Snp marker ec62238 related to reproductive traits of exopalaemon modestus and application thereof

By using the SNP marker Ec62238 to assist in breeding, high-fertility white shrimp were screened out, solving the problem of low reproductive performance of white shrimp and achieving rapid and economical breeding results.

CN119570941BActive Publication Date: 2025-10-24YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411632187.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-15
Publication Date
2025-10-24
Estimated Expiration
2044-11-15

AI Technical Summary

Technical Problem

The reproductive performance of white shrimp is low, resulting in poor seed quality and affecting the breeding benefits. The existing breeding methods are costly and have a long cycle.

Method used

Molecular marker-assisted breeding was performed using the SNP marker Ec62238. Specific primers were designed for PCR and quantitative real-time PCR amplification. Individuals with the GG genotype were screened as parents with high fertility. Genome-wide association analysis was used to screen out SNP markers associated with reproductive traits.

Benefits of technology

This method allows for the rapid selection of highly fertile white shrimp, shortening the breeding cycle, reducing costs, and improving seed quality. It is suitable for early-stage breeding and reduces the randomness of parent selection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119570941B_ABST
    Figure CN119570941B_ABST
Patent Text Reader

Abstract

The present application relates to a SNP marker Ec62238 related to the reproductive traits of Exopalaemon modestus and an application thereof, and belongs to the technical field of crustacean genetics and breeding. Detection primers SEQ ID NO. 1-2 and typing primers SEQ ID NO. 3-5 are designed according to the SNP marker Ec62238. The gene sequence in which the SNP marker Ec62238 is located is shown in SEQ ID NO. 6. The base at the 601st site of the 5' end of the gene sequence is G or A. The SNP marker Ec62238 is located on the 24th chromosome of Exopalaemon modestus. The present application also provides an application of the detection primers and the typing primers in the selection of Exopalaemon modestus of good reproductive traits. The molecular marker is used for the screening of Exopalaemon modestus with high reproductive capacity or the selection of good breeds with high reproductive capacity, and can save cost and shorten the breeding period.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic breeding of crustaceans, and particularly relates to a SNP marker Ec62238 related to reproductive traits of Exopalaemon carinicauda and application thereof. BACKGROUND

[0002] Exopalaemon carinicauda belongs to Palaemonidae and Palaemon. Exopalaemon carinicauda has tender and delicious meat and has a high market value. In recent years, as a new breeding species, Exopalaemon carinicauda has developed rapidly and become a main characteristic aquaculture species in coastal mudflat areas of Jiangsu, Zhejiang and Shandong provinces. Reproductive traits are one of the most important economic traits in shrimp breeding industry, and a higher reproductive capacity has a relatively important significance for the propagation and production of excellent breeding species. However, the clutch size of Exopalaemon carinicauda is much lower than that of other economic shrimps, and the Exopalaemon carinicauda seedlings are mainly obtained by capturing wild parent shrimps or breeding parent shrimps, which leads to low reproductive capacity of parent shrimps, poor quality of seedlings, slow growth rate of Exopalaemon carinicauda, poor disease resistance and other problems, and restricts the development of Exopalaemon carinicauda breeding industry. Therefore, improving the reproductive performance of Exopalaemon carinicauda through genetic improvement is an important measure for the sustainable development of Exopalaemon carinicauda breeding industry.

[0003] Exopalaemon carinicauda has the advantage of short reproductive cycle, and generally one generation can be reproduced in 2-3 months, and the same female shrimp can continuously reproduce eggs for multiple times. The important indicators for measuring the reproductive performance of female shrimps mainly include clutch size and frequency of egg production, and the reproductive performance of groups with different genetic backgrounds is significantly different.

