Adenovirus carrying bispecific t-cell adapter

Abstract

The invention relates to an adenovirus carrying a bispecific T cell adapter. A modified adenovirus, in particular Enadnotucirev (EnAd), is provided which carries a bispecific T cell adapter comprising at least two binding domains wherein at least one of the domains is specific for a surface antigen on a T cell of interest. Also provided is a composition, such as a pharmaceutical formulation comprising the virus; the use of the viruses and viral formulations for treatment, such as the treatment of cancer. The present disclosure also extends to methods for preparing the viruses.

Description

[0001] This application is a divisional application. The application date of the original application is August 29, 2017, the application number is 201780057768.4, and the name of the invention is “Adenovirus carrying a bispecific T cell engager”, which is incorporated herein by reference in its entirety. Technical Field

[0002] The present disclosure relates to a modified adenovirus, specifically Enadenotucirev (EnAd), carrying a bispecific T cell engager comprising at least two binding domains, at least one of which is specific for a surface antigen on a T cell of interest. The present disclosure further relates to compositions, such as pharmaceutical formulations, comprising the virus; and the use of the virus and viral formulations for therapy, particularly for the treatment of cancer. The present disclosure also extends to methods for preparing the virus and DNA encoding the virus. Background Art

[0003] Cancer remains a huge burden on society in terms of the hardship and suffering it inflicts on patients and their loved ones, as well as the high economic costs of treating, caring for, and supporting patients.

[0004] A variety of therapies for the treatment of cancer have been developed, including chemotherapeutic agents, radiotherapy, and more recently, biological agents such as antibodies. Over the past 15 years, antibody-based cancer therapy has been established and is currently one of the most successful and important strategies for treating patients with hematological malignancies and solid tumors. Examples of current clinically used monoclonal antibody-based anticancer therapies include rituximab targeting CD20, bevacizumab targeting VEGF, cetuximab targeting EGFR, and labetuzumab targeting CEA.

[0005] Among the various antibody formats being developed, bispecific T cell engagers show great promise. These are relatively simple bispecific molecules that are specific for the CD3ε subunit of the TCR complex of a T cell and also target an antigen of interest, such as a cancer antigen. Because bispecific T cell engagers are specific for the TCR complex, this enables them to activate resident T cells to kill cells that express a specific target antigen on their cell surface, such as cancer cells. An important property of bispecific T cell engagers is their ability to make CD4 + and unactivated CD8 + T cells target cancer cells. In other words, T cells activated by bispecific T cell engagers can be made to kill cells independently of MHC expression on the cell surface. This is important because some tumor cells downregulate MHC, making them resistant to agents such as CAR-T cells and immTACs.

[0006] Unfortunately, bispecific T cell engagers have poor circulation kinetics relative to full-length antibodies. This means that when administered to a patient, most bispecific T cell engagers fail to reach their target cells. Furthermore, using a high-affinity anti-CD3 ScFv as part of a bispecific T cell engager can result in strong binding to T cells in the blood, which also interferes with delivery to tumors. As a result, bispecific T cell engagers cannot fully realize their potential as anti-cancer therapeutics because they cannot be effectively delivered to tumor cells.

[0007] The requirement for effective delivery of therapeutic agents such as bispecific T cell adapters to tumor cells has become increasingly important because it has become increasingly apparent that solid tumors protect themselves in a variety of ways in vivo, such as by forming a matrix around the tumor. The progression of cancer is associated with the proliferation of epithelial cells (mitotic cells) and the development of activated tumor stroma. In this case, due to increased turnover, extracellular matrix (ECM) components such as collagen bundles are degraded. The number of inflammatory cells increases and fibroblasts differentiate into myofibroblasts, causing them to express growth factors, matrix components and degraded proteases. Angiogenesis is maintained, resulting in a large number of leaky tumor blood vessels. After activating the tumor matrix with sustained angiogenesis, the invasion of tumor cells begins through the degraded basement membrane, and blood vessels infiltrate the tumor tissue.

