Specific transposon related to chlorophyll content in rice leaf and its application

By detecting the MITE transposon in the promoter region of the rice gene OsSCE1a and using PCR amplification technology to identify the chlorophyll content in rice leaves, the problem of identification difficulties in existing technologies has been solved, and efficient rice breeding and yield improvement have been achieved.

CN119570966BActive Publication Date: 2026-04-28CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2024-11-11
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively identify or assist in identifying the chlorophyll content in rice leaves, which affects the progress of rice breeding and yield.

Method used

The MITE transposon in the promoter region of the rice gene OsSCE1a was used as a molecular marker. The presence of the MITE transposon in the rice genome was detected by PCR amplification, and the chlorophyll content was identified by combining specific PCR primers (SEQ ID NO:2 and SEQ ID NO:3).

Benefits of technology

Accurate identification of chlorophyll content in rice leaves using molecular marker technology can avoid the influence of environmental and human errors, thereby improving the accuracy and efficiency of rice breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119570966B_ABST
    Figure CN119570966B_ABST
Patent Text Reader

Abstract

This invention provides a specific transposon related to the chlorophyll content of rice leaves and its application. The specific transposon provided by this invention is the MITE transposon, which is a DNA fragment with the nucleotide sequence SEQ ID NO:1. Experiments have shown that rice... OsSCE1a Genes can regulate the chlorophyll content of rice, while OsSCE1a The presence of MITE transposons in the promoter region of a gene can affect its performance. OsSCE1a Gene expression, in turn, affects the chlorophyll content of rice leaves. Therefore, by detecting... OsSCE1a The presence of the MITE transposon in the promoter region of a gene can identify or assist in identifying the chlorophyll content of rice leaves. This invention analyzes the chlorophyll content of rice leaves using molecular markers, effectively avoiding the influence of environmental factors and human error on phenotypic identification, and providing a potential approach for rice breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and crop breeding technology, and in particular to a specific transposon that is related to the chlorophyll content of rice leaves and its application. Background Technology

[0002] Premature senescence is a common phenomenon in both indica and hybrid rice, significantly impacting yield. Chlorophyll content is a crucial indicator of leaf senescence. Maintaining high chlorophyll content in rice leaves contributes to increased yield and is a goal pursued in rice breeding. Molecular marker technology, utilizing molecular markers tightly linked to target genes, can accurately identify plants carrying those genes, enabling the transfer and aggregation of beneficial genes, thus shifting from "empirical breeding" to targeted "precision breeding." Therefore, developing molecular markers correlated with rice leaf chlorophyll content, and using these markers to identify or assist in identifying chlorophyll content in rice leaves to accelerate rice breeding progress, is a pressing issue for those skilled in the art. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to identify or assist in identifying the chlorophyll content of rice leaves by means of molecular markers.

[0004] In a first aspect, the present invention provides rice genes. OsSCE1a The application of the MITE transposon in the promoter region, wherein the MITE transposon is a DNA fragment with the nucleotide sequence SEQ ID NO:1, and the application is selected from any one of A1)-A4):

[0005] A1) Application in identifying or assisting in identifying the chlorophyll content of rice leaves;

[0006] A2) Application in the preparation of products for identifying or assisting in the identification of chlorophyll content in rice leaves;

[0007] A3) Application in rice breeding;

[0008] A4) Application in the preparation of rice breeding products.

[0009] In the application described above, SEQ ID NO:1 is specifically as follows:

[0010] 5'-GGGCCCCTTTGATTTGGGGGAAAACATAGGAATTTTAGAGGATTTCAATCCTATAGGAAAATTTCCTATGAAGCCCTTTGAAACAAAGGATTGAATCCTATCCAATCCTTTGAAATTCCTATGGAATGGACAATCCTATAGAGATTTTGGAGGAAATTTAGCAAGAGCTTCAACCTCTTGCTA ACTTTCCTTTGAGTCTATCTCTCATCCAATTCTTGTGTTTTTCCTGTGGTTCAATCAAACGGTCATTCCTGTGTTTTTCCTGTGTTTTGTTATCCTCTGTTTTACACTTACATTCCTATCAAAATCCTACGTTTTTCCTATTCCTACGTTTTCTCAATCCTGCGATTCAAAGGGGCCTTAA-3'.