[0004] Molecular marker-assisted breeding (MAS) uses molecular markers closely linked to target genes to screen individuals with specific genotypes, and combines conventional breeding methods to breed excellent varieties. Compared with traditional breeding methods, molecular marker-assisted breeding has obvious advantages, can shorten the breeding period, is not affected by the growth stage of aquatic animals, is not affected by the external environment, and can be carried out under any environmental conditions. The premise of molecular marker-assisted breeding is to obtain functional markers or closely linked markers of target genes, which requires gene positioning or cloning of target genes.

[0005] Genome-wide association study (GWAS) refers to the research of molecular markers and target traits on the whole genome level. Through high-density molecular marker typing of DNA samples in a large population, genetic markers related to target traits are found. GWAS is an effective tool for identifying genetic variations related to important economic traits of animals and plants, and clarifying key genetic regions and candidate genes, which may be the target of further research and breeding programs. With the rapid development of genome sequencing technology and the reduction of sequencing cost, GWAS has become an important method for studying important complex traits of animals and plants. GWAS analysis provides candidate molecular markers and functional genes for economic traits of crustaceans, and lays an important foundation for the application of molecular marker-assisted selection breeding in crustacean breeding. SUMMARY

[0006] In order to overcome the shortcomings of the existing traditional breeding technology in the selection of high reproductive traits of Exopalaemon modestus, the application provides a SNP marker Ec62238 related to the reproductive traits of Exopalaemon modestus and its application. The molecular marker is used for screening or breeding of high reproductive Exopalaemon modestus, which can save cost and shorten the breeding cycle.

[0007] In order to achieve the above application purposes, the application is realized by the following technical solutions:

[0008] The application first provides the application of the SNP marker Ec62238 in the selection of high reproductive Exopalaemon modestus, and designs detection primers SEQ ID NO. 1-2 and typing primers SEQ ID NO. 3-5 according to the SNP marker Ec62238. The gene sequence of the SNP marker Ec62238 is shown in SEQ ID NO. 6, the base of the 601st site of the 5' end of the gene sequence is G or A, and the SNP marker Ec62238 is located on the 24th chromosome of Exopalaemon modestus.

[0009] The detection primer of the SNP marker Ec62238, the forward primer sequence of the detection primer is 5'-TACTTGGATGCCTCTGGTGT-3'(SEQ ID NO. 1), and the reverse primer sequence is 5'-TTTAGTGTAGGTCTCGCTGATG-3'(SEQ ID NO. 2).

[0010] The typing primer of the SNP marker Ec62238 has a forward primer sequence of 5'-ATCACCTCAGTAAGTAACCAGG-3' (SEQ ID NO. 3) or 5'-ATCACCTCAGTAAGTAACCAGA-3' (SEQ ID NO. 4), and a reverse primer sequence of 5'-AAGTCTTTGTCTTGACCAGATG-3' (SEQ ID NO. 5).

[0011] The application further provides application of the detection primer in breeding of a good-prolific variety of Exopalaemon modestus, and the application method is that the sample DNA of Exopalaemon modestus is subjected to PCR amplification by using the primer, and individuals amplifying the 647bp target fragment are selected as breeding parents of the variety, and the nucleotide sequence of the detection primer is shown as SEQ ID NO. 1-2.

[0012] The application further provides application of the SNP marker Ec62238 typing primer in breeding of a good-prolific variety of Exopalaemon modestus, and the application method is that the sample DNA of Exopalaemon modestus is subjected to fluorescent quantitative PCR amplification by using the primer, SNP marker typing of individuals of Exopalaemon modestus is performed according to the amplification result, and the genotype of the sample at the Ec62238 site is determined; the site with the GG genotype is selected as a breeding parent of the variety, and the nucleotide sequence of the typing primer is shown as SEQ ID NO. 3-5.

