Exosome medicine for treating endometrial injury as well as preparation method and application of exosome medicine

Abstract

The invention relates to the technical field of endometrial injury treatment, in particular to an exosome medicine for treating endometrial injury and a preparation method and application of the exosome medicine. The exosome drug comprises an exosome Exo-miR-26a-5p / 543, and the exosome Exo-miR-26a-5p / 543 is carried with the miRNA-26a-5p and the miRNA-543 at the same time. The exosome Exo-miR-26a-5p / 543 contained in the exosome medicine contains miR-26a-5p and miR-543 at the same time, and the excellent effect of treating endometrial injury is achieved through the synergistic effect of the two kinds of exogenous genes. Besides, when the exosome Exo-miR-26a-5p / 543 is prepared, magnetized water is added into a culture medium in an enlarged culture stage, so that the metabolism of the recombinant MSC and the secretion process of the exosome can be regulated and controlled, and the treatment effect of the exosome medicine on endometrial injury is further improved.

Description

Technical Field

[0001] The present application relates to the technical field of endometrial damage treatment, and in particular to an exosome drug for treating endometrial damage, and a preparation method and application thereof. Background Art

[0002] The endometrium is divided into a functional layer and a basal layer, of which the functional layer accounts for two-thirds of the endometrial surface and is shed periodically under the influence of ovarian sex hormones, forming menstruation. Endometrial damage generally refers to damage to the functional layer, which is more common in frequent intrauterine surgery and endometritis, etc., resulting in reduced menstrual blood volume, irregular vaginal bleeding, and lumbosacral pain, causing intrauterine adhesions (endometrial fibrosis), leading to infertility or habitual abortion. Endometritis is a mucous or purulent inflammation, usually an acute inflammation caused by urine, semen, bacteria, fungi, etc. entering the uterus. If acute inflammation caused by multiple reasons exists at the same time and is prolonged, it will develop into a chronic inflammation, delaying or preventing conception.

[0003] Lipopolysaccharide is an important component of the outer membrane of pathogenic Gram-negative bacteria and a major virulence factor. Injection into the uterus can induce endometrial cells to produce a large number of proinflammatory factors (such as interleukin-1β, tumor necrosis factor α, and interleukin-6). Intense inflammation (congestion, swelling, endometrial cell necrosis, and inflammatory cell infiltration) can form locally within 24 hours. This method is often used to establish an acute inflammation model of the endometrium in animals. Multiple curettage can cause chronic inflammation of the endometrium (intrauterine adhesions), delay or prevent conception, and pathologically show increased expression of α-smooth muscle actin and fibronectin 1 and decreased expression of E-cadherin in endometrial cells. It is often used to establish a chronic inflammation model. The combination of multiple curettage and lipopolysaccharide double injury can lead to complex endometrial damage, which is similar to the situation of clinical infertility patients.

[0004] In recent years, mesenchymal stem cells (MSC), stem cell exosomes (Exosomes, Exo) and gene-modified exosome drugs have attracted extensive attention due to their low tumorigenicity, rapid onset and strong efficacy. The microRNA (miR) contained in them is the main functional and active substance, which can play a role in gene therapy. However, the therapeutic effect of exosome drugs in the prior art on endometrial damage is limited to a certain extent, and it cannot effectively treat complex endometrial damage. Therefore, it is necessary to provide a new exosome drug for the treatment of endometrial damage. Summary of the invention

[0005] In order to solve the technical problem that existing exosome drugs have poor therapeutic effects on endometrial damage, the present application provides an exosome drug for treating endometrial damage, which can significantly improve the therapeutic effect of endometrial damage and effectively restore fertility.

[0006] To this end, the first aspect of the present application provides an exosome drug for treating endometrial damage, wherein the exosome drug includes exosomes Exo-miR-26a-5p / 543 carrying both miRNA-26a-5p and miRNA-543.

[0007] In the present application, the miRNA-26a-5p in the exosome Exo-miR-26a-5p / 543 can inhibit multiple inflammatory cytokines in endometrial cells, such as interleukin 1β, tumor necrosis factor α and interleukin 6), thereby reducing acute endometrial inflammation, while the miR-543 in the exosome Exo-miR-26a-5p / 543 can regulate multiple fibrosis-related factors in endometrial cells, such as α-smooth muscle actin, fibronectin 1 and E-cadherin, thereby relieving chronic endometrial inflammation (intrauterine adhesions). The exosome Exo-miR-26a-5p / 543 in the present application contains both the exogenous gene miR-26a-5p and the exogenous gene miR-543. These two exogenous genes synergistically affect the metabolism related to endometrial damage, and ultimately significantly improve the therapeutic effect of endometrial damage. Specifically, compared with the treatment of endometrial damage with only one of the exogenous genes (exogenous gene miR-26a-5p or exogenous gene miR-543), the results of animal experiments showed that after treatment with the exosomes Exo-miR-26a-5p / 543 of the present application, multiple inflammatory cytokines and fibrosis-related factors in the serum of female mice were significantly improved, and the ability to conceive and reproduce could be restored, solving the problem that the existing model mice still have the phenomenon of delayed or prevented conception after exosome treatment.

[0008] In some embodiments, the exosome drug is a liquid preparation, and the content of exosome Exo-miR-26a-5p / 543 in the exosome drug is (1-10)×10 11 Pieces / mL.