[0011] Secondly, this invention provides a method for detecting rice genes. OsSCE1a The application of a substance whose promoter region contains a MITE transposon, wherein the MITE transposon is a DNA fragment with the nucleotide sequence SEQ ID NO:1, and the application is selected from any one of A1)-A4):

[0012] A1) Application in identifying or assisting in identifying the chlorophyll content of rice leaves;

[0013] A2) Application in the preparation of products for identifying or assisting in the identification of chlorophyll content in rice leaves;

[0014] A3) Application in rice breeding;

[0015] A4) Application in the preparation of rice breeding products.

[0016] In the application described above, the indicators for rice breeding include the chlorophyll content of rice leaves, specifically referring to the cultivation of rice varieties with altered chlorophyll content in their leaves. Furthermore, the goal of rice breeding is to cultivate rice varieties with higher chlorophyll content in their leaves than the recipient rice.

[0017] In the applications described above, rice genes are detected. OsSCE1a The substance whose promoter region contains MITE transposons is selected from at least one of B1)-B2):

[0018] B1) Reagents required for gene sequencing;

[0019] B2) PCR primers for amplifying rice genomic DNA fragments containing the MITE transposon.

[0020] Furthermore, the PCR primers include a first primer and a second primer, wherein the first primer is a single-stranded DNA that specifically binds to the upstream of the MITE transposon in the rice genomic DNA, and the second primer is a single-stranded DNA that specifically binds to the downstream of the MITE transposon in the rice genomic DNA.

[0021] Furthermore, the first primer is a single-stranded DNA with the nucleotide sequence SEQ ID NO:2, and the second primer is a single-stranded DNA with the nucleotide sequence SEQ ID NO:3.

[0022] SEQ ID NO: 2: 5'-TTCATATGAGCCCTACCTGAG-3';

[0023] SEQ ID NO: 3: 5'-CAAACTCTAGCGCAACGATTA-3'.

[0024] Furthermore, taking the superior indica rice variety 93-11 containing the MITE transposon as an example, the genome of the superior indica rice variety 93-11 was amplified by PCR using the above primers. The nucleotide sequence of the amplified product is SEQ ID NO:4, which includes the 367 bp MITE transposon shown in SEQ ID NO:1 (as shown underlined). Correspondingly, the chlorophyll content of the rice leaves is low.

[0025] SEQ ID NO:4:

[0026] 5'-TTCATATGAGCCCTACCTGAGTAAATTAGTTTTTTTAGTCAAAAAGATGTGCCATGCCCCATACTAGGTTTATTTTTTATGGGACGGAGGGAGTAAAGTTTTAGCCTTCGATACATGTGTTAAGTAGTTGCCTTCTTAATGTGGGTAAGATATAGGTCTGAACTAGTTAGGGCCCCTTTGAATCGAAGGGTAGAAAAAAACGGAGGAATAGGAAAAACACAGGATTCTG ACAGGAATTGAAGTGTAAAACAGAGGATTGCAAAACACAGGAAAAACACAGGAATGGTCGTTTGATTGGAGCACAGGAAAACGCAGGAATCGGATGAGAGAGATAGACTCAAAGAAATTTTCCAAGAGGTTGGAGCTCTTGCCAAATTTCCTCCAAAATCCACATGCAATATGCCATTCCATAGGAATTTCATAGGATTTGGAAAACTTCAATCCTTTGAATCAAAAGGCTAA GGGCCCCTTTGATTTGGGGGAAAAACATAGGAATTTTAGAGGATTTCAATCCTATAGGA AAATTTCCTATGAAGCCCTTTGAAACAAAGGATTGAATCCTATCCAATCCTTTGAAATTCCTATGGAATGGACAAT CCTATAGAGATTTTGGAGGAAATTTAGCAAGAGCTTCAACCTCTTGCTAACTTTCCTTTGAGTCTATCTCTCTCAT CCAATTCTTGTGTTTTTCCTGTGGTTCAATCAAACGGTCATTCCTGTGTTTTTCCTGTGTTTTGTTATCCTCTGTT TTACACTTACATTCCTATCAAAATCCTACGTTTTTCCTATTCCTACGTTTTCTCAATCCTGCGATTCAAAGGGGCC TTAA ATAGGAAATTTCCTATAGGATTTGAATCCTATGAAATTCCTACATAAATCCTTTGATTCAAAGGGGACCTTAGAGTTGTAACAAACCAATGGGTAGTACGGATAGTGTGGGCAGTAAAATGATAAAAGTCACATTTAAAATGATAATTGTGGATAGCCTTTTCACTTGTCTTAAAATAAGTTTACTTTTAGAATAATCGTTGCGCTAGAGTTTG-3'.