[0013] Further, the typing primer is used for typing of Exopalaemon modestus in the following method: the first primer pair and the second primer pair are respectively used for PCR fluorescent quantification of individuals of Exopalaemon modestus, and the amplification result is analyzed, the forward primer sequence of the first primer pair is 5'-ATCACCTCAGTAAGTAACCAGG-3' (SEQ ID NO. 3), and the reverse primer sequence is 5'-AAGTCTTTGTCTTGACCAGATG-3' (SEQ ID NO. 5); the forward primer sequence of the second primer pair is 5'-ATCACCTCAGTAAGTAACCAGA-3' (SEQ ID NO. 4), and the reverse primer sequence is 5'-AAGTCTTTGTCTTGACCAGATG-3' (SEQ ID NO. 5); when the fluorescent quantitative PCR amplification cycle number Ct value of the first primer pair is less than that of the second primer pair, and the difference is greater than 4, the genotype of the individual is GG; when the fluorescent quantitative PCR amplification cycle number Ct value of the first primer pair is greater than that of the second primer pair, and the difference is greater than 4, the genotype of the individual is AA; and if the difference between the fluorescent quantitative PCR amplification cycle number Ct value of the first primer pair and that of the second primer pair is less than 1, the genotype of the individual is GA.

[0014] Compared with the prior art, the application has the following beneficial technical effects: the typing primer provided by the application can screen the breeding material of Exopalaemon modestus with the SNP marker Ec62238 of the GG genotype, the clutch size, the clutch size per unit body length and the clutch size per unit body weight of the individual of the GG genotype of the SNP marker Ec62238 are significantly greater than those of the individuals of the AA genotype and the GA genotype (P<0.05); not only can the Exopalaemon modestus with outstanding reproductive traits be quickly obtained, but also the Exopalaemon modestus is not limited by the growth stage and the environment, can be used for early selection of the Exopalaemon modestus, reduces the blindness of parent screening, saves the breeding cost and shortens the breeding cycle. The application has a good and wide market application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 FIG. 1 is a Manhattan plot for whole genome association analysis of the reproductive traits (clutch size) of Exopalaemon modestus, and the purple circle marker is the molecular marker screened by the application, which is located on the 24th chromosome of Exopalaemon modestus;

[0016] Figure 2 FIG. 4 is an electropherogram of the PCR product of the amplification primer for detecting the SNP marker Ec62238 of Exopalaemon modestus;

[0017] Figure 3 FIG. 5 is an amplification curve of the fluorescence quantitative PCR reaction of the Ec62238 marker; the genotypes from top to bottom are GG, AA and GA genotypes, respectively. DETAILED DESCRIPTION

[0018] The following examples further describe the application and are not intended to limit the application. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are commercially available unless otherwise specified.

[0019] The example of the application screens the SNP marker related to the reproductive traits of Exopalaemon modestus based on whole genome association analysis. The whole genome resequencing of 152 Exopalaemon modestus is carried out, the resequencing data is aligned to the Exopalaemon modestus genome by using the BWA software, the SNP site information of all individuals is obtained, the whole genome association analysis of the clutch size and the relative clutch size traits of Exopalaemon modestus is carried out, and finally the SNP site related to the clutch size traits of Exopalaemon modestus is screened through a large number of screening experiments, which is located at the 69272350th base of the 24th chromosome and is named Ec62238. The sequences of 600 bp upstream and downstream of the SNP site are extracted by using the TBtools software, and the specific nucleotide sequence is shown in SEQ ID NO: 6.

[0020] Example 1: Resequencing, genetic variation detection and genome-wide association analysis of Exopalaemon modestus

[0021] 1. Phenotype data collection and statistical analysis of population reproductive traits

[0022] Healthy female Exopalaemon modestus at the initial stage of egg carrying were selected, and data related to reproductive traits such as egg carrying amount, egg carrying amount per unit body length, and egg carrying amount per unit body weight were collected. Statistical analysis was performed on the collected phenotype data, including minimum value, maximum value, average value, standard deviation, coefficient of variation, etc. The results are shown in Table 1.

