Application of YOD1 gene in the preparation of drugs for treating rhabdomyosarcoma

Abstract

The present invention discloses the application of the YOD1 gene in the preparation of a drug for treating rhabdomyosarcoma. The present invention deeply analyzes how YOD1 co-regulates the stability of PAX3-FOXO1 and N-Myc proteins. After inducing and reducing YOD1 expression using a tetracycline regulatory system, the cloning ability and xenograft tumor growth of rhabdomyosarcoma cells that are FOXO1 fusion-positive and accompanied by high N-Myc expression are significantly inhibited. Therefore, the present invention not only discloses the application of the YOD1 gene, but also provides a new therapeutic target for rhabdomyosarcoma cells that are FOXO1 fusion-positive and accompanied by high N-Myc expression.

Description

Technical Field

[0001] The present invention belongs to the field of medical biotechnology, and particularly relates to an application of a YOD1 (YOD1 deubiquitinase) gene in the preparation of a drug for treating rhabdomyosarcoma. Background Art

[0002] Rhabdomyosarcoma is the most common soft tissue sarcoma in children, characterized by high malignancy and a poor prognosis. FOXO1 fusion-positive rhabdomyosarcoma, a subtype driven by PAX3-FOXO1 or PAX7-FOXO1, carries the worst prognosis among all rhabdomyosarcoma subtypes. Studies have shown that FOXO1 fusion protein is a key driver of rhabdomyosarcoma's malignant progression, closely associated with malignant phenotypes such as recurrence, metastasis, and drug insensitivity, making it a crucial indicator of poor clinical prognosis. Clinically, approximately 76% of patients with FOXO1 fusion-positive rhabdomyosarcoma exhibit abnormal activation of the N-Myc protein, and N-Myc expression is significantly positively correlated with poor prognosis in rhabdomyosarcoma patients. Therefore, identifying key targets for rhabdomyosarcoma treatment, focusing on FOXO1 fusion protein and N-Myc, and exploring new effective intervention strategies based on these novel targets are key scientific challenges in this field and represent an urgent clinical need.

[0003] YOD1, a member of the ovarian tumor protease family of deubiquitinating enzymes, specifically catalyzes the hydrolysis of ubiquitin molecules from substrate proteins. Limited research has been reported on YOD1, including: 1) YOD1 promotes Hippo signaling by inhibiting ubiquitination by the LATS E3 ligase ITCH, thus promoting its activation and potential therapeutic target for liver cancer; 2) YOD1 promotes the development and progression of pancreatic adenocarcinoma by affecting the tumor microenvironment; and 3) YOD1 expression is elevated in various cancer tissues, including pancreatic cancer, non-small cell lung cancer, and triple-negative breast cancer, with its expression levels being closely correlated with poor patient prognosis. These studies suggest that YOD1 may participate in tumor development and progression, but the role of YOD1 in FOXO1 fusion-positive rhabdomyosarcoma with high N-Myc expression has not been clearly documented. Therefore, the role of YOD1 in FOXO1 fusion-positive rhabdomyosarcoma with high N-Myc expression warrants further investigation. Summary of the Invention

[0004] The present invention aims to provide a use of the YOD1 gene in the preparation of a drug for treating rhabdomyosarcoma, wherein the nucleotide sequence of the YOD1 gene is shown in SEQ ID NO: 1, and the amino acid sequence of the YOD1 gene targeting siRNA is shown in SEQ ID NO: 2. The nucleotide sequences of the interfering siRNAs are:

[0005] SEQ ID NO:3:5'GAGTACTGTGACTGGATCAAA3'(﹟1)

[0006] SEQ ID NO: 4: 5'CCAGAAGTTCACCTGCATTTA3'(﹟2).

[0007] The rhabdomyosarcoma involves FOXO1 fusion-positive rhabdomyosarcoma with high N-Myc expression.

[0008] The YOD1 gene reduces the ubiquitination of the FOXO1 fusion protein and N-Myc through its deubiquitinating activity, thereby stabilizing the FOXO1 fusion protein and N-Myc. By inhibiting the activity of the YOD1 gene, the expression of both the FOXO1 fusion protein and N-Myc protein can be simultaneously suppressed. This is of great significance for the clinical treatment of patients with FOXO1 fusion-positive rhabdomyosarcoma and those with FOXO1 fusion-positive rhabdomyosarcoma with high N-Myc expression, providing a new treatment strategy.