[0027] Furthermore, taking the introgression line material 9YJ30, constructed through hybridization and backcrossing using common wild rice from Yuanjiang, Yunnan as the donor parent and superior indica rice variety 93-11 as the recurrent parent, as an example, the genome of the introgression line material 9YJ30 was amplified by PCR using the above primers. The nucleotide sequence of the amplification product is SEQ ID NO:5, which does not include the 367 bp MITE transposon shown in SEQ ID NO:1. Correspondingly, the chlorophyll content of the rice leaves is relatively high.

[0028] SEQ ID NO:5:

[0029] 5'--3'.

[0030] Furthermore, the chlorophyll content of rice leaves can be determined by performing gel electrophoresis on the amplified products and analyzing the length of the amplified products.

[0031] Thirdly, this invention provides a method for identifying or assisting in the identification of chlorophyll content in rice leaves, including detecting the genes of the rice being tested. OsSCE1a The promoter region of the sample contains the MITE transposon, which is a DNA fragment with the nucleotide sequence SEQ ID NO:1. The chlorophyll content of the tested rice leaves containing the MITE transposon is lower, while the chlorophyll content of the tested rice leaves not containing the MITE transposon is higher.

[0032] Fourthly, the present invention provides a method for breeding rice varieties with high chlorophyll content in their leaves, including detecting genes in the rice to be tested. OsSCE1a The promoter region of the rice contains the MITE transposon, which is a DNA fragment with the nucleotide sequence SEQ ID NO:1; rice varieties that do not contain the MITE transposon are selected to obtain rice varieties with higher chlorophyll content in their leaves.

[0033] In the above method, the rice gene to be tested is detected. OsSCE1a The determination of whether the promoter region contains the aforementioned MITE transposon specifically includes: using the genomic DNA of the rice to be tested as a template, performing PCR amplification with PCR primers that amplify rice genomic DNA fragments containing the MITE transposon to obtain PCR products, and determining the rice gene to be tested based on the length of the PCR products. OsSCE1a The promoter region of the rice plant contains the MITE transposon, thereby determining the chlorophyll content of the rice leaves being tested.

[0034] Furthermore, the PCR primers include a first primer and a second primer, wherein the first primer is a single-stranded DNA that specifically binds to the upstream of the MITE transposon in the rice genomic DNA, and the second primer is a single-stranded DNA that specifically binds to the downstream of the MITE transposon in the rice genomic DNA.

[0035] Furthermore, the first primer is a single-stranded DNA with the nucleotide sequence SEQ ID NO:2, and the second primer is a single-stranded DNA with the nucleotide sequence SEQ ID NO:3.

[0036] Fifthly, the present invention provides a DNA molecule, wherein the DNA molecule is a DNA molecule with the nucleotide sequence SEQ ID NO:1.

