A Lactiplantibacillus pentosus strain for promoting cellular immune regulation, its application and product
By screening out a breast milk-derived strain of L. pentosaccharide LIHUO 03, this strain can significantly regulate the immune response of macrophages and lymphocytes in vitro, solving the lack of immune regulation effect on breast milk-derived S. pentosaccharide in the prior art, and achieving effective immune regulation on macrophages and lymphocytes.
Patent Information
- Application Number
- CN202510140160.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-08
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2045-02-08
AI Technical Summary
At this stage, no systematic attention has been made to the effect of breast milk-derived P. pentosaccharide on various immune cells and their cytokines, especially the immune regulation effect on macrophages and lymphocytes in vitro.
A breast milk-derived P. pentosaccharide LIHUO 03 is provided. This strain can promote the secretion of TNF-α, IL-10 and IL-1β by macrophages and downregulate the secretion of NO. The heat-inactivated strain also has the effect of promoting the secretion of TNF-α by macrophages, and promotes lymphocyte proliferation in the mouse primary epithelial cell-splenary lymphocyte co-culture system.
LIHUO 03 significantly increased the content of TNF-α, IL-10 and IL-1β secretion by macrophages, while reducing the secretion of NO. The heat-inactivated strain also had significant immunomodulatory effects in the inflammatory state and promoted the proliferation of lymphocytes.
Smart Images

Figure CN119570698B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of microorganisms, and particularly relates to a Lactiplantibacillus pentosus strain that promotes cellular immune regulation, as well as its applications and products. Background Art
[0002] The immune system is the tissue system responsible for performing immune functions in the body. It is dedicated to defending the organism against pathogens, repairing tissue damage, and serving as a continuous surveillance barrier. It develops from birth and is strengthened during childhood. Immune cells are the functional units of the immune system and can be divided into innate immune cells and adaptive immune cells. The former mainly includes monocytes / macrophages, granulocytes, etc., and the latter are mainly T cells and B cells. Many immune cells play different functions in the immune response and, together with the cytokines they secrete, such as tumor necrosis factor (TNF-α), interleukin-10 (IL-10), IL-1β, etc., jointly maintain the health of the host organism, achieving the effects of immune defense, immune homeostasis, and immune surveillance.
[0003] Probiotics can promote the development and maturation of the host immune system and regulate the body's immunity. They have regulatory effects on a variety of immune cells, including epithelial cells, dendritic cells, monocytes / macrophages, B cells, T cells, and NK cells. Breast milk is a newly discovered high-quality source for screening functional probiotics. Existing research has shown that the microorganisms in breast milk play roles in promoting intestinal nutrient metabolism and absorption, constructing the intestinal barrier, and enhancing immune development. Lactobacilli derived from breast milk have natural advantages in regulating host immune development. Lactiplantibacillus pentosus is generally considered a safe microorganism and has broad application prospects in food fermentation and production. Some studies have shown that Lactiplantibacillus pentosus can affect the body's immunity through various pathways, such as changing the structure and composition of the host intestinal flora and regulating the levels of short-chain fatty acids in feces. However, at present, no researcher has systematically focused on the effects of breast milk-derived Lactiplantibacillus pentosus on various immune cells and their cytokines in vitro. Therefore, it is necessary to explore the stimulating effects of breast milk-derived Lactiplantibacillus pentosus on innate immune cells and adaptive immune cells, and develop Lactiplantibacillus pentosus that can immunomodulate macrophages and lymphocytes.
[0004] The prior art discloses some information about Lactiplantibacillus pentosus as follows:
[0005] The combined use of viable Lactiplantibacillus pentosus and Spirulina platensis can maintain a relatively good immune state in the hepatopancreas of penaeid shrimp (Liu Lei. Effects of the combined use of Lactiplantibacillus pentosus and Spirulina platensis on the growth, digestion, immunity, intestinal flora, and disease resistance of Litopenaeus vannamei [D]. Hainan University, 2022. DOI: 10.27073 / d.cnki.ghadu.2022.000711.).
[0006] RAW264.7 cells were treated with Lactiplantibacillus pentosus LZ-R-17 at different concentrations, which could significantly improve the ability of cells to phagocytose neutral red and their acid phosphatase activity. Lactiplantibacillus pentosus LZ-R-17 could significantly increase the release of cytokines such as NO, TNF-α, IL-6, IL-1β, and IL-10, indicating its good immunomodulatory effect (You Xiu, Zhao Xiaogan, Li Zhi, et al. Immunomodulatory and intestinal probiotic functions of Lactobacillus helveticus LZ-R-5 and Lactiplantibacillus pentosus LZ-R-17 from kefir grains [C]. Chinese Institute of Food Science and Technology. Proceedings of the 16th International Symposium on Probiotics and Health. College of Food Science and Technology, Nanjing Agricultural University, 2021:2. DOI: 10.26914 / c.cnkihy.2021.004863.). Summary of the Invention
[0007] To solve the above problems, the present invention provides Lactiplantibacillus pentosus derived from breast milk that can immunomodulate cells (macrophages and lymphocytes).