[0009] The exosome drug in the present application can be a solid preparation or a liquid preparation, preferably a liquid preparation. The solid preparation can be, for example, a gelatin capsule, a soft capsule, a lozenge, a chewing gum, and a dry powder, and the liquid preparation can be, for example, a spray and a solution. In order to adapt to the use environment, when preparing the exosome drug of the relevant dosage form, conventional components can be added by conventional means to make the exosome drug of the present application meet the requirements of the relevant drug dosage form.

[0010] In the present application, the number of exosomes in the exosome drug of the liquid preparation is controlled within the above range, so that a sufficient amount of the exogenous genes (miRNA-26a-5p and miRNA-543) carried by the exosomes can fully exert their effects inside and outside the target cells, and thus be effectively used for the treatment of endometrial damage.

[0011] In some embodiments, the exosome medicine contains magnetized water.

[0012] The inventors of this application creatively discovered that when the exosome drug in the liquid preparation contains magnetized water, the exosome drug has a more excellent therapeutic effect, which is mainly manifested in a significant shortening of the treatment time, which is shortened from 4 weeks to within 3 weeks. The reason may be that the magnetized water has a certain regulatory effect on the membrane structure of the exosome, so that the exosome can be fully released to the target; or after the magnetized water enters the target cell, it affects the metabolism of the target cell, and the combined action of the magnetized water and the exosome significantly accelerates the treatment cycle.

[0013] In some embodiments, the method for preparing the magnetized water comprises: magnetizing water in a magnetic field strength of 500 to 1000 T for 1 to 3 hours to obtain the magnetized water.

[0014] In some specific implementations, the magnetic field strength during the preparation of the magnetized water can be, for example, 500T, 550T, 600T, 650T, 700T, 750T, 800T, 850T, 900T, 950T or 1000T, etc.; the magnetization time can be, for example, 1h, 1.3h, 1.5h, 1.8h, 2.0h, 2.3h, 2.5h, 2.8h or 3.0h, etc.

[0015] In some preferred embodiments, the method for preparing the magnetized water comprises: magnetizing water in a magnetic field strength of 650 to 850 T for 1.5 to 2.5 hours to obtain the magnetized water.

[0016] The present application helps to further enhance the therapeutic effect of exosome drugs by optimizing the magnetic field strength and magnetization time during the preparation of magnetized water.

[0017] In some specific embodiments, when the exosome drug is in solution dosage form, the exosome drug may include: a cell culture fluid that secretes the exosomes Exo-miR-26a-5p / 543 and the exosomes Exo-miR-26a-5p / 543; or include: a cell culture fluid that secretes the exosomes Exo-miR-26a-5p / 543, the exosomes Exo-miR-26a-5p / 543 and magnetized water.

[0018] The second aspect of the present application provides a method for preparing the exosome drug as described in the first aspect of the present application, the method comprising the following steps: S1, contacting mesenchymal stem cells with a recombinant lentivirus and then culturing them to obtain recombinant mesenchymal stem cells, wherein the recombinant lentivirus includes miR-26a-5p and miR-543; S2, expanding and culturing the recombinant mesenchymal stem cells, and collecting the culture supernatant, which is the exosome drug for treating endometrial damage.

[0019] The present application adopts the above method to insert the genes miR-26a-5p and miR-543 into the genome of the lentivirus and then transfect mesenchymal stem cells, and then culture the recombinant mesenchymal stem cells (recombinant MSC) to obtain the exosome drug required by the present application.

[0020] In the present application, the mesenchymal stem cells used in step S1 can be, for example, adipose mesenchymal stem cells and umbilical cord mesenchymal stem cells. Mesenchymal stem cells, also known as multipotent stromal cells, referred to as MSC, are a type of typical cell population that can self-renew and have multidirectional differentiation potential. The exosomes secreted by mesenchymal stem cells not only have certain functional characteristics of MSC, but also have advantages such as low toxicity, non-tumorigenicity, good permeability, and no risk of vascular occlusion. The mesenchymal stem cells used in the present application can be from any source, such as bone marrow, placenta, umbilical cord, fat, mucosa, bone, muscle, lung, liver, pancreas and other tissues. Mesenchymal stem cells come from animals, typically mammals, for example, mice, rats, rabbits, goats, lambs, sheep, horses, pigs, cattle, preferably primates, and most preferably humans.

[0021] In some embodiments, in step S1, the gene sequence of the lentivirus used in preparing the recombinant lentivirus is shown as SEQ ID NO:1, the gene sequence of the miR-26a-5p is shown as SEQ ID NO:2, and the gene sequence of the miR-543 is shown as SEQ ID NO:3.

[0022] In some specific embodiments, the recombinant lentivirus further includes a resistance screening gene and a fluorescent marker gene, wherein the resistance screening gene is used to obtain recombinant mesenchymal stem cells containing the recombinant lentivirus through resistance gene screening in step S1, and the fluorescent marker gene is used to quickly and conveniently determine in step S1 that the obtained cells are all recombinant mesenchymal stem cells through fluorescence phenomenon.

[0023] In the present application, the fluorescent marker gene may be, for example, a green fluorescent protein screening marker gene, whose gene sequence is shown in SEQ ID NO:4; the resistance screening gene may be, for example, a puromycin resistance gene, whose gene sequence is shown in SEQ ID NO:5.

[0024] In some embodiments, in step S2, the expanded culture comprises: placing the recombinant mesenchymal stem cells in a selective culture medium for culture, and adding magnetized water to the selective culture medium during the culture process.