[0037] In a sixth aspect, the present invention provides PCR primers for identifying or assisting in the identification of chlorophyll content in rice leaves to be tested. The PCR primers include a first primer and a second primer. The first primer is a single-stranded DNA that specifically binds to the upstream of the MITE transposon in the rice genomic DNA, and the second primer is a single-stranded DNA that specifically binds to the downstream of the MITE transposon in the rice genomic DNA. The MITE transposon is a DNA fragment with the nucleotide sequence SEQ ID NO:1.

[0038] Furthermore, the first primer is a single-stranded DNA with the nucleotide sequence SEQ ID NO:2, and the second primer is a single-stranded DNA with the nucleotide sequence SEQ ID NO:3.

[0039] In a seventh aspect, the present invention provides a kit for identifying or assisting in the identification of the chlorophyll content in rice leaves to be tested, including the above-mentioned PCR primers.

[0040] This invention provides a specific transposon related to the chlorophyll content of rice leaves and its application. Experiments have shown that it is effective in rice. OsSCE1a The presence of MITE transposons in the gene promoter region affects OsSCE1a Gene expression, in turn, affects the chlorophyll content in rice leaves; therefore, detection... OsSCE1a The presence of the MITE transposon in the promoter region of a gene can determine the chlorophyll content of rice leaves. This invention uses molecular markers to identify or assist in the identification of chlorophyll content in rice leaves, avoiding the influence of environmental factors and human error on phenotypic identification, and providing a potential approach for rice breeding. Attached Figure Description

[0041] Figure 1 for OsSCE1a The expression analysis results; where a represents the expression of different tissues in the infiltrated material 9YJ30 during the heading stage. OsSCE1a The results of relative expression analysis; b represents the growth of superior indica rice variety 93-11 and introgression line material 9YJ30 to the seedling stage after 30 days of greenhouse cultivation. OsSCE1a The relative expression levels were analyzed; c represents the expression levels of the superior indica rice variety 93-11 and the introgression line material 9YJ30 at the jointing stage, specifically in the first (FL), second (SL), third (TL), and fourth (FTL) leaves from top to bottom. OsSCE1a The relative expression levels were analyzed; d represents the expression level of the first leaf (FL) from top to bottom when the superior indica rice variety 93-11 and the infiltration line material 9YJ30 reached the heading stage. OsSCE1a The results of the relative expression level analysis; P < 0.01 indicates a significant difference, and ns indicates no significant difference.

[0042] Figure 2 for OsSCE1a The results of gene structure analysis; where a is OsSCE1a The gene structure is shown in the diagram. Black boxes represent exons, I (-2544-2178) represents a 367 bp insertion, D represents a 367 bp deletion, yellow boxes represent 367 bp MITEs, the solid black lines between the black boxes represent introns, white boxes represent 5'-UTR and 3'-UTR, and red lines represent SNPs and an 8 bp indel. The scale bar is 100 bp. b represents the gene structure in the diagram. OsSCE1a A 367 bp sequence was inserted into the promoter;

[0043] Figure 3 forOsSCE1a Results of transient expression analysis of promoters; This indicates that P < 0.01. This indicates that P < 0.05;

[0044] Figure 4 For MITE transposons and OsSCE1a The correlation analysis results between expression levels and chlorophyll content in rice leaves; where a represents the statistical results of SPAD values ​​of leaves from 115 rice materials at the heading stage; b represents the SPAD values ​​of leaves from 115 rice materials at the heading stage. OsSCE1a The results of the relative expression level analysis; This indicates that P < 0.01;

[0045] Figure 5 The results of MITE site detection are shown for 40 rice materials, where M represents a marker, I represents a 367 bp insertion, and D represents a 367 bp deletion. Detailed Implementation

[0046] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, embodiments of this invention, and should not be construed as limiting the invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention. In the description of this invention, it should be understood that the terminology used is for descriptive purposes only and should not be construed as indicating or implying relative importance.