[0008] Lactiplantibacillus pentosus ( Lactiplantibacillus pentosus ) was formerly known as Lactobacillus pentosus and can also be translated as Lactiplantibacillus plantarum. In the present invention, Lactiplantibacillus pentosus is used to refer to this strain.
[0009] The present invention aims to provide a strain of Lactiplantibacillus pentosus LIHUO 03 derived from breast milk that can immunomodulate macrophages and lymphocytes. This strain can promote the secretion of TNF-α, IL-10, and IL-1β by macrophages under normal conditions and downregulate the secretion of NO. At the same time, its heat-inactivated strain also has the effect of promoting the secretion of TNF-α by macrophages; the heat-inactivated strain LIHUO03 can further interfere with the secretion of TNF-α, IL-10, and IL-1β by macrophages in an inflammatory state; in the Caco-2 cell-macrophage co-culture system, the heat-inactivated strain LIHUO 03 can significantly increase the content of TNF-α secreted by macrophages in this system; in the mouse primary epithelial cell-spleen lymphocyte co-culture system, the heat-inactivated strain LIHUO 03 can promote the proliferation of lymphocytes.
[0010] In the present invention, a strain of Lactiplantibacillus pentosus ( Lactiplantibacillus pentosus ) LIHUO03 was deposited with the China General Microbiological Culture Collection Center on November 29, 2024, and the deposit number is: CGMCC No. 32858.
[0011] The above-mentioned Lactiplantibacillus pentosus ( Lactiplantibacillus pentosus ) LIHUO 03 is derived from breast milk samples of healthy women in Jiangxi Province. After sequencing analysis, its pheSThe sequence fragment is shown in SEQ ID NO.1. The sequenced sequence was aligned with nucleic acid sequences in NCBI, and the results showed that the strain was Lactiplantibacillus pentosus, named LIHUO 03.
[0012] SEQ ID NO.1:
[0013] TTTCTAACACGTGAGGATGCACCATCCCAGCACCTAAAACTTCGATCCAACCCGTTTGCTTGCAGATGGCACAGCCCTTACCGTTACAGTTAAAGCAGGTCACATCAGCTTCAACGGACGGTTCCGTGAATGGGAAGAAGCTTGGCCGCAGCCGCACGTCAAATTGGTCACCAAACAACGTTTTAGCAACTAAAATCAAGGTGCCCTTCAAGTCAGCCATCGTGATATGCTTATCGACTACTAGCCCTTCAATCTGATGGAATTGATGGGAATGGGTCGCATCATCCGTGTCACGCCGATAAACGCGGCCTGGTGAGAGCACTTTTAATGGGCCCTTTGAGAAATCATGATTTTCAAGTGAACGTGGTTGGTCCGCAGAAGTTTGCGTCCGTAAGAGCACGTCCTTGGTAATGTAAAAGGTATCCTGC.
[0014] The Lactiplantibacillus pentosus LIHUO 03 has the following biological characteristics:
[0015] (1) The colonies of the Lactiplantibacillus pentosus LIHUO 03 on MRS solid medium are milky white, semi-circular convex, with a smooth and moist surface and neat edges.
[0016] (2) Live bacteria can promote the secretion of TNF-α, IL-10 and IL-1β by macrophages in the normal state and down-regulate the secretion of NO. The heat-inactivated strain also has the effect of promoting the secretion of TNF-α by macrophages.
[0017] (3) The heat-inactivated strain can further interfere with the secretion of TNF-α, IL-10 and IL-1β by macrophages in the inflammatory state.
[0018] (4) In the Caco-2 cell-macrophage co-culture system, the heat-inactivated strain can significantly increase the content of TNF-α secreted by macrophages in this system.
[0019] (5) In the co - culture system of mouse primary epithelial cells - splenic lymphocytes, the heat - inactivated strain LIHUO 03 can promote the proliferation of lymphocytes.
[0020] The present invention also provides a method for culturing the aforementioned Lactiplantibacillus pentosus, which includes inoculating the Lactiplantibacillus pentosus into a culture medium.
[0021] The culture medium includes, but is not limited to: MRS medium, MRS - cysteine hydrochloride medium.
[0022] As an example, the culture medium may include: peptone 8 - 12 g, beef extract 8 - 12 g, yeast powder 3 - 8 g, glucose 15 - 25 g, K2HPO4 1 - 3 g, diammonium citrate 1 - 3 g, sodium acetate 1 - 3 g, Tween 80 0.5 - 2 mL, MgSO4·7H2O 0.5 g, MnSO4·4H2O 0.25 g. The pH of the culture medium is preferably 7.2 - 7.4.
[0023] The present invention also provides the aforementioned culture of Lactiplantibacillus pentosus.
[0024] The culture is obtained by inoculating the Lactiplantibacillus pentosus into any one or more of a solid culture medium, a semi - solid culture medium, or a liquid culture medium and then culturing.
[0025] The culture can be a fermentation broth under some conditions.
[0026] The present invention also provides a bacterial agent, which includes any one or more of the viable bacteria, dead bacteria, or cultures of the aforementioned Lactiplantibacillus pentosus.
[0027] The dead bacteria are preferably heat - inactivated bacteria.