[0009] The present invention utilizes a tetracycline regulatory system and siRNAs targeting the YOD1 gene to downregulate YOD1, thereby studying the role of YOD1 inhibition in the growth of rhabdomyosarcoma tumors that are FOXO1 fusion-positive and have high N-Myc expression. siRNAs targeting the YOD1 gene (SEQ ID NO:3; SEQ ID NO:4) inhibit YOD1 expression and induce degradation of the FOXO1 fusion protein and N-Myc protein, thereby inhibiting the growth of rhabdomyosarcoma tumors that are FOXO1 fusion-positive and have high N-Myc expression. Specifically, downregulation of YOD1 significantly inhibits the clonogenicity of Rh30 cells, a rhabdomyosarcoma tumor that is FOXO1 fusion-positive and has high N-Myc expression, as well as the growth of Rh30 xenograft tumors.

[0010] The present invention uses RNA interference technology to reduce YOD1, which can significantly inhibit the growth of rhabdomyosarcoma cells that are FOXO1 fusion-positive and have high N-Myc expression. Therefore, the present invention not only discloses the application of the YOD1 gene, but also provides a new therapeutic target for rhabdomyosarcoma cells that are FOXO1 fusion-positive and have high N-Myc expression.

[0011] Specifically, inhibitors are developed targeting the YOD1 gene, including chemical drugs, peptide drugs and protein drugs that target the inhibition of YOD1 expression level or activity, so as to inhibit cell proliferation and thus fight rhabdomyosarcoma by downregulating YOD1 expression or inhibiting YOD1 activity.

[0012] This study utilizes siRNA interference technology to reduce YOD1 expression, thereby inducing degradation of the FOXO1 fusion protein and N-Myc protein, thereby inhibiting the growth of rhabdomyosarcoma. This study suggests for the first time that the YOD1 gene is a key gene for the malignant progression of rhabdomyosarcoma characterized by FOXO1 fusions and high N-Myc expression. siRNAs targeting YOD1 can be used as an effective intervention for the treatment of rhabdomyosarcoma characterized by FOXO1 fusions and high N-Myc expression.

[0013] The drug is in the form of a liquid preparation or a solid preparation.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention provides the use of YOD1 siRNA in the preparation of a therapeutic drug for FOXO1 fusion-positive rhabdomyosarcoma with overexpression of N-Myc. YOD1, through its deubiquitinating activity, reduces the ubiquitination of FOXO1 fusion protein and N-Myc, thereby stabilizing the FOXO1 fusion protein and N-Myc. Downregulating YOD1 can effectively inhibit the clonogenicity and xenograft growth of FOXO1 fusion-positive rhabdomyosarcoma with overexpression of N-Myc, providing a new direction for the development of therapeutic drugs for this disease. This approach, to some extent, addresses the current predicament of limited available drugs and limited mechanisms of action for this disease. In summary, downregulating YOD1 can inhibit the clonogenicity and xenograft growth of FOXO1 fusion-positive rhabdomyosarcoma, opening the possibility of developing new drugs for this disease, enhancing patient efficacy, and improving prognosis and survival. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Two siRNAs targeting the YOD1 gene (SEQ ID NO: 3; SEQ ID NO: 4) both have the effects of significantly downregulating the protein expression of YOD1 and promoting the degradation of FOXO1 fusion protein and N-Myc protein.

[0017] Figure 2 This figure shows that YOD1 can inhibit the ubiquitination levels of FOXO1 fusion protein and N-Myc. A shows the regulation of FOXO1 fusion protein ubiquitination by YOD1 and its active mutant YOD1-C160S; B shows the regulation of N-Myc ubiquitination by YOD1 and its active mutant YOD1-C160S.

[0018] Figure 3The tetracycline regulatory system is combined with siRNA targeting the YOD1 gene (SEQ ID NO: 3) and applied to Rh30 cells, which are FOXO1 fusion-positive and accompanied by high expression of N-Myc. The clone-forming ability of Rh30 cells is significantly inhibited.

[0019] Figure 4 The invention utilizes a tetracycline regulatory system combined with siRNA (SEQ ID NO: 3) targeting the YOD1 gene to be applied to rhabdomyosarcoma xenograft tumors that are FOXO1 fusion-positive and accompanied by high expression of N-Myc, and the growth of the xenograft tumors is significantly inhibited. DETAILED DESCRIPTION

[0020] The present invention will be further described in detail below with reference to the accompanying drawings and examples. The following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0021] Experimental methods for which specific conditions are not specified in the examples are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

[0022] The application of the YOD1 gene described in the present invention can refer to conventional drug formulation methods and actual development. The pharmaceutical dosage form and biological preparation can be any medically approved dosage form, such as powder, injection, capsule, tablet or oral solution.

[0023] Example 1:

[0024] Two YOD1 siRNAs targeting different sequences (SEQ ID NO: 3; SEQ ID NO: 4) and a negative control NC were introduced into rhabdomyosarcoma Rh30 cells by lipofectamine transfection. After 72 hours, the cells were harvested and lysed using cell lysis buffer. Western blot experiments were performed using YOD1 antibodies (purchased from Proteintech), FOXO1 antibodies (purchased from Cell Signal Technology), and N-Myc antibodies (purchased from Cell Signal Technology).