[0047] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0048] The introgression line 9YJ30 in the following examples was constructed through hybridization and backcrossing from common wild rice from Yuanjiang, Yunnan, using Yunnan Yuanjiang as the donor parent and the superior indica rice variety 93-11 as the recurrent parent. Introgression line 9YJ30 with high chlorophyll content and an earlier heading date was selected. Introgression line 9YJ30 has been described in: Fu Q, Zhang P, Tan L, Zhu Z, Ma D, Fu Y, Zhan X, Cai H, Sun C. Analysis of QTLs for yield-related traits in Yuanjiang common wild rice (…). Oryza rufipogon Griff.). J GenetGenomics. 2010 Feb;37(2):147-57. doi: 10.1016 / S1673-8527(09)60033-3. PMID:20227048. The biological material is available to the public from the applicant and is intended solely for the purpose of replicating experiments of this invention and may not be used for any other purpose.

[0049] The primer sequences used in the following examples are shown in Table 1.

[0050] Table 1 Primers and their nucleotide sequences involved in the embodiments of the present invention

[0051]

[0052] Example 1: Effects on rice OsSCE1a Discovery of gene expression-specific transposons

[0053] 1. OsSCE1a It is a target gene that regulates the chlorophyll content of rice, and can be downregulated, inhibited, or reduced. OsSCE1a The expression level of this substance can enhance the chlorophyll content of rice leaves. This example focuses on the expression of this substance in the superior indica rice variety 93-11 and the infiltration line material 9YJ30. OsSCE1a The relative expression levels were analyzed, and the specific analysis is as follows:

[0054] 1.1 Samples were extracted from eight parts of the superior indica rice variety 93-11: leaf, leaf sheath, leaf pillow, node, young panicle, stem base, stem, and root. RNA was extracted from the samples, and cDNA was obtained through reverse transcription. OsSCE1aBased on the coding sequence, primers OsSCE1a-F and OsSCE1a-R were designed. RT-qPCR was performed using the extracted cDNA as a template, with Ubq (…) as the base. LOC_Os03g13170 The internal reference gene was used, and the primers for amplifying the internal reference gene were Ubq-F and Ubq-R. The experiment was set up in triplicate and used a two-tailed primer. t Test whether the difference is significant, and the test results are as follows: Figure 1 As shown in Figure a.

[0055] according to Figure 1 From a, we can know that OsSCE1a The highest expression level was observed in the leaves of the superior indica rice variety 93-11.

[0056] 1.2 Using the same method as in 1.1, the superior indica rice variety 93-11 and the infiltration line material 9YJ30 were cultured in a greenhouse for 30 days, and the seedling stage was tested. OsSCE1a The relative expression level, the detection results are as follows Figure 1 As shown in Figure b, it can be seen that... OsSCE1a The expression level in the superior indica rice variety 93-11 was higher than that in the introgression line material 9YJ30.

[0057] 1.3 Using the same method as in 1.1, after the superior indica rice variety 93-11 and the infiltrated line material 9YJ30 reached the jointing stage, the jointing of different leaves (first leaf (FL), second leaf (SL), third leaf (TL), and fourth leaf (FTL)) was tested. OsSCE1a The relative expression levels, test results are as follows Figure 1 As shown in Figure c, it can be seen that as rice leaves age, OsSCE1a The relative expression level of the compound showed a consistent decreasing trend in the superior indica rice variety 93-11 and the infiltrated line material 9YJ30.

[0058] 1.4 Using the same method as in 1.1, when the superior indica rice variety 93-11 and the infiltrated line material 9YJ30 reached the heading stage, the concentration of [unclear - possibly referring to a specific substance or component] in the first leaf (FL) from top to bottom was tested. OsSCE1a The relative expression levels, test results are as follows Figure 1 As shown in d, it can be seen that OsSCE1a The expression level in the superior indica rice variety 93-11 was higher than that in the introgression line material 9YJ30.

[0059] The above results indicate that OsSCE1a Differences in expression led to phenotypic differences between the superior indica rice variety 93-11 and the infiltrated line material 9YJ30.