[0028] The present invention also provides the application of the aforementioned Lactiplantibacillus pentosus, culture, or bacterial agent in the preparation of an immune - regulating product.
[0029] The immune - regulating product can be used for immune regulation of macrophages or lymphocytes.
[0030] Preferably, the immune - regulating product is used to promote the proliferation of macrophages or lymphocytes.
[0031] Preferably, the immune - regulating product is used to promote the expression or secretion of TNF - α, IL - 10, and IL - 1β.
[0032] Preferably, the immune - regulating product is used to down - regulate the secretion of NO.
[0033] In one embodiment of the present invention, the enhancement and regulation of immunity include at least one of the following functions:
[0034] (1) Promote the secretion of TNF-α, IL-10 and IL-1β by macrophages under normal conditions and down-regulate the secretion of NO.
[0035] (2) Heat-inactivated strains can further intervene in the secretion of TNF-α, IL-10 and IL-1β in the inflammatory state of macrophages.
[0036] (3) In the Caco-2 cell-macrophage co-culture system, it can significantly stimulate the content of TNF-α secreted by macrophages in this system.
[0037] (4) In the mouse primary epithelial cell-spleen lymphocyte co-culture system, it can promote the proliferation of lymphocytes.
[0038] The present invention also provides a product comprising the foregoing Lactiplantibacillus pentosus or culture or bacterial agent.
[0039] The product described includes but is not limited to pharmaceuticals.
[0040] The Lactiplantibacillus pentosus in the product can be viable bacteria or dead bacteria, preferably heat-inactivated bacteria.
[0041] Specifically, the product may include any one or more of the fermentation broth of Lactiplantibacillus pentosus, fermentation broth precipitate, and freeze-dried powder.
[0042] In some specific embodiments, the product may be a pharmaceutical, and as is well known to those skilled in the art, it may also include other pharmaceutical raw materials or pharmaceutical excipients. The pharmaceutical excipients include but are not limited to any one or more of excipients, buffers, emulsifiers, stabilizers, diluents, binders, preservatives, and lubricants.
[0043] Based on the specific embodiments of the present invention, the present invention also provides a method for preparing postbiotics of Lactiplantibacillus pentosus, and the preparation method at least includes: heat-inactivating the Lactiplantibacillus pentosus.
[0044] In some specific embodiments, the preparation method may include:
[0045] (1) Ferment the foregoing Lactiplantibacillus pentosus to obtain a fermentation broth;
[0046] (2) After centrifuging the fermentation broth in step (1), resuspend the bacterial cells to obtain a bacterial suspension;
[0047] (3) Heat-inactivate the bacterial suspension in step (2) under the conditions of 90-121 °C for 15-30 min, and detect and confirm.
[0048] Advantages of the present invention:
[0049] The present invention has screened out a Lactiplantibacillus pentosus LIHUO03 with good in vitro immune regulation and probiotic characteristics, which has a probiotic effect on immune regulation, specifically manifested as follows:
[0050] (1) LIHUO 03 can increase the content of TNF-α secreted by macrophages by 1381.04%, the content of IL-10 by 464.70% and the content of IL-1β by 287.09% under normal conditions, and reduce the secretion of NO by 47.72%; Heat-inactivated LIHUO 03 can increase the content of TNF-α secreted by macrophages by 1056.72% under normal conditions.
[0051] (2) Heat-inactivated LIHUO 03 can further increase the content of TNF-α secreted by macrophages in the inflammatory state by 830.71%, the content of IL-10 by 1207.40%, and down-regulate the content of IL-1β by 36.55%.
[0052] (3) In the Caco-2 cell-macrophage co-culture system, heat-inactivated LIHUO 03 can promote the increase of the content of TNF-α secreted by macrophages in this system by 23.25%.
[0053] (4) In the mouse primary epithelial cell-spleen lymphocyte co-culture system, heat-inactivated LIHUO 03 can promote the proliferation of lymphocytes, with an increase of 2.30%.
[0054] (5) The strain of the present invention is safely sourced from the milk of healthy women; and both the live bacteria and dead bacteria of this strain have the ability of in vitro immune regulation, with good practical application prospects.
[0055] Deposition Description
[0056] A strain of Lactiplantibacillus pentosus, taxonomically named Lactiplantibacillus pentosus Lactiplantibacillus pentosus was deposited at the China General Microbiological Culture Collection Center on November 29, 2024, with the deposition number CGMCC No. 32858 and the deposition address at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. Description of the Drawings
[0057] Figure 1 shows the colony morphology of Lactiplantibacillus pentosus LIHUO 03.
[0058] Figure 2 shows the effect of Lactiplantibacillus pentosus LIHUO 03 on TNF-α of normal macrophages. "****" indicates that compared with the blank group, p <0.0001, with extremely significant differences.
[0059] Figure 3Effect of Lactiplantibacillus pentosus LIHUO 03 on IL-10 of normal macrophages. "***" indicates compared with the blank group, p <0.001, showing a highly significant difference.
[0060] Figure 4 Effect of Lactiplantibacillus pentosus LIHUO 03 on IL-1β of normal macrophages. "**" indicates compared with the blank group, p <0.01, showing a significant difference.