[0008] This matrix is ​​a physical shield, as it may have the function of trapping immune cells to fight the tumor. In addition, the matrix shields the tumor from the hypoxic microenvironment, which is permissive and optimal for tumor growth. There are some theories that the cells in the matrix are the energy source in the tumor.

[0009] A large component of the tumor stroma is fibroblasts, which have been destroyed to play a role in initiating cancer. Other cells that infiltrate the stroma are tumor-associated macrophages (TAMs), which are type 2 (M2) macrophages that can promote tumor growth by secreting cytokines and chemokines such as IL-10 that suppress the immune response.

[0010] Targeting the tumor stroma is particularly difficult because the cells that generate the milieu are "innate" immune cells or connective tissue cells found throughout the body. Therefore, targeting these cells with therapeutic agents can result in significant off-target effects.

[0011] Therefore, there is a need for improved methods to deliver bispecific T cell engagers directly to tumor cells where they can provide the greatest therapeutic benefit, specifically to tumor cells surrounded by stromal fibroblasts. Summary of the Invention

[0012] The inventors believe that one of the most effective ways to deliver therapeutic agents directly to tumors is to use oncolytic adenoviruses engineered to express agents that, for example, activate T cells, such as in the stroma, and target antigens.

[0013] Thus, the present disclosure provides an adenovirus comprising a sequence of formula (I):

[0014] 5'ITR-B1-B A -B2-B X -B B -B Y -B3-3'ITR(I)

[0015] in:

[0016] B1 is a bond or includes: E1A, E1B or E1A-E1B;

[0017] B A Includes -E2B-L1-L2-L3-E2A-L4;

[0018] B2 is a key or includes: E3;

[0019] B X A DNA sequence that is a bond or includes: a restriction site, one or more transgenes, or both;

[0020] B B Including L5;

[0021] B Y A DNA sequence that is a bond or includes: a restriction site, one or more transgenes, or both;

[0022] B3 is a key or includes: E4;

[0023] wherein the adenovirus encodes a bispecific T cell engager comprising at least two binding domains, wherein at least one of the domains is specific for a surface antigen on an immune cell of interest, such as a T cell of interest; and

[0024] The adenovirus is EnAd or Ad11.

[0025] One or more bispecific T cell engagers according to the present disclosure do not include a transmembrane domain and are therefore not expressed on the surface of cancer cells, but rather include a signal sequence that promotes the release of the bispecific T cell engager molecule from the cancer cell.

[0026] The following paragraphs are an overview of the present disclosure:

[0027] 1. An adenovirus comprising a sequence of formula (I):

[0028] 5'ITR-B1-B A -B2-B X -B B -B Y -B3-3'ITR(I)

[0029] in:

[0030] B1 is a bond or includes: E1A, E1B or E1A-E1B;

[0031] B A Includes -E2B-L1-L2-L3-E2A-L4;

[0032] B2 is a key or includes: E3;

[0033] B X A DNA sequence that is a bond or includes: a restriction site, one or more transgenes, or both;

[0034] B B Including L5;

[0035] B Y A DNA sequence that is a bond or includes: a restriction site, one or more transgenes, or both;

[0036] B3 is a key or includes: E4;

[0037] wherein the adenovirus encodes a bispecific T cell engager comprising at least two binding domains, wherein at least one of the domains is specific for a surface antigen on an immune cell of interest, such as a T cell of interest; and

[0038] The adenovirus is EnAd or Ad11.

[0039] 2. The adenovirus according to paragraph 1, wherein the adenovirus is EnAd.

[0040] 3. The adenovirus according to paragraph 1 or 2, wherein the surface antigen is a component of the T cell receptor complex (TCR), such as CD3, TCR-α and TCR-β.

[0041] 4. The adenovirus according to paragraph 3, wherein the surface antigen is CD3, such as CD3ε, CD3γ and CD3δ, in particular CD3ε.