[0060] 2. Genetic analysis of superior indica rice variety 93-11 and the introgression line 9YJ30 from Yuanjiang, Yunnan. OsSCE1aThe structure was analyzed, and the results are as follows: Figure 2 As shown, it can be seen that OsSCE1a The coding region sequences were identical, but in the infiltrated line material 9YJ30, the gene... OsSCE1a The promoter contains a 367 bp deletion, which is a miniature inverted transposable element (MITE). The nucleotide sequence of the MITE is SEQ ID NO:1, as shown below:

[0061] 5'-GGGCCCCTTTGATTTGGGGGAAAACATAGGAATTTTAGAGGATTTCAATCCTATAGGAAAATTTCCTATGAAGCCCTTTGAAACAAAGGATTGAATCCTATCCAATCCTTTGAAATTCCTATGGAATGGACAATCCTATAGAGATTTTGGAGGAAATTTAGCAAGAGCTTCAACCTCTTGCTA ACTTTCCTTTGAGTCTATCTCTCATCCAATTCTTGTGTTTTTCCTGTGGTTCAATCAAACGGTCATTCCTGTGTTTTTCCTGTGTTTTGTTATCCTCTGTTTTACACTTACATTCCTATCAAAATCCTACGTTTTTCCTATTCCTACGTTTTCTCAATCCTGCGATTCAAAGGGGCCTTAA-3'.

[0062] 3. Detection of MITE transposon pairing with genes using a luciferase transient expression assay. OsSCE1a Regulatory activity

[0063] 3.1 Constructing the LUC carrier

[0064] Using DNA from the superior indica rice variety 93-11 and the introgression line 9YJ30 from the Yuanjiang wild rice of Yunnan as templates, primers 93-11- ... OsSCE1a pro -LUC-F and 93-11- OsSCE1a pro PCR amplification was performed using the -LUC-R vector, and the amplification product was ligated into the pGreenII-0800-LUC vector using homologous recombination to obtain plasmid 93-11- OsSCE1a pro -LUC and 9YJ30- OsSCE1a pro -LUC.

[0065] 93-11- OsSCE1a proThe 367 bp MITE transposon in the LUC plasmid was mutated to form the M1 plasmid, and the 367 bp MITE transposon was inserted into 9YJ30- OsSCE1a pro In the -LUC plasmid, the M2 plasmid is formed.

[0066] 3.2. Introduce the plasmid prepared in 3.1 into rice protoplasts:

[0067] (1) Select about 200 seeds, and after threshing, disinfection and other treatment steps, inoculate them on 1 / 2 MS medium and then culture them in the dark at 28°C for 10 days.

[0068] (2) Remove the roots and leaves of the seeds, and use a blade to cut the stem into slices of about 0.5 mm. Then transfer these slices to an Erlenmeyer flask containing 20 ml of enzymatic hydrolysate (including 0.3 g 1.5% Celluase R-10, 0.06 g 0.3% Macerozyme R-10, 1.458 g D-Mannitol, 200 µl 0.2 M MES, 0.1×W5 resuspension, and ddH2O to make up to 20 ml, pH 5.7). The Erlenmeyer flask should be properly wrapped with aluminum foil.

[0069] (3) Place the Erlenmeyer flask in a vacuum environment (-20 kPa), wait for 30 min, and then shake it slowly at 28 ℃ and 40 rpm for 4 h.