[0061] Figure 5 Effect of Lactiplantibacillus pentosus LIHUO 03 on NO of normal macrophages. "**" indicates compared with the blank group, p <0.01, showing a significant difference.
[0062] Figure 6 Effect of heat-inactivated Lactiplantibacillus pentosus LIHUO 03 on TNF-α of normal macrophages. "****" indicates compared with the blank group, p <0.0001, showing an extremely significant difference.
[0063] Figure 7 Effect of heat-inactivated Lactiplantibacillus pentosus LIHUO 03 on TNF-α of LPS-induced inflammatory macrophages. "#" indicates compared with the model group, p <0.0001, showing an extremely significant difference.
[0064] Figure 8 Effect of heat-inactivated Lactiplantibacillus pentosus LIHUO 03 on IL-10 of LPS-induced inflammatory macrophages. "#" indicates compared with the model group, p <0.0001, showing an extremely significant difference; "##" indicates compared with the model group, p <0.01, showing a significant difference.
[0065] Figure 9 Effect of heat-inactivated Lactiplantibacillus pentosus LIHUO 03 on IL-1β of LPS-induced inflammatory macrophages. "#" indicates compared with the model group, p <0.0001, showing an extremely significant difference.
[0066] Figure 10 Effect of Lactiplantibacillus pentosus LIHUO 03 on TNF-α of macrophages in the Caco-2 cell-macrophage co-culture system. "**" indicates compared with the blank group p <0.01, showing a significant difference.
[0067] Figure 11To investigate the effect of heat-inactivated Lactobacillus pentosus LIHUO 03 on the proliferation of lymphocytes in a co-culture system of mouse primary epithelial cells and splenic lymphocytes, "**" indicates significant difference compared with the blank group. p <0.01, indicating a significant difference. Specific implementation methods
[0068] The present invention will be further described in detail below in conjunction with specific embodiments. The following embodiments are not used to limit the present invention, but only to illustrate the present invention. The experimental methods used in the following embodiments, unless otherwise specified, and the experimental methods without specific conditions indicated in the embodiments are usually carried out under conventional conditions. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can be obtained from commercial channels.
[0069] As an example, the media involved in the following embodiments are as follows:
[0070] MRS medium formula (1L): peptone 10g, beef extract 10g, yeast powder 5g, glucose 20g, K2HPO4 2g, diammonium citrate 2g, sodium acetate 2g, Tween 80 1 mL, MgSO4·7H2O 0.5g, MnSO4·4H2O 0.25g, pH 7.2 - 7.4; sterilized at 121 °C for 15 min.
[0071] MRS solid medium formula (1L): peptone 10g, beef extract 10g, yeast powder 5g, glucose 20g, K2HPO4 2g, diammonium citrate 2g, sodium acetate 2g, Tween 80 1 mL, MgSO4·7H2O 0.5g, MnSO4·4H2O 0.25g, agar 20g, pH 7.2 - 7.4; sterilized at 121 °C for 15 min.
[0072] The human colorectal adenocarcinoma Caco-2 cells and mouse mononuclear macrophage RAW 264.7 involved in the following embodiments were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences.
[0073] The mouse primary small intestinal mucosal epithelial cells and mouse primary splenic lymphocytes involved in the following embodiments were purchased from Wuhan Punosai Life Science Co., Ltd.
[0074] The culture method of macrophage RAW 264.7 involved in the following embodiments is as follows:
[0075] After the macrophages are revived, observe the cell adhesion. If the cell growth is good and the density reaches about 80%, subculture. Aspirate the culture medium in the culture bottle, add 5mL PBS to rinse 1-2 times, and remove the residual culture medium; after aspirating the PBS for rinsing, add 1mL pancreatin, shake to make the pancreatin evenly cover the bottom of the bottle, and place it in the incubator at 37℃ for digestion; during digestion, take it out and observe it every 3-5 minutes until the edges of some cells begin to fall off, absorb the digesting pancreatin and blow the cells into a centrifuge tube containing 3-4mL complete culture medium, gently blow the cell suspension in the centrifuge tube to disperse the cells; 1000rpm, 3min centrifugation to collect cells; gently resuspend the cells with fresh DMEM culture medium, evenly inoculate the cell suspension into the culture dish, mix it by cross method or 8-shaped method, and then place it in the incubator to continue culturing and observe the cell status. Subculture 2-3 times for subsequent experiments.
[0076] The Caco-2 cell culture method involved in the following examples is as follows:
[0077] The recovery, passage and culture steps are the same as those for macrophages. After the cells have grown to 80%-90% of the bottom of the bottle, use 0.25% trypsin to digest at 37°C for 2-3 minutes, then stop digestion, centrifuge, resuspend and count for later use. Caco-2 cells were inoculated into a cell migration culture chamber (also known as an insert cell culture dish), and 100 μL of cell suspension (cell number 1.0×10 5 500 μL of DMEM high-glucose medium without cells was added to the bottom side of the cell migration filter and cultured for 21 days.