[0042] 5. An adenovirus according to any one of paragraphs 1 to 4, wherein one of the binding domains is specific for a tumor antigen, such as CEA; MUC-1; EpCAM; HER receptors HER1, HER2, HER3, HER4; PEM; A33; G250; carbohydrate antigens Ley, Lex, Leb; PSMA; TAG-72; STEAP1; CD166; CD24; CD44; E-cadherin; SPARC; ErbB2 and ErbB3.

[0043] 6. The adenovirus of paragraph 5, wherein one of the binding domains is specific for EpCAM, such as EpCAM comprising the amino acid sequence set forth in SEQ ID NO: 28.

[0044] 7. The adenovirus of any one of paragraphs 1 to 4, wherein one of the binding domains is specific for a tumor stromal antigen, such as fibroblast activation protein (FAP), TREM1, IGFBP7, FSP-1, platelet-derived growth factor-alpha receptor (PDGFR-alpha), platelet-derived growth factor-beta receptor (PDGFR-beta), and vimentin.

[0045] 8. The adenovirus of paragraph 7, wherein one of the binding domains is specific for FAP, such as FAP comprising the amino acid sequence set forth in SEQ ID NO: 30.

[0046] 9. The adenovirus of paragraph 7 or 8, wherein the stromal antigen is an antigen selected from the group consisting of myeloid-derived suppressor cell antigen, tumor-associated macrophage, and combinations thereof.

[0047] 10. The adenovirus of paragraph 9, wherein the antigen is selected from CD163, CD206, CD68, CD11c, CD11b, CD14, CSF1 receptor, CD15, CD33, CD66b, and a combination of two or more thereof.

[0048] 11. The adenovirus of any one of paragraphs 1 to 3 and 5 to 10, wherein one of the binding domains in the bispecific T cell engager is specific for a non-TCR activating protein such as CD31, CD2, and CD277.

[0049] 12. The adenovirus according to any one of paragraphs 1 to 11, wherein B X or B Y At least one of is not a key.

[0050] 13. The adenovirus of any of paragraphs 1 to 12, wherein the adenovirus is chimeric.

[0051] 14. The adenovirus of any one of paragraphs 1 to 13, wherein the adenovirus is oncolytic.

[0052] 15. The adenovirus of any of paragraphs 1 to 14, wherein the adenovirus is capable of replication.

[0053] 16. The adenovirus of paragraph 13, wherein the adenovirus is replication competent.

[0054] 17. The adenovirus of any of paragraphs 1 to 14, wherein the adenovirus is replication defective.

[0055] 18. The adenovirus according to any one of paragraphs 1 to 17, wherein B X One or more transgenes or transgene cassettes are included.

[0056] 19. The adenovirus according to any one of paragraphs 1 to 16, wherein B Y One or more transgenes or transgene cassettes are included.

[0057] 20. The adenovirus of any one of paragraphs 1 to 19, wherein the one or more transgenes or transgene cassettes are under the control of an endogenous or exogenous promoter, such as an endogenous promoter.

[0058] 21. The adenovirus of paragraph 20, wherein the transgene or transgene cassette is under the control of an endogenous promoter selected from the group consisting of an E4 promoter and a major late promoter, in particular the major late promoter.

[0059] 22. The adenovirus of paragraph 19, wherein the transgene or transgene cassette is under the control of an exogenous promoter such as CMV.

[0060] 23. The adenovirus of any one of paragraphs 1 to 22, wherein the transgene cassette further comprises regulatory elements independently selected from:

[0061] a. Splice acceptor sequence

[0062] b. Internal ribosome entry sequence or high self-cleavage efficiency A peptide,

[0063] c.Kozak sequence and

[0064] d. combinations thereof.

[0065] 24. The adenovirus of paragraph 23, wherein the transgene cassette comprises a Kozak sequence located at the beginning of the protein coding sequence.

[0066] 25. The adenovirus of any one of paragraphs 1 to 24, wherein the transgene cassette encodes a high self-cleavage efficiency A peptide.

[0067] 26. The adenovirus of any of paragraphs 1 to 25, wherein the transgene cassette further comprises a polyadenylation sequence.