[0025] The present application adds magnetized water during the expansion and culture process of the recombinant mesenchymal stem cells, and the magnetized water plays a certain regulatory role on the cell metabolism of the recombinant mesenchymal stem cells, so that when the exosomes secreted by the recombinant mesenchymal stem cells cultured with magnetized water are used to treat endometrial damage, the therapeutic effect is further improved, and the treatment cycle is shortened.

[0026] In some embodiments, the magnetized water is added twice, and the amount of the magnetized water added each time is 5-10% of the volume of the selection culture medium.

[0027] In some specific embodiments, the amount of magnetized water added each time (i.e., the added volume) is 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5% or 10% of the volume of the selection culture medium.

[0028] In some preferred embodiments, the amount of magnetized water added each time (ie, the added volume) is 6.5% to 8.5% of the volume of the selection culture medium.

[0029] The number of times that magnetized water is added in this application is twice. The main purpose of adding magnetized water for the first time is to achieve the purpose of improving the therapeutic effect by regulating the metabolism of recombinant mesenchymal stem cells; the main purpose of adding magnetized water for the second time is that the magnetized water can have a surplus to enter the target cells and participate in the metabolic regulation of the target cells. The therapeutic effect of the obtained exosome drug on endometrial damage is significantly improved by adding magnetized water twice. In addition, the reason for adding magnetized water twice is that if too much magnetized water is added at one time, it will affect the proliferation of recombinant mesenchymal stem cells, and a small amount of magnetized water is added at one time. The ideal therapeutic effect cannot be achieved. This application adds magnetized water twice, and controls the amount of magnetized water added each time within the above range, which can improve the endometrial damage treatment effect of the exosome Exo-miR-26a-5p / 543 of this application from many aspects.

[0030] In some embodiments, when the content of the exosome Exo-miR-26a-5p / 543 in the supernatant of the recombinant mesenchymal stem cell culture is (1-10)×10 5 When the content of exosomes Exo-miR-26a-5p / 543 in the supernatant of recombinant mesenchymal stem cell culture is (1-10)×10 8 When the concentration of magnetized water was 0.1477 g / mL, the second addition of magnetized water was performed.

[0031] In the present application, controlling the timing of adding the magnetized water twice helps to further enhance the therapeutic effect of the exosome drug on endometrial damage.

[0032] The third aspect of the present application provides a use of the exosome drug described in the first aspect of the present application or the exosome drug prepared by the method described in the second aspect in the preparation of a medicament for treating endometrial damage.

[0033] The exosomes Exo-miR-26a-5p / 543 contained in the exosome drug of the present application contain both the exogenous gene miR-26a-5p and the exogenous gene miR-543. Through the synergistic effect of the two exogenous genes, the therapeutic effect of endometrial damage is significantly improved. Therefore, it can be better used in the preparation of a medicament for the treatment of endometrial damage.

[0034] The beneficial technical effects of this application are as follows: (1) The exosomes Exo-miR-26a-5p / 543 contained in the exosome drug provided in the present application contain both the exogenous gene miR-26a-5p and the exogenous gene miR-543, and the synergistic effect of these two exogenous genes achieves an excellent effect in treating endometrial damage.

[0035] (2) When preparing exosomes Exo-miR-26a-5p / 543 in the present application, magnetized water is added to the culture medium when the recombinant mesenchymal stem cells are expanded and cultured. The added magnetized water can regulate the metabolism of the recombinant mesenchymal stem cells and the secretion process of exosomes, further improving the therapeutic effect of exosomes Exo-miR-26a-5p / 543 on endometrial damage.

[0036] (3) The magnetized water in the present application is added twice in stages. The first addition of magnetized water can regulate the metabolism of recombinant mesenchymal stem cells and the secretion of exosomes. The second addition of magnetized water allows the magnetized water to have a surplus to enter the target therapeutic cells, regulate the membrane fusion of exosomes and target therapeutic cells, and the synergistic therapeutic effect of the exogenous gene miR-26a-5p and the exogenous gene miR-543. Adding magnetized water twice at the same time can avoid the effect of adding too much magnetized water at one time on the proliferation of recombinant mesenchymal stem cells, and can also avoid the problem of poor short-term (i.e., 3 weeks and within 3 weeks) therapeutic effect caused by the small amount of magnetized water added. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is a graph showing the Realtime-PCR detection results of the genes miR-26a-5p and miR-543 in the recombinant MSCs overexpressing miR-26a-5p / 543 and ordinary adipose MSCs obtained in Example 1.

[0038] Figure 2 The concentration and particle size distribution of exosome Exo-miR-26a-5p / 543 in the exosome drug prepared in Example 1.

[0039] Figure 3 This is a comparison chart of the test results of the acute inflammatory index levels in the serum of each group of mice after treatment in Test Example 1.

[0040] Figure 4 This is a comparison chart of the test results of fibrosis-related factor levels in the serum of each group of mice after treatment in Test Example 1.

[0041] Figure 5 This is a comparison of the appearance of the uterus of each group of mice after treatment in Test Example 1.

[0042] Figure 6 This is a comparison of HE-stained sections of the ovaries of mice in each group after treatment in Test Example 1.

[0043] Figure 7 This is a comparison of the results of the birth of suckling mice in each group of mice after treatment in Test Example 1. DETAILED DESCRIPTION

[0044] In order to make the present application easier to understand, the present application will be further described in detail below in conjunction with the examples, which are merely illustrative and are not intended to limit the scope of application of the present application. The raw materials or components used in the present application can be obtained through commercial routes or conventional methods unless otherwise specified.