[0025] The results are as follows Figure 1As shown, two siRNAs targeting the YOD1 gene (SEQ ID NO:3; SEQ ID NO:4) both significantly downregulated YOD1 protein expression and induced degradation of FOXO1 fusion protein and N-Myc protein. These results indicate that targeting the YOD1 gene can intervene in the stability of key proteins in rhabdomyosarcoma with FOXO1 fusion-positive and N-Myc-overexpressing tumors, providing experimental evidence for the development of novel therapeutic strategies.

[0026] Example 2:

[0027] HEK-293T cells were co-transfected with PAX3-FOXO1-HA or N-Myc-HA, YOD1-Flag or YOD1-C160S-Flag (an enzymatically active mutant of YOD1), and His-Ub. The cells were then treated with 8 μmol / L MG132 for 12 hours to enhance protein ubiquitination. Cell extracts were immunoprecipitated on agarose gel using an anti-HA antibody, and the ubiquitination of PAX3-FOXO1 and N-Myc was detected by Western blotting using a His antibody (purchased from Cell Signaling Technology).

[0028] The results are as follows Figure 2 As shown, YOD1 overexpression significantly reduced the ubiquitination levels of PAX3-FOXO1 and N-Myc, while the catalytically inactive YOD1-C160S mutant failed to reduce the ubiquitination levels of these two proteins, confirming the necessity of the deubiquitinase activity of YOD1 for regulating the stability of PAX3-FOXO1 and N-Myc.

[0029] Example 3:

[0030] siRNA (SEQ ID NO: 3) targeting the YOD1 gene and the negative control NC were stably transfected into rhabdomyosarcoma Rh30 cells using a tetracycline-regulated system. The cells were digested and counted using a hemocytometer. (1) 1500 cells were inoculated into a six-well plate for clonal culture. A 1μg / ml tetracycline treatment group and a control group were set up, and SRB staining was performed after 14 days. (2) 8000 cells were inoculated into a six-well plate for soft agar culture. A 1μg / ml tetracycline treatment group and a control group were set up, and photos were taken after 14 days. The area of ​​the cloned spheres was counted using ImageJ.

[0031] The results are as follows Figure 3As shown, siRNA targeting the YOD1 gene (SEQ ID NO: 3) using the tetracycline control system can significantly inhibit the colony formation ability of Rh30 rhabdomyosarcoma cells, which are FOXO1 fusion-positive and have high N-Myc expression. These results reveal the key role of the YOD1 gene in maintaining the colony formation of Rh30 rhabdomyosarcoma cells and provide scientific evidence for the use of siRNA technology to regulate YOD1 gene expression for the treatment of specific types of rhabdomyosarcoma.

[0032] Example 4:

[0033] The siRNA (SEQ ID NO: 3) targeting the YOD1 gene and the negative control NC were stably transfected into rhabdomyosarcoma Rh30 cells using a tetracycline-regulated system. The cells were digested and counted using a hemocytometer. 4 × 10 6 The cells were inoculated into the armpits of nude mice, which were fed with tetracycline feed and ordinary feed respectively. The growth of the transplanted tumors in nude mice was continuously monitored for four consecutive weeks.

[0034] The results are as follows Figure 4 As shown, siRNA targeting the YOD1 gene (SEQ ID NO: 3) using the tetracycline control system can significantly inhibit the growth of Rh30 rhabdomyosarcoma cell xenografts. This result emphasizes the importance of the YOD1 gene in the development of rhabdomyosarcoma and confirms that downregulating YOD1 gene expression through siRNA technology is an effective therapeutic strategy that can inhibit tumor growth, providing experimental support for the development of new anti-tumor drugs.

Claims

1. Use of interfering siRNAs targeting the YOD1 deubiquitinase gene in the preparation of a drug for treating rhabdomyosarcoma, characterized in that: The nucleotide sequence of the YOD1 deubiquitinase gene is shown in SEQ ID NO: 1, the protein sequence encoded by the YOD1 deubiquitinase gene is shown in SEQ ID NO: 2, and the nucleotide sequences of the interfering siRNAs of the YOD1 deubiquitinase gene are: SEQ ID NO:3: 5'GAGUACUGUGACUGGAUCAAA3' SEQ ID NO:4: 5'CCAGAAGUUCACCUGCAUUUA3'.

2. The use according to claim 1, characterized in that The rhabdomyosarcoma is a rhabdomyosarcoma that is FOXO1 fusion-positive and accompanied by high expression of N-Myc.

3. The use according to claim 1, characterized in that The drug is in the form of a liquid preparation or a solid preparation.

Images