatc ctctcttaag gtagcgagca 720 agctctaaga ggagtgtcga caagcttggc actggccgtc gttttacaac gtcgtgactg 780 ggaaaaccct ggcgttaccc aacttaatcg ccttgcagca catccccct tcgccagctg 840 gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa cagttgcgca gcctgaatgg 900 cgaatgctag agcagcttga gcttggatca gattgtcgtt tcccgccttc agtttaaact 960 atcagtgttt gacaggatat attggCGACC CTTTCCTAGG CACCGGTGGC GAGGGTGGGC 1020 GTGATGAAGT TGGGTCGGCC GGGGTGTCCG GTTGTCCAGC TGCCGGATTC ACCGCGGCGC 1080 ACGAGGGGAC TGCCCACCTC CGGGGTAGGG GGTGGGGGTG AAACCTTAGC GTGGTGTGGA 1140 TGGTTAGGGG AGAGTTATAT GAAGGGTCTT GTCACAATCA CTCGACATGG TGACGTGTCT 1200 GCGCAGGCAT GGTGACATGC GGGTGGATTG TGTCTTGTGG GTATAGTTGT GCACCTCTTG 1260 CCAGAGTAAA ACTATTCGAA TAGCCGTGCC CGCGGTTATG GGCGATCAAC CAGATTCACC 1320 GTGATTAGTCTCACACTTAA TAAATCGACC CAATGCACTG TAGTTCGGGTGGGTTGGTTG 1380 GG 1382 The results of sequencing analysis showed that the RN85zN-eH exogenous fragment was reversely inserted from the LB to the RB end into the rice genome Chr12: 13858270-13858330 bp position.

[0057] The recipient rice genome sequence at the position of the transformant insertion (the underline marks the genome deletion sequence caused by the insertion of the transformant T-DNA): gacacaatcc acccgcatgt caccatgcct gcgcagacac gtcaccatgt cgagtgattg 60 tgacaagacc cttcatataa ctctccccta accatccaca ccacgctaag gtttcacccc 120 caccccctac cccggaggtg ggcagtcccc tcgtgcgccg cggtgaatcc ggcagctgga 180 caaccggaca ccccggccga cccaacttca tcacgcccac cctcgccacc ggtgcctagg 240 aaagggtcg a gctatacttc agatcaggca gttacccatt cccgcttgtg gtaagcactg 300 taagtcttcc agggtttccc gtgaaccggt ccttaattgc catgggtgcg actagcaaaa 360 ccatgcaccc acagcccacc attcagtcgc attttagttg tataattacg accaatgaaa 420 catggtcggg tgtctcgagc aagcagctcg tcatgatact aaaaatgtct aatactgcaa 480 ttataccatc aact 494 Analysis of the left and right border sequences showed that the insertion of the exogenous sequence caused a 59 bp deletion mutation in the recipient rice genome; at the same time, the LB end of the T-DNA region deleted 14 bp and the RB end deleted 9 bp. Analysis of the upstream and downstream genomic sequences of the insertion site showed that the insertion site of the exogenous sequence was located in the intergenic region of the rice genome, and there was no known functional gene.

[0058] 2. Analysis of full-length insert sequences in vitro Using SEQ ID NO: 8 and SEQ ID NO: 11 as primers and the genomic DNA of the transformant RN85zN-eH as a template, PCR amplification was performed, and the obtained PCR product was the exogenous full-length insertion sequence. The PCR product was subjected to second-generation sequencing analysis and sequence splicing to obtain the actual insertion sequence of the RN85zN-eH transformant and the left and right flanking rice genome sequences, as shown in SEQ ID NO: 5.

[0059] Example 3 Detection method of transformation event RN85zN-eH New varieties can be bred from the transgenic rice event RN85zN-eH and agricultural products or commodities can be produced. If a sufficient amount is detected in the agricultural product or commodity, the agricultural product or commodity is expected to contain a nucleotide sequence that can diagnose the presence of transgenic rice event RN85zN-eH material in the agricultural product or commodity. The agricultural product or commodity includes but is not limited to rice flour, rice oil, rice bran, rice germ, rice protein, rice starch, rice bran nutritional oil or rice bran polysaccharide, and any other food to be consumed by animals as a food source, or cosmetics, industrial products, etc. Probe or primer pair-based nucleic acid detection methods and / or kits can be developed to detect a transgenic rice event RN85zN-eH nucleotide sequence such as shown in SEQ ID NO: 1 or SEQ ID NO: 2 in a biological sample, wherein the probe sequence or primer amplification sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, to diagnose the presence of transgenic rice event RN85zN-eH.