[0045] In this application, Exo is the abbreviation of exosome, which refers to exosomes; miR is the abbreviation of microRNA, which refers to microRNA (i.e., miRNA). miR-26a-5p refers to the miRNA-26a-5p gene, and miR-543 refers to the miRNA-543 gene. Exo-miR-543 refers to exosomes carrying miRNA-543, Exo-miR-26a-5p refers to exosomes carrying miRNA-26a-5p, and Exo-miR-26a-5p / 543 refers to exosomes carrying both miRNA-26a-5p and miRNA-543.

[0046] Example 1: Preparation of exosome drugs for treating endometrial damage 1. Preparation of Human Adipose-derived MSCs and Recombinant Lentivirus (1) Preparation of human adipose MSCs: Sterile adipose tissue was obtained from a plastic surgery institution. The adipose tissue was rinsed with 0.01 mol / L sterile PBS buffer until blood was eliminated. The adipose tissue was then cleaned with sterile ophthalmic scissors and forceps and cut into approximately 1 mm thick pieces. 3Add an appropriate amount of 0.1wt% type I collagenase solution to the adipose tissue block, and shake and digest for 30 minutes at 37°C; then terminate the digestion with Gibco cell culture medium containing 10Vol.% fetal bovine serum, and centrifuge at 1000r / min for 15 minutes; discard the supernatant of the suspension after centrifugation, resuspend the incompletely digested tissue blocks and the lower cell clusters with MSC basal culture medium, mix well, and obtain the cell cluster resuspension. The cell cluster resuspension was cultured in a 37°C, 5Vol.% CO2 incubator, and adipose MSC was obtained after 3 days of adherent culture, and then a large number of cell factories were used to expand, that is, human adipose MSC was obtained.

[0047] (2) Preparation of recombinant lentivirus: The recombinant lentivirus was prepared by Nanjing Zebrafish Biotechnology Co., Ltd. The preparation method is briefly described as follows: genes miR-26a-5p and miR-543, green fluorescent protein screening marker gene and puromycin resistance gene are connected to the lentiviral gene to obtain a recombinant lentivirus. Among them, the gene sequence of the lentivirus is shown in SEQ ID NO: 1, the sequence of the gene miR-26a-5p is shown in SEQ ID NO: 2, the sequence of the gene miR-543 is shown in SEQ ID NO: 3, the sequence of the green fluorescent protein screening marker gene is shown in SEQ ID NO: 4, and the sequence of the puromycin resistance gene is shown in SEQ ID NO: 5. Specifically, the gene sequences of SEQ ID NO. 2 to 5 involved are as follows: Gene miR-26a-5p: 3’-TTCAAGTAATCCAGGATAGGCT-5’ (SEQ ID NO.2, where T in the sequence represents uracil in the RNA sequence); Gene miR-543: 3’-AAACATTCGCGGTGCACTTCTT-5’ (SEQ ID NO.3, where T in the sequence represents uracil in the RNA sequence); Green fluorescent protein screening marker gene: ATGGCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGCATGGAGGGCTGCGTGGACGGCCACAAGTTCGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGCCCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCACCGAGTACCCCCAGGACATCGTCGACTACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGGGACCGCTCCTTCCTGTTCGAGGACGGCGCCGTGTGCATCTGCAACGCCGACATCACCGTGAGCGTGGAGGAGAACTGCATGTACCACGAGTCCAAGTTCTACGGCGTGAACTTCCCCGCCGACGGCCCCGTGATGAAGAAGATGACCGACAACTGGGAGCCCTCCTGCGAGAAGATCATCCCCGTGCCCAAGCAGGGCATCTTGAAGGGCGACGTGAGCATGTACCTGCTGCTGAAGGACGGTGGCCGCTTGCGCTGCCAGTTCGACACCGTGTACAAGGCCAAGTCCGTGCCCCGCAAGATGCCCGACTGGCACTTCATCCAGCACAAGCTGACCCGCGAGGACCGCAGCGACGCCAAGAACCAGAAGTGGCACCTGACCGAGCACGCCATCGCCTCCGGCTCCGCCTTGCCCTGA(SEQ IDNO.4); Puromycin resistance gene: ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCG (SEQ ID NO.5). .

[0048] The synthesized recombinant lentivirus needs to be further packaged to obtain a large amount of recombinant lentivirus. The specific steps are as follows: the recombinant lentivirus carrying miR-26a-5p and miR-543 prepared above is added to the culture flask for culturing 293T cells, and the recombinant lentivirus is continuously packaged in the 293T cells. Then, the packaged recombinant lentivirus is obtained from the supernatant of the 293T cell culture fluid and stored at -20°C for future use.

[0049] 2. Preparation of Recombinant MSCs Sterilized human MSC serum-free basal medium (AM-V Serum Free Medium; Catalog No. SC-2013-GA, Tianjin Haoyang) was added to the T175 culture flask, and 1wt% penicillin-streptomycin was added. Then, the human adipose MSC prepared in step 1 was inoculated into the human MSC serum-free basal medium, and an appropriate amount of the recombinant lentivirus obtained in step 1 was added, and cultured at 37°C for 24h. In this process, the recombinant lentivirus repeatedly invaded the human adipose MSC to obtain recombinant human adipose MSC.