[0078] The method for culturing primary mouse small intestinal epithelial cells involved in the following examples is as follows:
[0079] Aspirate the culture medium in the culture flask and wash the cells once with PBS. Add 1 mL of 0.25% trypsin digestion solution to the T25 culture flask, gently rotate the culture flask until the digestion solution covers the entire bottom of the culture flask, aspirate the excess trypsin, and incubate at 37°C for 1-3 minutes; observe under an inverted microscope, and add 5 mL of complete culture medium to terminate digestion after the cells shrink. Use a pipette to gently blow and mix, inoculate into a T25 culture flask for subculture according to the subculture ratio, and then add fresh complete culture medium to 5 mL, and place it in a cell culture incubator at 37°C, 5% CO2, and saturated with appropriate temperature for static culture. After the cells are completely attached to the wall, culture and observe, and use them for experiments. After that, replace the fresh complete culture medium according to the frequency of fluid change. After the cells have grown 80%-90% of the bottom of the flask, use 0.25% trypsin to digest at 37°C for 2-3 minutes, then terminate the digestion, centrifuge, resuspend and count, and set aside. Mouse primary small intestinal epithelial cells were inoculated into the cell migration culture chamber, and 100 μL of cell suspension (cell number 1.0×10 5(number / perforation), add 500 μL of the special medium for small intestinal mucosal epithelial cells without cells (Procell) to the bottom side of the cell migration filter membrane, and culture for 21 days.
[0080] The method for culturing mouse spleen lymphocytes involved in the following examples is as follows:
[0081] Collect the cells in the culture flask into a 15 mL centrifuge tube, centrifuge at 1200 rpm for 3 min, discard the supernatant, and collect the cell pellet. Add 5 mL of fresh lymphocyte special medium (Procell), gently pipette and mix to disperse the cells; adjust the dispersed cells to an appropriate density and inoculate them into a culture vessel, and place them in a cell culture incubator at 37 °C, 5% CO2, and saturated humidity for static culture. After the cell state is stable, culture and observe for experiments. Then change the fresh complete medium according to the medium change frequency.
[0082] The method for preparing the Lactiplantibacillus pentosus suspension involved in the following examples is as follows:
[0083] Streak on MRS solid medium and culture at 37 °C for 48 h to obtain single colonies; pick single colonies and inoculate them into MRS liquid medium, culture at 37 °C for 13 - 18 h for activation, and activate continuously for two generations to obtain an activation solution; inoculate the activation solution into MRS liquid medium at an inoculation amount of 2% (v / v), culture at 37 °C for 13 - 18 h to obtain a bacterial solution; centrifuge the bacterial solution at 4 °C, 6000 g for 5 min to obtain Lactiplantibacillus pentosus cells; wash the Lactiplantibacillus pentosus cells with 0.01 M PBS and resuspend them in 0.01 M PBS to a bacterial concentration of 1×10 8 CFU / mL to obtain a bacterial suspension.
[0084] The method for preparing the heat-inactivated Lactiplantibacillus pentosus suspension involved in the following examples is as follows:
[0085] Streak on MRS solid medium and culture at 37 °C for 48 h to obtain single colonies; pick single colonies and inoculate them into MRS liquid medium, culture at 37 °C for 13 - 18 h for activation, and activate continuously for two generations to obtain an activation solution; inoculate the activation solution into MRS liquid medium at an inoculation amount of 2% (v / v), culture at 37 °C for 13 - 18 h to obtain a bacterial solution; centrifuge the bacterial solution at 4 °C, 6000 g for 5 min to obtain Lactiplantibacillus pentosus cells; wash the Lactiplantibacillus pentosus cells with 0.01 M PBS and resuspend them in 0.01 M PBS to a bacterial concentration of 1×10 8CFU / mL to obtain a bacterial suspension. The bacterial suspension was inactivated under the conditions of 90 - 121 °C for 15 - 30 min. A small amount of the bacterial liquid was aspirated and spread on an MRS solid plate, and cultured in an incubator at 37 °C for 24 - 48 h. The presence or absence of colony formation was observed. The absence of colony formation indicated the completion of heat inactivation.
[0086] Example 1 Screening, Isolation and Identification of Lactiplantibacillus pentosus Strains
[0087] The strain involved in the present invention is a Lactobacillus strain screened from the breast milk of healthy humans, and was identified as Lactiplantibacillus pentosus based on molecular biology. Figure 1 It is the colony morphology diagram of the Lactiplantibacillus pentosus strain in the examples of the present invention.
[0088] The specific steps are as follows:
[0089] (1) Dilution and spreading
[0090] Under aseptic operation, 1 mL of the sample (breast milk of healthy humans) was aspirated and added to 9 mL of sterilized water to form a 1:10 uniform dilution. The above dilution steps were repeated to successively obtain dilution solutions with dilution factors of 10 -2 、10 -3 、10 -4 、10 -5 and 10 -6 dilution solutions. 100 μL of the above dilution solutions with dilution factors of 10 -4 、10 -5 and 10 -6 dilution solutions were respectively aspirated with a sterile pipette tip and spread onto an MRS solid medium, and cultured at 37 °C for 48 h to obtain dilution plates.