[0070] (4) Carefully and slowly aspirate the enzyme hydrolysate, then add 20 ml of W5 resuspension (100 ml of W5 resuspension includes 5 M NaCl, 1 M CaCl2, 1 M KCl, 0.2 M MES, pH=5.7). Shake slowly at 80 rpm for 1 h at 28 ℃;

[0071] (5) Filter the solution into a 50 ml centrifuge tube using a Miracloth membrane, then centrifuge at 1000 rpm for 5 min at room temperature (using the lowest acceleration and deceleration speed), and carefully remove the supernatant;

[0072] (6) Add 10 ml of W5 resuspension and gently stir to resuspend. Then centrifuge at 1000 rpm for 5 min at room temperature (using the lowest acceleration and deceleration rate) and carefully remove the supernatant;

[0073] (7) According to the required number of transformations (200 µl of protoplasts are required for each sample), add an appropriate amount of mg resuspension solution (1.458 g D-Mannitol, 1 M CaCl2 400 µl, 0.2 M MES 500 µl, ddH2O to make up to 20 ml, pH 5.7), shake gently to fully resuspend, and obtain protoplasts;

[0074] (8) Add 10 µg of the 93-11- prepared in 3.1 above to each 2 ml centrifuge tube. OsSCE1a pro -LUC、9YJ30- OsSCE1a pro - Gently add 200 µl of protoplasts to LUC, M1 and M2 plasmids, then add 220 µl of 40% PEG4000, shake gently to mix evenly, and then let stand at room temperature in the dark for 20 min;

[0075] (9) Add 1 ml of W5 resuspension, shake gently to mix evenly, then centrifuge at 1000 rpm for 3 min at room temperature (using the lowest acceleration and deceleration speed), carefully remove the supernatant, add another 1 ml of W5 resuspension, and then let stand at 28°C in the dark for 14-20 h.

[0076] 3.3 LUC Chemiluminescence Detection:

[0077] (1) Centrifuge at 1000 rpm for 3 min at room temperature and remove 800 µl of supernatant;

[0078] (2) Using the Dual Luciferase Reporter Assay Kit (catalog number DL101-01) manufactured by Vazyme, activate the fluorescence according to the steps and measure the fluorescence value using the Tecan Spark multi-functional microplate reader.

[0079] Experimental results are as follows Figure 3 As shown, it can be seen that in the genome of the superior indica rice variety 93-11 OsSCE1a After the MITE transposon in the promoter region is mutated, OsSCE1a The expression activity decreased, while when the Yunnan Yuanjiang wild rice infiltrated the genome of material 9YJ30 OsSCE1a After inserting the MITE transposon into the starter sub-region OsSCE1a The increased expression activity of MITE indicates that MITE is... OsSCE1a The functional sites of these sites affect the chlorophyll content in rice leaves.

[0080] Example 2: Establishment of a method for detecting chlorophyll content in rice leaves

[0081] This embodiment measured the chlorophyll content of leaves from 116 rice samples from 39 countries and regions. The origin, variety name, and subspecies classification of the 116 rice samples are shown in Table 2. The 116 rice samples were planted at the Shangzhuang Experimental Station of China Agricultural University (40.1°N, 116.1°E). When the rice reached the heading stage, the chlorophyll content (SPAD) of the flag leaf was measured using a handheld chlorophyll meter (SPAD-502, Minolta Camera Co., Osaka, Japan). The measurement results are shown in Table 2.

[0082] DNA was extracted from 116 rice samples, and then PCR amplification was performed using primers SEQ ID NO:2 and SEQ ID NO:3. PCR amplification was performed using KOD Fx high-fidelity enzyme manufactured by TOYOBO. The amplification system is shown in Table 3, and the amplification program is shown in Table 4. After the amplification system was prepared, 20 µl of liquid paraffin was added to prevent evaporation at high temperatures. The rice containing the MITE transposon was named Hap. 93-11 Rice lacking the MITE transposon was named Hap 9YJ30 .

[0083] Table 2. Chlorophyll content and amplification product results of leaves from 116 rice materials.

[0084]

[0085]

[0086]

[0087]

[0088] In Table 2, 'a' represents the insertion and deletion of 367 bp transposons, where 'D' represents deletion and 'I' represents insertion. Ind Indicating indica rice, ​ It refers to japonica rice. ​ This refers to temperate japonica rice. ​ It refers to tropical japonica rice.