[0050] Replace the human MSC serum-free basal medium in the T175 flask with a human MSC serum-free selection medium, and continue screening and culturing at 37°C until all cells show obvious green fluorescence under a fluorescence microscope. The composition of the human MSC serum-free selection medium is: human MSC serum-free basal medium + 2 μg / mL puromycin.

[0051] 3. Expansion of recombinant MSCs The obtained recombinant MSCs were placed in human MSC serum-free selection medium for continued expansion culture, and the culture supernatant was continuously collected and stored at -20°C for future use. After 10L of the culture supernatant was melted, the culture supernatant was concentrated to 500mL using the 3D FloTrix vivaEXO exosome harvesting system produced by Beijing Huakan Company, and exosome drugs containing exosomes Exo-miR-26a-5p / 543 for the treatment of endometrial damage were obtained.

[0052] 4. Performance testing (1) Realtime-PCR detection Realtime-PCR was used to detect the expression levels of miR-26a-5p and miR-543 in the recombinant adipose MSCs overexpressing miR-26a-5p / 543 and ordinary adipose MSCs (i.e., without modified genes miR-26a-5p and miR-543) obtained in step 2. The specific results are shown in Figure 1 .from Figure 1 The results show that the expression intensity of genes miR-26a-5p and miR-543 at the mRNA level in the recombinant adipose MSCs obtained after genetic modification of adipose MSCs was significantly increased. Among them, the expression intensity of gene miR-26a-5p at the mRNA level increased by 25 times, and the expression intensity of gene miR-543 at the mRNA level increased by 31 times. This result fully demonstrates that this method has the advantages of high efficiency and high yield when preparing miRNA drugs.

[0053] (2) Exosome particle size concentration and detection: The concentration and particle size distribution of exosome Exo-miR-26a-5p / 543 in the exosome drug obtained after concentration were detected by nanoparticle tracking analysis (NTA). The specific results are as follows: Figure 2 As shown. Figure 2 It can be seen that the content of exosome Exo-miR-26a-5p / 543 in exosome drugs is 4.1×10 11 / mL, packaged in 1mL per tube, and stored at -80°C. The particle size distribution of exosomes Exo-miR-26a-5p / 543 is 48-140nm, the median particle size is 62nm, D90 is 81nm, and D10 is 58nm. The above test results of Comparative Examples 1 and 2 are similar to this result.

[0054] Example 2: Preparation of exosome drugs for treating endometrial damage The preparation process is basically the same as in Example 1, except that the step of expanding the culture of the recombinant MSC in step 3 is different. Step 3 is specifically as follows: The obtained recombinant MSCs were placed in human MSC serum-free selection medium for further expansion and culture, and the culture supernatant was continuously collected. The content of exosomes in the culture supernatant was monitored at any time. When the exosome content was 5.0×10 5 When the exosome content was 8.0×10 8 When the concentration of MSCs / mL was 1.5477 g / mL, magnetized water was added again, and the amount of magnetized water added was 7% of the volume of human MSC serum-free selection medium. Finally, the culture supernatant was collected and stored at -20°C for future use.

[0055] After 10L of culture supernatant was melted, the culture supernatant was concentrated to 500mL using the 3D FloTrix vivaEXO exosome harvesting system produced by Beijing Huakan Company, and an exosome drug for treating endometrial damage containing exosomes Exo-miR-26a-5p / 543 was obtained. The exosome drug prepared in this embodiment contains cell culture fluid, exosomes Exo-miR-26a-5p / 543 and magnetized water. The preparation method of the magnetized water added in this embodiment is: magnetize the water at a magnetic field strength of 750T for 2h.

[0056] Example 3: Preparation of exosome drugs for treating endometrial damage The preparation process is basically the same as in Example 1, except that the step of expanding the culture of the recombinant MSC in step 3 is different. Step 3 is specifically as follows: The obtained recombinant MSCs were placed in human MSC serum-free selection medium for further expansion and culture, and the culture supernatant was continuously collected. The content of exosomes in the culture supernatant was monitored at any time. When the exosome content was 5.0×10 5 When the exosome content was 8.0×10 8 When the concentration of MSCs / mL reached 400 μg / mL, magnetized water was added again, and the amount of magnetized water added was 5% of the volume of human MSC serum-free selection medium. Finally, the culture supernatant was collected and stored at -20°C for later use.

[0057] After 10L of culture supernatant was melted, the culture supernatant was concentrated to 500mL using the 3D FloTrix vivaEXO exosome harvesting system produced by Beijing Huakan Company, and an exosome drug for treating endometrial damage containing exosomes Exo-miR-26a-5p / 543 was obtained. The exosome drug prepared in this embodiment contains cell culture fluid, exosomes Exo-miR-26a-5p / 543 and magnetized water. The preparation method of the magnetized water added in this embodiment is: magnetize the water at a magnetic field strength of 750T for 2h.

[0058] Example 4: Preparation of exosome drugs for treating endometrial damage The preparation process is basically the same as in Example 1, except that the step of expanding the culture of the recombinant MSC in step 3 is different. Step 3 is specifically as follows: The obtained recombinant MSCs were placed in human MSC serum-free selection medium for further expansion and culture, and the culture supernatant was continuously collected. The content of exosomes in the culture supernatant was monitored at any time. When the exosome content was 5.0×10 5 When the exosome content was 8.0×10 8 When the concentration of MSCs / mL was 100 μg / mL, magnetized water was added again, and the amount of magnetized water added was 12% of the volume of human MSC serum-free selection medium. Finally, the culture supernatant was collected and stored at -20°C for later use.