[0091] (2) Purification culture
[0092] Dilution plates with colony counts in the range of 30 - 300 were taken. 10 - 20 single colonies that were milky white or white and of different sizes were randomly selected from each sample, and were streaked onto an MRS solid medium in three areas and cultured at 37 °C for 48 h to obtain single colonies. The single colonies on the above streaked plates were respectively inoculated into an MRS liquid medium and cultured at 37 °C for 12 h to obtain a secondary purified culture solution.
[0093] (3) Strain preservation and identification
[0094] The secondary purified culture solution was mixed evenly. The bacterial cells were respectively taken into 2 mL clean strain preservation tubes. After centrifugation and discarding the supernatant, the bacterial cells were taken, 1 mL of 30% glycerol was added for resuspension, and then placed in a -80 °C refrigerator. At the same time, the strain was sent to the Institute of Microbiology, Chinese Academy of Sciences for strain identification. pheSThe sequence fragment is shown as SEQ ID NO.1, identified as Lactiplantibacillus pentosus, named LIHUO 03, and the preservation work has been completed. Lactiplantibacillus pentosus JZ959 screened during the same period was used for comparison.
[0095] Example 2 Effects of Lactiplantibacillus pentosus on the secretion of inflammatory factors TNF-α, IL-10, IL-1β and NO by macrophages in the normal state
[0096] I. Experimental steps
[0097] Macrophages were cultured in DMEM medium supplemented with 10% (v / v) fetal bovine serum under the culture conditions of 37 °C and 5% CO2. Cells were seeded on a 48-well cell culture plate at a density of 1×10 5 cells / well, and after overnight culture, fresh medium was replaced to start the experimental treatment. The experimental groups were as follows: LIHUO 03 group: 100 μL of LIHUO 03 bacterial suspension was added to each well; JZ959 group: 100 μL of JZ959 bacterial suspension was added to each well; blank group: 100 μL of PBS was added to each well. There were three parallels in each group. After treatment, the well plates were incubated in a CO2 incubator at 37 °C for 2 h. After incubation, the supernatant of each well was aspirated into a 1.5 mL EP tube and centrifuged at 6000 g for 5 min to obtain the incubated culture supernatant, which was stored in a -80 °C refrigerator. The detection of the contents of TNF-α (MouseTNF-alpha Quantikine Elisa kit / mouse TNF-α enzyme-linked immunosorbent assay kit, R&D), IL-10 (Mouse IL-1beta DuoSet Elisa kit / mouse IL-1β enzyme-linked immunosorbent assay kit, R&D), IL-1β (Mouse IL-10 DuoSetElisa kit / mouse IL-10 enzyme-linked immunosorbent assay kit, R&D) and NO (Mouse NO Elisa kit / mouse NO enzyme-linked immunosorbent assay kit, Elabscience ® ) in the incubated culture supernatant was carried out according to the steps of their respective instructions.
[0098] II. Experimental results
[0099] As Figure 2 shown, LIHUO 03 (898.40 ± 6.90 pg / mL) could increase the content of TNF-α secreted by macrophages in the blank group (60.66 ± 22.46 pg / mL) by 1381.04%, and the promoting effect was significantly better than that of JZ959 (376.6 ± 55.65 pg / mL).
[0100] As Figure 3As shown, LIHUO 03 (2025.00 ± 315.90 pg / mL) can increase the content of IL-10 secreted by macrophages in the blank group (358.60 ± 166.90 pg / mL) by 464.70%, and the promoting effect is significantly better than that of JZ959 (606.50 ± 161.20 pg / mL).
[0101] As Figure 4 shown, LIHUO 03 (14.40 ± 3.46 pg / mL) can increase the content of IL-1β secreted by macrophages in the blank group (3.72 ± 0.28 pg / mL) by 287.09%, and the promoting effect is significantly better than that of JZ959 (8.05 ± 1.19 pg / mL).
[0102] As Figure 5 shown, LIHUO 03 (8.50 ± 2.03 pg / mL) can reduce the content of NO secreted by macrophages in the blank group (16.26 ± 2.86 pg / mL) by 47.72%, and the inhibitory effect is significantly better than that of JZ959 (11.87 ± 1.10 pg / mL).
[0103] Example 3 Effect of Heat-inactivated Lactobacillus pentosus on the Secretion of Inflammatory Factor TNF-α by Macrophages in the Normal State
[0104] I. Experimental Procedures
[0105] Macrophages were cultured in DMEM medium supplemented with 10% (v / v) fetal bovine serum under the conditions of 37°C and 5% CO2. Cells were seeded on a 48-well cell culture plate at a density of 1 × 10 5 cells / well, and after overnight culture, fresh medium was replaced to start the experimental treatment. The experimental groups were as follows: LIHUO 03 group: 100 μL of LIHUO 03 heat-inactivated bacterial suspension was added to each well; JZ959 group: 100 μL of JZ959 heat-inactivated bacterial suspension was added to each well; blank group: 100 μL of PBS was added to each well. There were three parallels in each group. After treatment, the well plates were incubated in a CO2 incubator at 37°C for 2 h. After incubation, the supernatant of each well was aspirated into a 1.5 mL EP tube and centrifuged at 6000 g for 5 min to obtain the incubated culture supernatant, which was stored in a -80°C refrigerator. The content of TNF-α (Mouse TNF-alpha Quantikine Elisa kit / mouse TNF-α enzyme-linked immunosorbent assay kit, R&D) in the incubated culture supernatant was detected according to the instructions of the kit.