[0089] Table 3 PCR amplification system

[0090]

[0091] Table 4 PCR Amplification Program

[0092]

[0093] PCR amplification results of some rice materials are as follows: ​As shown, I indicates the presence of the MITE transposon, and D indicates the absence of the MITE transposon.

[0094] The data shown in Table 2 was initially organized using Excel. A significance analysis was performed using the ANOVA model in GraphPad Prism 8 software, and the results are expressed as mean ± standard deviation. GraphPad Prism 8 software was then used to create the graphs.

[0095] The results are as follows ​ As shown in Figure a, it can be seen that Hap 93-11 A lower SPAD value (containing MITE transposons) indicates a lower chlorophyll content in the leaves, while Hap 9YJ30 A higher SPAD value (without MITE transposons) indicates a higher chlorophyll content in the leaves, suggesting that the presence of MITE transposons is related to the chlorophyll content of rice leaves. MITE transposons can be used as molecular markers for the identification or auxiliary identification of chlorophyll content in rice leaves.

[0096] Using the same method as in Example 1, 116 rice samples were tested. ​ The relative expression levels were tested and statistically analyzed, and the results are as follows: ​ As shown in b, it can be seen that Hap 93-11 middle ​ The relative expression level of Hap was significantly higher than that of Hap. 9YJ30 middle ​ The relative expression levels further demonstrate the reliability of the results.

[0097] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Detection of rice genes OsSCE1a The application of substances whose promoter regions contain MITE transposons is characterized by, The nucleotide sequence of the MITE transposon is SEQ ID NO:1, and the application is selected from any one of A1)-A2): A1) Application in identifying or assisting in identifying the chlorophyll content of rice leaves; A2) Application in the preparation of products for identifying or assisting in the identification of chlorophyll content in rice leaves; The application includes: using the genomic DNA of the rice to be tested as a template, performing PCR amplification with PCR primers that amplify rice genomic DNA fragments containing the MITE transposon to obtain PCR products; determining whether the promoter region of the rice gene OsSCE1a to be tested contains the MITE transposon based on the length of the PCR products; and determining the chlorophyll content of the leaves of the rice to be tested; wherein, the leaves of the rice to be tested containing the MITE transposon have lower chlorophyll content, and the leaves of the rice to be tested without the MITE transposon have higher chlorophyll content. The nucleotide sequences of the PCR primers are SEQ ID NO:2 and SEQ ID NO:

3.

2. A method for identifying or assisting in the identification of chlorophyll content in rice leaves, characterized in that, Including the detection of genes in rice samples OsSCE1a Whether the promoter region contains the MITE transposon, wherein the nucleotide sequence of the MITE transposon is SEQ ID NO:1; Using the genomic DNA of the rice to be tested as a template, PCR amplification was performed using PCR primers that amplify rice genomic DNA fragments containing the MITE transposon. The length of the PCR product was used to determine the rice gene to be tested. OsSCE1a The promoter region of the rice plant contains the MITE transposon, thereby determining the chlorophyll content of the rice leaves being tested. Rice leaves containing the MITE transposon have lower chlorophyll content, while rice leaves not containing the MITE transposon have higher chlorophyll content. The nucleotide sequences of the PCR primers are SEQ ID NO:2 and SEQ ID NO:

3.

3. A method for selecting rice varieties with high chlorophyll content in their leaves, characterized in that, Including the detection of genes in rice samples OsSCE1a The promoter region of the rice gene OsSCE1a is determined to contain the MITE transposon, the nucleotide sequence of which is SEQ ID NO:

1. Using the genomic DNA of the rice to be tested as a template, PCR amplification is performed using PCR primers that amplify rice genomic DNA fragments containing the MITE transposon to obtain PCR products. The length of the PCR products determines whether the promoter region of the rice gene OsSCE1a contains the MITE transposon. Rice varieties that do not contain the MITE transposon are selected to obtain rice with high chlorophyll content in leaves. The nucleotide sequences of the PCR primers are SEQ ID NO:2 and SEQ ID NO:3.