[0060] One of the detection methods is: using the PCR method to detect samples containing RN85zN-eH, and the PCR primer pairs used are SEQ ID NO: 8 (forward primer), SEQ ID NO: 9 (reverse primer) or SEQ ID NO: 10 (forward primer), SEQ ID NO: 11 (reverse primer).

[0061] PCR reaction system: The reaction procedure is: 95℃, 5 min; (95℃, 30 sec; 59℃, 30 sec; 72℃, 90 sec) × 30 cycles; 72℃, 7 min.

[0062] The PCR product was electrophoresed in 1% (w / v) 1×TAE agarose gel. Figure 3 shown.

[0063] The expected target bands (SEQ ID NO: 6 and SEQ ID NO: 7, respectively) can be amplified in the RN85zN-eH transformation event. Moreover, the PCR method can track the existence of the transformation event, so as to be applied to breeding work. In summary, the transgenic rice event RN85zN-eH of the present invention can improve plant insect resistance and has a high tolerance to glufosinate herbicide, and can be used to improve other rice germplasms and create new rice hybrid combinations. Its detection method can accurately and quickly identify whether the biological sample contains the DNA molecule of the transgenic rice event RN85zN-eH.

[0064] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A nucleic acid molecule, characterized in that Includes any of the following: i) comprising the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, or the reverse complementary sequence thereof; ii) comprising the sequence shown in SEQ ID NO: 3 and / or SEQ ID NO: 4, or the reverse complementary sequence thereof; iii) comprising the sequence shown in SEQ ID NO: 6 and / or SEQ ID NO: 7, or the reverse complementary sequence thereof; iv) comprising the sequence shown in SEQ ID NO: 5, or its reverse complementary sequence.

2. A probe for detecting rice transformation events, characterized in that: It includes the sequence shown by SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 6 or SEQ ID NO: 7 or its fragment or variant or its reverse complementary sequence.

3. A primer pair for detecting rice transformation events, characterized in that: The amplification product of the primer pair comprises the sequence of claim 2.

4. The primer pair according to claim 3, characterized in that: The primer pair is the sequence shown in SEQ ID NO: 8 and SEQ ID NO: 9; or the sequence shown in SEQ ID NO: 10 and SEQ ID NO:

11.

5. A kit or microarray for detecting rice transformation events, characterized in that: Comprising the probe according to claim 2 and / or the primer pair according to any one of claims 3-4.

6. A method for detecting rice transformation events, characterized in that: The method comprises using any of the following to detect whether the conversion event exists in the sample to be tested: i) the probe according to claim 2; ii) the primer pair according to any one of claims 3 to 4; iii) the probe according to claim 2 and the primer pair according to any one of claims 3 to 4; iv) The kit or microarray according to claim 5.

7. A method for breeding rice, characterized in that: The method comprises the following steps: 1) obtaining rice containing the nucleic acid molecule according to claim 1; 2) The rice obtained in step 1) is subjected to pollen culture, unfertilized embryo culture, doubling culture, cell culture, tissue culture, self-pollination or hybridization or a combination thereof to obtain rice plants, seeds, plant cells, offspring plants or plant parts.

8. The method according to claim 7, characterized in that The method comprises: evaluating the insect resistance traits and / or identifying the herbicide resistance of the offspring plants obtained in step 2) of claim 7, and using the method of claim 6 to detect whether there is a transformation event therein.

9. The product obtained by the method according to any one of claims 7 to 8, characterized in that The product is made from rice plants, seeds, plant cells, progeny plants or plant parts, including food, feed or industrial raw materials.

10. A method for protecting rice plants from damage caused by herbicides, characterized in that The method comprises applying an effective dose of a glufosinate herbicide to a field planted with at least one transgenic rice plant, wherein the transgenic rice plant sequentially comprises the nucleic acid sequences of SEQ ID NO: 1, SEQ ID NO: 5 at positions 654-6844 and SEQ ID NO: 2 in its genome, or the genome of the transgenic rice plant comprises SEQ ID NO: 5; and the transgenic rice plant has tolerance to the glufosinate herbicide.

11. A method for protecting rice plants from insect attack, characterized in that The method comprises providing at least one transgenic rice plant cell in the diet of a target insect, wherein the transgenic rice plant cell comprises SEQ ID NO: 1, the nucleic acid sequence at positions 654-6844 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence in its genome, or the genome of the transgenic rice plant cell comprises SEQ ID NO: 5; and the target insect that ingests the transgenic rice plant cell is inhibited from further ingesting the rice plant.

Images