[0106] II. Experimental Results
[0107] As Figure 6As shown, LIHUO 03 (961.70±19.73 pg / mL) can increase the content of TNF-α secreted by macrophages in the blank group (83.14±2.39 pg / mL) by 1056.72%, and the promotion effect is significantly better than that of JZ959 (245.70±14.72 pg / mL).
[0108] Example 4 Effects of Intervention with Heat-Inactivated Lactobacillus pentosus on the Secretion of Inflammatory Factors TNF-α, IL-10, and IL-1β by LPS-Induced Inflammatory Macrophages
[0109] I. Experimental Procedures
[0110] Macrophages were cultured in DMEM medium supplemented with 10% (v / v) fetal bovine serum under the conditions of 37 °C and 5% CO2. Cells were seeded on a 48-well cell culture plate at a density of 2×10 5 cells / well, and after overnight culture, fresh medium was replaced to start the experimental treatment. The experimental groups were as follows: LIHUO 03 group: 100 μL of LIHUO 03 heat-inactivated bacterial suspension was added to each well; JZ959 group: 100 μL of JZ959 heat-inactivated bacterial suspension was added to each well; blank group: 100 μL of PBS was added to each well. There were three parallels in each group. After treatment, the well plates were incubated in a CO2 incubator at 37 °C for 2 h. After incubation, the supernatant was aspirated. Each well was washed 2-3 times with sterile PBS, 900 μL of DMEM culture medium and 100 μL of LPS solution (10 μg / mL) were added to each well, and the blank group was 1000 μL of DMEM culture medium. There were 3 replicates in each group. The plates were incubated in a 37 °C, 5% CO2 incubator for 1 h. After incubation, the supernatant was aspirated and centrifuged at 6000 g for 5 min to obtain the incubation culture supernatant, which was stored in a -80 °C refrigerator. The detection of the contents of TNF-α (Mouse TNF-alpha Quantikine Elisa kit / R&D), IL-1β (Mouse IL-1beta DuoSet Elisa kit / R&D), and IL-10 (Mouse IL-10 DuoSet Elisa kit / R&D) in the incubation culture supernatant was carried out according to the steps of their respective instructions.
[0111] II. Experimental Results
[0112] As Figure 7As shown, LIHUO 03 (1303.00 ± 43.72 pg / mL) can increase the content of TNF-α secreted by macrophages in the blank group (140.00 ± 4.53 pg / mL) by 830.71%, and its promoting effect is significantly better than that of JZ959 (670.00 ± 15.39 pg / mL).
[0113] As Figure 8 shown, LIHUO 03 (690.7 ± 13.14 pg / mL) can increase the content of IL-10 secreted by macrophages in the blank group (52.83 ± 4.400 pg / mL) by 1207.40%, and its promoting effect is significantly better than that of JZ959 (98.59 ± 4.46 pg / mL).
[0114] As Figure 9 shown, LIHUO 03 (0.92 ± 0.024 pg / mL) can down-regulate the content of IL-1β secreted by macrophages in the blank group (1.45 ± 0.084 pg / mL) by 36.55%, and its inhibitory effect is significantly better than that of JZ959 (0.075 ± 0.0063 pg / mL). Compared with the model group (0.019 ± 0.0030 pg / mL), LIHUO 03 can relieve the decrease in the secretion of macrophage IL-1β caused by LPS and increase it by nearly 47 times.
[0115] Example 5 Effect of heat-inactivated Lactiplantibacillus pentosus LIHUO 03 on macrophages TNF-α in Caco-2 cell-macrophage co-culture system
[0116] I. Experimental procedures
[0117] The culture methods of Caco-2 cells and macrophages are as described above. After the Caco-2 cells are cultured to form a confluent monolayer, 10 5 macrophages are inoculated in the lower chamber of cell migration, and 500 μL of DMEM medium is added. After the cells adhere and grow, they are transferred to the upper chamber of Caco-2 cells that form a barrier, and the fresh complete medium is replaced respectively.
[0118] The experimental groups are as follows:
[0119] LIHUO 03 group: Add 200 μL of DMEM culture solution and 100 μL of heat-inactivated LIHUO 03 bacterial suspension to each well;
[0120] JZ959 group: Add 200 μL of DMEM culture solution and 100 μL of heat-inactivated JZ959 bacterial suspension to each well;
[0121] Blank group: Add 200 μL of DMEM culture solution and 100 μL of PBS to each well.
[0122] Incubate in triplicate for 2 h in an incubator at 37 °C with 5% CO₂. After incubation, aspirate the supernatant from the lower chamber, centrifuge at 6000 g for 5 min to obtain the incubated culture supernatant, and store it in a -80 °C refrigerator. The content of TNF-α in the incubated culture supernatant was detected using a Mouse TNF-alpha Quantikine ELISA kit (R&D) according to the instructions of the kit.