[0023] Table 1. Statistical analysis of Exopalaemon modestus reproductive trait phenotype data

[0024]

[0025] 2. Extraction and detection of genomic DNA from muscle tissue of Exopalaemon modestus

[0026] DNA was extracted from the muscle tissue of Exopalaemon modestus by the traditional phenol-chloroform method. 100 mg of muscle tissue was taken into a 2 ml centrifuge tube, 600 μl of lysis buffer was added, and 30 μl of proteinase K was added to remove proteins. Then, 60°C incubation was performed for 1-2 hours, and the tube was inverted several times to accelerate the digestion process. After complete digestion, an equal volume (600 μl) of phenol-chloroform-isoamyl alcohol (25:24:1) was added, and the tube was mixed on a shaker at low speed for 5 minutes. Centrifugation was performed at 12000 g for 15 minutes at room temperature, and 400 μl of supernatant was collected. An equal volume of cold isopropanol (-20°C) was added, and the tube was slowly inverted several times until a white flocculent precipitate appeared. Centrifugation was performed at 12000 g for 10 minutes at room temperature, and the flocculent precipitate was collected at the bottom of the centrifuge tube. The liquid in the centrifuge tube was removed, and the DNA was washed twice with 95% ethanol. After complete drying, the DNA was dissolved in 1xTE. The quality of the DNA was detected by 1% agarose gel, and the concentration was determined. The DNA was stored at 4°C or -20°C for future use.

[0027] 3. Whole genome resequencing and genetic variation detection of Exopalaemon modestus

[0028] The qualified genomic DNA was sent to Shanghai Oeuge Biomedical Technology Co., Ltd. for quality control and library construction for sequencing. Illumina next-generation sequencing platform was used for whole genome resequencing to obtain raw data. Fastp software was used to quality control the raw sequencing raw reads, remove reads containing adapter sequences, and remove low-quality reads. Finally, high-quality clean data was obtained, and bwa software was used to align the clean reads to the reference genome. Vcf tools software was used to filter and screen SNPs, and SHAPEIT2 software was used to convert the original haplotype file into a phased VCF file.

[0029] 4. Genome-wide association analysis of reproductive traits of white shrimp.

[0030] Using EMMAX software and a mixed linear model, genome-wide association analysis was performed on the white shrimp based on the SNP detection results and the egg holding capacity trait. The significance of the association (P-value) was used. When -log10(P)>6, the difference was significant, and potential candidate SNPs were screened. A total of 190 SNP sites related to the egg holding capacity trait were screened ( Figure 1 ) and functionally annotated the genes at these sites. One candidate SNP site was selected to verify the accuracy of the association results. This site, located at base 69,272,350 on chromosome 24, had a correlation with egg clutch size with a P-value of 2.24E-08.

[0031] Example 2: Preliminary verification of the correlation between the Ec62238 marker and reproductive traits of the white shrimp

[0032] Candidate molecular markers associated with reproductive traits were validated using quantitative PCR in a population of 152 individuals of the same species used in the genome-wide association study. Genotyping primers were used to generate quantitative PCR amplification curves of DNA from the individuals to be tested. The genotypes of each individual were statistically analyzed based on the amplification curves, and correlation analysis was performed using a generalized linear model (GLM) using Tassel 5.0 software. The specific steps are as follows:

[0033] 1. Ec62238 site verification.

[0034] PCR amplification and sequencing were performed on 10 random individuals of the white shrimp Ec62238 using the forward primer sequence: 5'-TACTTGGATGCCTCTGGTGT-3' (SEQ ID NO. 1) and the reverse primer sequence: 5'-TTTAGTGTAGGTCTCGCTGATG-3' (SEQ ID NO. 2). The PCR amplification system consisted of 2 μl of template DNA, 1 μl of each upstream and downstream primer, 2 μl of 10× LA PCR buffer II, 1.6 μl of 2.5 mM dNTP mix, 0.4 μl of 5 U / μl TaKaRa LA Taq, and 11 μl of sterile water. The PCR amplification protocol was as follows: initial denaturation at 95°C for 3 min, followed by 35 cycles of denaturation at 95°C for 20 s, annealing at 60°C for 40 s, and extension at 72°C for 20 s, followed by a final extension at 72°C for 3 min. The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing to obtain the sequence information of each individual at the Ec62238 site and verify whether the mutation site was consistent with the results of the previous resequencing ( Figure 2), the amplified target fragment of the detection primer is 647bp.