[0059] After 10L of culture supernatant was melted, the culture supernatant was concentrated to 500mL using the 3D FloTrix vivaEXO exosome harvesting system produced by Beijing Huakan Company, and an exosome drug for treating endometrial damage containing exosomes Exo-miR-26a-5p / 543 was obtained. The exosome drug prepared in this embodiment contains cell culture fluid, exosomes Exo-miR-26a-5p / 543 and magnetized water. The preparation method of the magnetized water added in this embodiment is: magnetize the water at a magnetic field strength of 750T for 2h.

[0060] Example 5: Preparation of exosome drugs for treating endometrial damage The preparation process is basically the same as in Example 1, except that the step of expanding the culture of the recombinant MSC in step 3 is different. Step 3 is specifically as follows: The obtained recombinant MSCs were placed in human MSC serum-free selection medium for further expansion and culture, and the culture supernatant was continuously collected. The content of exosomes in the culture supernatant was monitored at any time. When the exosome content was 5.0×10 4 When the exosome content was 8.0×10 9 When the concentration of MSCs / mL was 1.5477 g / mL, magnetized water was added again, and the amount of magnetized water added was 7% of the volume of human MSC serum-free selection medium. Finally, the culture supernatant was collected and stored at -20°C for future use.

[0061] After 10L of culture supernatant was melted, the culture supernatant was concentrated to 500mL using the 3D FloTrix vivaEXO exosome harvesting system produced by Beijing Huakan Company, and an exosome drug for treating endometrial damage containing exosomes Exo-miR-26a-5p / 543 was obtained. The exosome drug prepared in this embodiment contains cell culture fluid, exosomes Exo-miR-26a-5p / 543 and magnetized water. The preparation method of the magnetized water added in this embodiment is: magnetize the water at a magnetic field strength of 750T for 2h.

[0062] Example 6: Preparation of exosome drugs for treating endometrial damage The preparation process is basically the same as in Example 1, except that the step of expanding the culture of the recombinant MSC in step 3 is different. Step 3 is specifically as follows: The obtained recombinant MSCs were placed in human MSC serum-free selection medium for further expansion and culture, and the culture supernatant was continuously collected. The content of exosomes in the culture supernatant was monitored at any time. When the exosome content was 5.0×10 5 When the concentration of MSCs / mL reached 100 μg / mL, magnetized water was added, and the amount of magnetized water added was 15% of the volume of human MSC serum-free selection medium. Finally, the culture supernatant was collected and stored at -20°C for later use.

[0063] After 10L of culture supernatant was melted, the culture supernatant was concentrated to 500mL using the 3D FloTrix vivaEXO exosome harvesting system produced by Beijing Huakan Company, and an exosome drug for treating endometrial damage containing exosomes Exo-miR-26a-5p / 543 was obtained. The exosome drug prepared in this embodiment contains cell culture fluid, exosomes Exo-miR-26a-5p / 543 and magnetized water. The preparation method of the magnetized water added in this embodiment is: magnetize the water at a magnetic field strength of 750T for 2h.

[0064] Example 7: Preparation of exosome drugs for treating endometrial damage The preparation process is basically the same as in Example 1, except that the step of expanding the culture of the recombinant MSC in step 3 is different. Step 3 is specifically as follows: The obtained recombinant MSCs were placed in human MSC serum-free selection medium for further expansion and culture, and the culture supernatant was continuously collected. The content of exosomes in the culture supernatant was monitored at any time. When the exosome content was 5.0×10 5 When the concentration of MSCs / mL reached 100 μg / mL, magnetized water was added, and the amount of magnetized water added was 8% of the volume of human MSC serum-free selection medium. Finally, the culture supernatant was collected and stored at -20°C for later use.

[0065] After 10L of culture supernatant was melted, the culture supernatant was concentrated to 500mL using the 3D FloTrix vivaEXO exosome harvesting system produced by Beijing Huakan Company, and an exosome drug for treating endometrial damage containing exosomes Exo-miR-26a-5p / 543 was obtained. The exosome drug prepared in this embodiment contains cell culture fluid, exosomes Exo-miR-26a-5p / 543 and magnetized water. The preparation method of the magnetized water added in this embodiment is: magnetize the water at a magnetic field strength of 750T for 2h.

[0066] Example 8: Preparation of exosome drugs for treating endometrial damage The preparation process is basically the same as that of Example 2, except that the preparation method of the magnetized water added in this example is: magnetizing water under a magnetic field strength of 300 T for 2 hours.

[0067] Example 9: Preparation of exosome drugs for treating endometrial damage The preparation process is basically the same as that of Example 2, except that the preparation method of the magnetized water added in this example is: magnetizing the water under a magnetic field strength of 700 T for 5 hours.

[0068] Comparative Example 1: Preparation of exosome drugs for treating endometrial damage The preparation process is basically the same as in Example 1, except that, when preparing the recombinant lentivirus, only the gene miR-26a-5p, the green fluorescent protein screening marker gene and the puromycin resistance gene are connected to the lentiviral gene to obtain the recombinant lentivirus. The obtained recombinant lentivirus contains only the exogenous gene miR-26a-5p, and does not contain the exogenous gene miR-543. In other words, the exosomes contained in the exosome drug obtained in Comparative Example 1 are Exo-miR-26a-5p, and the rest are the same as in Example 1.