[0123] II. Experimental Results
[0124] As Figure 10 shown, LIHUO 03 (749.50 ± 27.99 pg / mL) can increase the content of TNF-α secreted by macrophages in the blank group (608.10 ± 7.38 pg / mL) by 23.25%, and the promoting effect is significantly better than that of JZ959 (641.60 ± 36.80 pg / mL).
[0125] Example 6 Effect of heat-inactivated Lactobacillus pentosus LIHUO 03 on the proliferation of lymphocytes in a co-culture system of primary mouse small intestinal mucosal epithelial cells and splenic lymphocytes
[0126] I. Experimental Procedures
[0127] The culture methods of primary mouse small intestinal mucosal epithelial cells and splenic lymphocytes were as described above. After the mucosal epithelial cells were cultured to form a confluent monolayer, 10 5 splenic lymphocytes were seeded in the lower chamber of cell migration, and 500 μL of the special medium for splenic lymphocytes was added. After the cells adhered and grew, they were transferred to the upper chamber of the mucosal epithelial cells forming a barrier, and the fresh complete medium was replaced separately.
[0128] The experimental groups were as follows:
[0129] LIHUO 03 group: Add 200 μL of the special culture medium for mucosal epithelial cells and 100 μL of the heat-inactivated bacterial suspension of LIHUO 03 to each well;
[0130] JZ959 group: Add 200 μL of the special culture medium for mucosal epithelial cells and 100 μL of the heat-inactivated bacterial suspension of JZ959 to each well;
[0131] Blank group: Add 200 μL of the special culture medium for mucosal epithelial cells and 100 μL of PBS to each well.
[0132] Incubate in triplicate for 2 h in an incubator at 37 °C with 5% CO₂. After incubation, remove the upper chamber, add 50 μL of CCK-8 solution to the lower chamber, incubate in an incubator at 37 °C with 5% CO₂ for 4 h, measure OD450nm, and calculate the lymphocyte proliferation rate. The calculation formula is:
[0133] Proliferation rate = (OD 实验组 - OD 空白组 ) / OD 空白组 × 100%.
[0134] II. Experimental Results
[0135] As Figure 11 shown, LIHUO 03 (2.30% ± 0.50%) can promote the proliferation of splenic lymphocytes, with an increase of 2.30%, and the promoting effect is significantly better than that of JZ959 (0.50% ± 0.6%).
[0136] Comparative Example
[0137] The comparison with other Lactobacillus pentosus with immunomodulatory functions in the prior art is as follows:
[0138]
[0139] The above embodiments are only used to illustrate the present invention and are not used to limit the present invention. The technical solutions obtained by those skilled in the art through further improvements on the basis of the technical solution of the present invention are all within the protection scope of the present invention.
Claims
1. A strain of Lactobacillus pentosus ( Lactiplantibacillus pentosus ), characterized in that, The Lactobacillus pentosus is Lactobacillus pentosus LIHUO 03, with a preservation number of CGMCC No.32858, and was deposited in the General Microbiology Center of the China National Microbiological Culture Collection Administration on November 29, 2024.
2. The culture of Lactobacillus pentosus according to claim 1, characterized in that The lactobacillus pentosus is inoculated into any one or more of a solid culture medium, a semi-solid culture medium or a liquid culture medium and then cultured.
3. A bacterial agent, characterized in that: The method comprises any one or more of the live bacteria or dead bacteria of Lactobacillus pentosus according to claim 1 or the culture according to claim 2.
4. Use of the Lactobacillus pentosus according to claim 1, the culture according to claim 2, or the bacterial agent according to claim 3 in the preparation of an immunomodulatory product.
5. The use according to claim 4, characterized in that: The immunomodulatory product is used for immunomodulating macrophages or lymphocytes.
6. The use according to claim 5, characterized in that: The immunomodulatory product is used to promote the proliferation of macrophages or lymphocytes, promote the expression or secretion of TNF-α, IL-10 and IL-1β, and down-regulate the secretion of NO.
7. A product comprising the Lactobacillus pentosus according to claim 1, the culture according to claim 2, or the bacterial agent according to claim 3.
8. The product according to claim 7, characterized in that The product comprises any one or more of the fermentation liquid, fermentation liquid precipitation and freeze-dried powder of Lactobacillus pentosaceus; and the product is a medicine.
9. A method for preparing a postbiotic of Lactobacillus pentosus, characterized in that: The preparation method comprises: heat-inactivating the Lactobacillus pentosus described in claim 1.
10. The preparation method according to claim 9, characterized in that: The preparation method comprises: (1) fermenting the Lactobacillus pentosaceus described in claim 1 to obtain a fermentation liquid; (2) After centrifuging the fermentation broth in step (1), resuspending the bacterial cells to obtain a bacterial suspension; (3) The bacterial suspension in step (2) is heat-inactivated at 90-121°C for 15-30 min and tested for confirmation.
Citation Information
Patent Citations
Lactobacillus pentosus with anti-inflammatory and anti-oxidation characteristics and application thereof
CN116656523A
Phytobacterium pentosus JNL0030, application thereof and microbial preparation
CN119120263A