[0035] 2. Genotype detection.

[0036] The forward primer 5'-ATCACCTCAGTAAGTAACCAGG-3'(SEQ ID NO. 3) or 5'- ATCACCTCAGTAAGTAACCAGA-3'(SEQ ID NO. 4) and the reverse primer 5'- AAGTCTTTGTCTTGACCAGATG-3'(SEQ ID NO. 5) were used for the fluorescent quantitative PCR amplification of each individual of Exopalaemon carinicauda, and the PCR amplification system was as follows: 1 μl of template DNA, 1 μl of each of the upstream and downstream primers, 10 μl of 2xChamQTM SYBR Color qPCR, 0.4 μl of 50xROX II and 6.6 μl of sterile water. The reaction program of the fluorescent quantitative PCR amplification was as follows: 95℃ for 30 s; 95℃ for 10 s, 60℃ for 30 s, 72℃ for 40 s, 40 cycles; 95℃ for 15 s; 60℃ for 1 min; 95℃ for 15 s. According to the fluorescent quantitative PCR amplification curve, the genotype of each individual at the Ec62238 locus was typed. The genotype of each individual at the Ec62238 locus was obtained, and the results are shown in Table 1. Figure 3 When the cycle number Ct value of the fluorescent quantitative PCR amplification of the forward primer SEQ ID NO. 3 and the reverse primer (SEQ ID NO. 5) is less than that of the forward primer SEQ ID NO. 4 and the reverse primer (SEQ ID NO. 5), and the difference is greater than 4, the genotype of the individual is GG genotype; when the cycle number Ct value of the fluorescent quantitative PCR amplification of the forward primer SEQ ID NO. 3 and the reverse primer (SEQ ID NO. 5) is greater than that of the forward primer SEQ ID NO. 4 and the reverse primer (SEQ ID NO. 5), and the difference is greater than 4, the genotype of the individual is AA genotype; if the difference between the cycle number Ct value of the fluorescent quantitative PCR amplification of the forward primer SEQ ID NO. 3 and the reverse primer (SEQ ID NO. 5) and that of the forward primer SEQ ID NO. 4 and the reverse primer (SEQ ID NO. 5) is less than 1, the genotype of the individual is GA genotype.

[0037] 3. Correlation analysis of Ec62238 locus and clutch size trait.

[0038] The correlation between the Ec62238 locus and the clutch size trait was analyzed by using the generalized linear model GLM of Tassel 5.0 software. The Ec62238 locus was significantly correlated with the clutch size trait, and the phenotypic explanation rate of the Ec62238 marker to the clutch size trait was 3.29% (Table 2). The significance of the difference between different genotypes of Macrobrachium nipponense was compared by using one-way analysis of variance, and it was found that the clutch size of the Macrobrachium nipponense with the GG genotype was significantly higher than that of the Macrobrachium nipponense with the GA and AA genotypes (P<0.05).

[0039] Table 2 Influence of different genotypes of Ec62238 on the clutch size trait of Macrobrachium nipponense

[0040]

[0041] Example 3: Screening of high-reproductive Macrobrachium nipponense female shrimps by using the Ec62238 marker

[0042] The SNP marker Ec62238 obtained in the application can be used to assist in breeding high-reproductive varieties of Macrobrachium nipponense. The application steps are as follows: randomly selecting Macrobrachium nipponense female shrimps, extracting DNA of the samples to be tested and taking the DNA as a template, performing PCR amplification by using the amplification primers of the molecular marker Ec62238 of Example 2, and sequencing the PCR product. If the genotype of the molecular marker Ec62238 in the sequencing result is GG, the test sample of Macrobrachium nipponense can be selected as a parent for breeding high-reproductive varieties of Macrobrachium nipponense.