[0069] Comparative Example 2: Preparation of exosome drugs for treating endometrial damage The preparation process is basically the same as in Example 1, except that, when preparing the recombinant lentivirus, only the gene miR-543, the green fluorescent protein screening marker gene and the puromycin resistance gene are connected to the lentiviral gene to obtain the recombinant lentivirus. The obtained recombinant lentivirus contains only the exogenous gene miR-543 and does not contain the exogenous gene miR-26a-5p. In other words, the exosomes contained in the exosome drug obtained in Comparative Example 2 are Exo-miR-543, and the rest are the same as in Example 1.

[0070] Test Example 1: Detection of the therapeutic effect of the exosome drugs prepared in Example 1 and Comparative Examples 1-2 on endometrial injury. Eight-week-old female BALB / c mice were taken, and a composite endometrial injury mouse model was established by a double injury method of curettage and intrauterine perfusion of lipopolysaccharide (6 mg / L). The mice with composite endometrial injury were treated with a single intrauterine injection of exosome drugs of different implementation schemes, with an injection volume of 50 μL of exosome drugs per uterus. The 40 model mice were divided into 4 groups (3 treatment groups and 1 control group) for efficacy verification. Among them, the three treatment groups were: Exo-miR-26a-5p / 543 group, which was administered with the exosome drug prepared in Example 1; Exo-miR-26a-5p group, which used the exosome drug prepared in Comparative Example 1; Exo-miR-543 group, which was administered with the exosome drug prepared in Comparative Example 2. Control group: Intrauterine injection of an equal amount of PBS buffer. In addition, 10 normal female BALB / c mice aged 8 weeks were selected as the normal group. Half of the animals in each group were used to breed pups with male mice, and the other half were simply raised for 4 weeks to detect inflammation and fibrosis related indicators, uterine appearance and pathological examination.

[0071] After 4 weeks of treatment, blood was drawn to measure the levels of acute inflammatory indicators (interleukin-1β, tumor necrosis factor α, and interleukin-6) and fibrosis-related factors (α-smooth muscle actin, fibronectin 1, and E-cadherin) in each group of mice. The results of the acute inflammatory indicator level detection of each group of mice are as follows Figure 3 The results of the detection of fibrosis-related factor levels in each group of mice are shown in Figure 4 The animals were killed and the uteri of the mice in each group were taken to observe the differences in appearance. The results are shown in Figure 5 ; Then the endometrium was observed by sectioning and HE staining. The results are shown in Figure 6 At the same time, the birth of suckling mice in each group of mice was observed. The results are shown in Figure 7 .

[0072] from Figure 3 It can be seen that after 4 weeks of treatment, the various acute inflammatory indicators in the serum of mice in the Exo-miR-26a-5p / 543 group were significantly lower than those in the control group and close to those in normal mice. The indicators in the Exo-miR-26a-5p group were also significantly lower than those in the control group, but the reduction was not as significant as that in the Exo-miR-26a-5p / 543 group, indicating that the combination of miR-26a-5p and miR-543 has a synergistic effect in inhibiting endometrial injury and inflammation.

[0073] from Figure 4 It can be seen that after 4 weeks of treatment, the serum α-smooth muscle actin and fibronectin 1 in the Exo-miR-26a-5p / 543 group were significantly lower than those in the control group, and E-cadherin was significantly higher than that in the control group, and all three indicators were close to those of normal mice. The α-smooth muscle actin and fibronectin 1 in the Exo-miR-543 group were also lower than those in the control group, and E-cadherin was also higher than that in the control group, but the magnitude of change was not as significant as that in the Exo-miR-26a-5p / 543 group, indicating that the combination of miR-26a-5p and miR-543 has a synergistic effect in inhibiting endometrial fibrosis after endometrial damage.

[0074] from Figure 5 It can be seen that the uterus of mice in the Exo-miR-26a-5p / 543 group had a shape close to that of normal mice, while those in other treatment groups had obvious swelling and congestion, and the swelling and congestion in the control group were the most serious.

[0075] from Figure 6 It can be seen that no obvious inflammatory cell infiltration was observed in the endometrium of mice in the normal group. Inflammatory cell infiltration was only partially observed in the endometrium of mice in the Exo-miR-26a-5p / 543 group (indicated by the white arrow), which was similar to that of normal mice. The endometrium of mice in the control group was full of inflammatory cell infiltration areas (indicated by the white arrow). Multiple inflammatory cell infiltration areas were also observed in the endometrium of mice in the Exo-miR-26a-5p group and the Exo-miR-543 group, which were significantly more than those in the Exo-miR-26a-5p / 543 group, indicating that the combination of miR-26a-5p and miR-543 has a synergistic effect in reducing inflammation in the endometrium.

[0076] from Figure 7It can be seen that the mice in the normal group gave birth to their first puppies around 30 days after being caged together; 4 mice in the Exo-miR-26a-5p / 543 group gave birth to their first puppies around 35 days; only 2 mice in the Exo-miR-26a-5p group could become pregnant and give birth, and the time was after 50 days of caged together; only 1 mouse in the Exo-miR-543 group became pregnant and gave birth, and the time was after 53 days of caged together; the mice in the control group could not become pregnant within 2 months of caged together.

[0077] The above results all indicate that exosome drugs containing exosomes Exo-miR-26a-5p / 543 have significantly excellent therapeutic effects on endometrial damage, and the therapeutic effects are significantly better than the therapeutic effects of exosomes Exo-miR-26a-5p or exosomes Exo-miR-543 alone.