[0043] The specific operation steps are as follows:

[0044] 1. The population of Macrobrachium nipponense used is 40 full-sibling families of Macrobrachium nipponense bred in the breeding farm of Rizhao Haichen Aquatic Products Co., Ltd., and 96 individual Macrobrachium nipponense are randomly selected from the population, and the related data of reproductive traits such as clutch size, clutch size per unit body length and clutch size per unit body weight are collected. Further, the muscle tissues of the individual Macrobrachium nipponense are taken, and the genomic DNA of each individual is extracted.

[0045] 2. The SNP genotyping detection is performed on each sample of Macrobrachium nipponense. The forward primer 5'-ATCACCTCAGTAAGTAACCAGG-3' (SEQ ID NO. 3) or 5'-ATCACCTCAGTAAGTAACCAGA-3' (SEQ ID NO. 4) and the reverse primer 5'-AAGTCTTTGTCTTGACCAGATG-3' (SEQ ID NO. 5) are used to perform the fluorescent quantitative PCR amplification on each individual Macrobrachium nipponense. According to the fluorescent quantitative PCR amplification curve, the genotype of each individual at the Ec62238 locus is typed.

[0046] 3. The significance of differences between the reproductive traits of female Macrobrachium nipponense with different genotypes of Ec62238 marker was compared by one-way ANOVA. The results showed that the clutch size of female Macrobrachium nipponense with GG genotype was significantly larger than that of individuals with GA and AA genotypes (P<0.05) (Table 3). Therefore, female Macrobrachium nipponense with GG genotype can be selected as the parent of new high-fertility breed to significantly improve the fecundity of Macrobrachium nipponense. Ec62238 marker can be widely used in the screening of high-fertility female Macrobrachium nipponense individuals, and is not limited by their growth and breeding season.

[0047] In addition, Ec62238 marker can also be used for population genetic diversity analysis of Macrobrachium nipponense.

[0048] Table 3 Association analysis of Ec62238 marker and clutch size trait

[0049]

[0050] The above examples are only used to illustrate the technical solutions of the present application, but not to limit it; although the present application has been described in detail with reference to the foregoing examples, the technical solutions recorded in the foregoing examples can still be modified by those of ordinary skill in the art, or some technical features thereof can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions claimed by the present application.

[0051] SEQ ID NO. 6:

[0052] AACATTTTACATATTTCATAAATAACTTTTTAGCATTATTCCTCTCTCAGAAG

[0053] TGGCTAGCTAGTTAGTAAGACAGAACTCATTCCCTTGTAATTCATTTTCTTC

[0054] TTGTGAATGTCAATGAGGGGTTTGGCAAGATACCAATAACCTCTTGTTATAA

[0055] AACTAGGTGTATGATAGGGTTTCCCCATAGAGAACTGACCAGTACAATCTG

[0056] ATGTAAGGAGGCTGTAGTAAATTTTTACAAACATCCCATACACCTAAAGAA

[0057] TTTTATTACA ATGCACCTCT TTCTTTCATC ATATTCCATT ACTGTTTAAA AAA

[0058] CTCATGTAAA TATTTCACTT AATACTGGTA TCAAAAAGAG TACTAAAAAT TC

[0059] CAGACTACTT GGATGCCTCT GGTGTTGGCA ATGATATCAT CTAATGCAAC AC

[0060] CTACCTCCTT CTCTATTCAA TAATTATTTC CATAAATCTT ACCTTTGAAT CATA

[0061] AGCTATTAAT TCAGAAGTGC AACCTTTTTG GCCTTAGAAT GATTGAAACC A

[0062] AAAATTACTC TCCACATCAT CCTCACATCC CTTAGGCAAA CATAAGACTA AC

[0063] ATGCTGATCA CCTCAGTAAG TAACCAGGTG AGTTGGTCTG AACAATTAAC A

[0064] CTAACTAGTG CATCAGTTTA TTCAGTTATC TGCGTTTTTT ACACAGCCTT T

[0065] AGTGCCTAAT TCCTTCCTAG TGGTAACATC TGGTCAAGAC AAAGACTTTT T

[0066] ACTATAGTTC ATTGTGAGGA ATGTAAAGTA AGTCACCTAA GTTATAAGAA C

[0067] TTTCAACTTT CAAAGATATG AACTAGTTTG CGCAATAAAT TAAAAATCAT CT

[0068] ACACAAGTGA AAAGTATTTT AAAAATCAAA TTACGTGGCT GGCTAGCCAA C

[0069] TGAAAATGCT GAAGGGTAAG GGGTGCTATT ATAAGGTGGA TGCCTACGCT G

[0070] CTTATGTTGGACTTTAGAACCTTCGAACTAAAGAACCCACACTTGGAACGA

[0071] GTCTCATTTTCATCAGCGAGACCTACACTAAACATTTATCAAAATCAGATAT

[0072] GAAAACCTATTCAGGTTATGTAGTTATCTTATTTACTTTGGATATAAGGATAT

[0073] GTATTCTTATCTTTTTATGGTGAGGGTTTGTGATGGGTTGAATTAGACAGGA

[0074] TTTATGAATTTGGGCTATCTAACTCAGCACCGAGGTCTGTGAGGCCATTTAG

[0075] CACCCAAG.

Claims

1. Application of SNP marker Ec62238 in breeding of high-egg-carrying excellent varieties of Exopalaemon modestus, characterized in that, Detection primers SEQ ID NO. 1-2 and typing primers SEQ ID NO. 3-5 are designed according to the SNP marker Ec62238; the gene sequence in which the SNP marker Ec62238 is located is shown in SEQ ID NO. 6, the base at the 601st site of the 5' end of the gene sequence is G or A, and the SNP marker Ec62238 is located on the 24th chromosome of Exopalaemon modestus.

2. Application of the typing primer of the SNP marker Ec62238 in breeding of a good variety of Exopalaemon modestus with high egg-carrying capacity, characterized in that, The application method is to perform fluorescent quantitative PCR amplification on sample DNA of Exopalaemon modestus by using the typing primers, to perform SNP marker typing on Exopalaemon modestus individuals according to the amplification results, to determine the genotype of the sample at the Ec62238 site, and to select the GG genotype at the site as the variety breeding parent, and the nucleotide sequence of the typing primers is shown in SEQ ID NO. 3-5.

3. Use according to claim 2, characterized in that, The method for typing Exopalaemon modestus by using the typing primers is to perform PCR fluorescent quantification on Exopalaemon modestus individuals by using a first primer pair and a second primer pair, to analyze the amplification results, the sequence of the forward primer of the first primer pair is SEQ ID NO. 3, and the sequence of the reverse primer is SEQ ID NO. 5; the sequence of the forward primer of the second primer pair is SEQ ID NO. 4, and the sequence of the reverse primer is SEQ ID NO. 5; when the fluorescent quantitative PCR amplification cycle number Ct value of the first primer pair is less than that of the second primer pair, and the difference is greater than 4, the genotype of the individual is GG genotype; when the fluorescent quantitative PCR amplification cycle number Ct value of the first primer pair is greater than that of the second primer pair, and the difference is greater than 4, the genotype of the individual is AA genotype; if the difference between the fluorescent quantitative PCR amplification cycle number Ct value of the first primer pair and that of the second primer pair is less than 1, the genotype of the individual is GA genotype.

Citation Information

Patent Citations

  • Gene where single nucleotide polymorphism (SNP) marker related to growth of exopalaemon carinicauda is located, detection primer and application

    CN112029875A

  • SNP marker g.reelin-936 related to reproduction traits of exopalaemon carinicauda and application of SNP marker g.reelin-936

    CN118272546A