[0078] Test Example 2 Based on the research results of Test Example 1, this test example further studied the therapeutic effect of the exosome drugs prepared in Examples 2-9 on endometrial damage, and compared the therapeutic effect with the therapeutic effect of the exosome mixture in Example 1. The specific process and results are as follows: Eight-week-old female BALB / c mice were used to establish a mouse model of compound endometrial injury by a double injury method of curettage and intrauterine perfusion of lipopolysaccharide (6 mg / L). The mice with compound endometrial injury were treated with a single intrauterine injection of exosome drugs of different implementation schemes, with an injection volume of 50 μL of exosome drugs per uterus. 80 model mice were evenly divided into 8 groups (8 treatment groups) for efficacy verification. Among them, the 8 treatment groups are: magnetized water addition group 1: administering the exosome drug prepared in Example 2; magnetized water addition group 2: administering the exosome drug prepared in Example 3; magnetized water addition group 3: administering the exosome drug prepared in Example 4; magnetized water addition group 4: administering the exosome drug prepared in Example 5; magnetized water addition group 5: administering the exosome drug prepared in Example 6; magnetized water addition group 6: administering the exosome drug prepared in Example 7; magnetized water addition group 7: administering the exosome drug prepared in Example 8; magnetized water addition group 8: administering the exosome drug prepared in Example 9. After 3 weeks of treatment for each treatment group, half of the animals in each group were used to breed suckling mice with male mice, and the other half were simply raised for 3 weeks to detect inflammation and fibrosis related indicators. The detection method of the first litter birth of mice in each treatment group and the expression level of inflammation and fibrosis related indicators is the same as that of test example 1, and the specific detection results are shown in Table 1.

[0079] Table 1 From the test results in Table 2, it can be seen that adding magnetized water to the culture medium during the expansion of recombinant mesenchymal stem cells can enhance the therapeutic effect of exosome drugs on endometrial damage and significantly shorten the treatment time, which can be shortened from 4 weeks to within 3 weeks. When the number of magnetized water is 2 times, the amount of magnetized water added each time is controlled to be 5-10% of the volume of the selected culture medium, and the timing of the first addition of magnetized water is when the content of exosome Exo-miR-26a-5p / 543 in the supernatant is (1-10)×10 5 When the content of exosomes Exo-miR-26a-5p / 543 in the supernatant is (1-10)×10 8 When the concentration is 100 / mL, it will help to further enhance the therapeutic effect of exosome drugs on endometrial damage.

[0080] It should be noted that the embodiments described above are only used to explain the present application and do not constitute any limitation to the present application. The present application is described with reference to typical embodiments, but it should be understood that the words used therein are descriptive and explanatory words, rather than restrictive words. The present application may be modified as specified within the scope of the claims of the present application, and the present invention may be revised without departing from the scope and spirit of the present application. Although the present application described therein relates to specific methods, materials and embodiments, it does not mean that the present application is limited to the specific examples disclosed therein. On the contrary, the present application can be extended to all other methods and applications with the same functions.

Claims

1. An exosome drug for treating endometrial damage, characterized in that: The exosome drug includes exosomes Exo-miR-26a-5p / 543 carrying both miRNA-26a-5p and miRNA-543.

2. The exosome drug according to claim 1, characterized in that The exosome drug is a liquid preparation, and the content of exosome Exo-miR-26a-5p / 543 in the exosome drug is (1-10)×10 11 Pieces / mL.

3. The exosome drug according to claim 2, characterized in that The exosome medicine contains magnetized water.

4. The exosome drug according to claim 3, characterized in that The preparation method of the magnetized water comprises: placing water in a magnetic field strength of 500-1000 T for magnetization for 1-3 hours to obtain the magnetized water.

5. A method for preparing the exosome drug according to any one of claims 1 to 4, characterized in that: The method comprises the following steps: S1, contacting mesenchymal stem cells with a recombinant lentivirus and then culturing them to obtain recombinant mesenchymal stem cells, wherein the recombinant lentivirus includes miR-26a-5p and miR-543; S2, expanding and culturing the recombinant mesenchymal stem cells, and collecting the culture supernatant, which is the exosome drug for treating endometrial damage.

6. The method according to claim 5, characterized in that In step S1, the gene sequence of the lentivirus used in preparing the recombinant lentivirus is shown in SEQ ID NO:1, the gene sequence of miR-26a-5p is shown in SEQ ID NO:2, and the gene sequence of miR-543 is shown in SEQ ID NO:

3.

7. The method according to claim 5 or 6, characterized in that: In step S2, the expanded culture comprises: placing the recombinant mesenchymal stem cells on a selective culture medium for culture, and adding magnetized water to the selective culture medium during the culture process.

8. The method according to claim 7, characterized in that The magnetized water is added twice, and the amount of magnetized water added each time is 5-10% of the volume of the selection culture medium.

9. The method according to claim 8, characterized in that When the content of the exosome Exo-miR-26a-5p / 543 in the supernatant of recombinant mesenchymal stem cells is (1~10)×10 5 When the content of exosomes Exo-miR-26a-5p / 543 in the supernatant of recombinant mesenchymal stem cell culture is (1-10)×10 8 When the concentration of magnetized water was 0.1477 g / mL, the second addition of magnetized water was performed.

10. Use of the exosome drug according to any one of claims 1 to 4 or the exosome drug prepared by the method according to any one of claims 5 to 9 in the preparation of a medicament for treating endometrial damage.

Images