[0068] 27. The adenovirus of any one of paragraphs 1 to 26, wherein the transgene cassette further comprises restriction sites located at and / or at the ends of the DNA sequence.

[0069] 28. The adenovirus of any of paragraphs 1 to 27, wherein at least one transgene cassette encodes a monocistronic mRNA.

[0070] 29. The adenovirus of any one of paragraphs 1 to 28, wherein the bispecific T cell engager has a short half-life, eg, 48 hours or less.

[0071] 30. The adenovirus of any one of paragraphs 1 to 29, wherein the bispecific T cell engager is encoded by a region selected from the group consisting of E1, E3, B X 、B Y and combinations thereof.

[0072] 31. The adenovirus of paragraph 30, wherein the bispecific T cell engager is encoded at least at position B, for example, under the control of the major late promoter. X middle.

[0073] 32. The adenovirus of any one of paragraphs 1 to 29, wherein the adenovirus further encodes a second bispecific T cell engager.

[0074] 33. An adenovirus according to paragraph 32, wherein the first bispecific T cell engager molecule is specific for a tumor antigen, e.g., a tumor antigen (e.g., listed herein), and the second bispecific T cell engager molecule is specific for a tumor stromal antigen, e.g., a stromal antigen (e.g., listed herein).

[0075] 34. The adenovirus of any one of paragraphs 1 to 33, wherein the adenovirus further comprises a cytokine or chemokine or an immunomodulatory factor (such as a cytokine or chemokine).

[0076] 35. The adenovirus of paragraph 34, wherein the cytokine or chemokine is selected from the group consisting of MIP1α, IL-1α, IL-1β, IL-6, IL-9, IL-12, IL-13, IL-17, IL-18, IL-22 , IL-23, IL-24, IL-25, IL-26, IL-27, IL-33, IL-35, IL-2, IL-4, IL-5, IL-7, IL-10, IL-15, IL-21, IL-25, IL-1RA, IFNα, IFNβ, IFNγ, TNFα, lymphotoxin α (LTA), Flt3L, GM-CSF, IL-8, CCL2, CCL3, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCL10, CXCL11, CXCL13, CXCL12, CCL2, CCL19, CCL21, (e.g., IL-1α, IL-1β, IL-6, IL-9, IL-12, IL -13, IL-17, IL-18, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-33, IL-35, IL-2, IL-4, IL-5, IL-7, IL -10, IL-15, IL-21, IL-25, IL-1RA, IFNα, IFNβ, IFNγ, TNFα, lymphotoxin α (LTA), GM-CSF, IL-8, CCL2, CCL3, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCL10, CXCL11, CXCL13, CXCL12, CCL2, CCL19, CCL21), such as IL-12, IL-18, IL-22, IL-7, IL-15, IL-21, IFNγ, TNFα, lymphotoxin alpha (LTA), CCL3, CCL5, CXCL9, CXCL10, CXCL12, CCL2, CCL19 and CCL21.

[0077] 36. The adenovirus of any one of paragraphs 1 to 35, wherein the adenovirus further comprises an immunomodulatory factor, such as an antibody or antibody fragment, or a protein or peptide ligand, specific for a checkpoint protein such as CTLA-4, PD-1, PD-L1, PD-L2, VISTA, B7-H3, B7-H4, HVEM, ILT-2, ILT-3, ILT-4, TIM-3, LAG-3, BTLA, LIGHT, or CD160, e.g., CTLA-4, PD-1, PD-L1, and PD-L2, or specific for a co-stimulatory molecule such as CD28, CD80, CD86, CD83, ICOS, B7H2, TL1A, and 4-1BB.

[0078] 37. The adenovirus of any one of paragraphs 1 to 36, wherein the bispecific T cell engager comprises: a VH domain comprising the amino acid sequence set forth in any one of SEQ ID NOs: 8, 13, or 18, or an amino acid sequence that is at least 95% identical thereto.

[0079] 38. The adenovirus of any one of paragraphs 1 to 37, wherein the bispecific T cell engager comprises: a VL domain comprising the amino acid sequence set forth in any one of SEQ ID NOs: 9, 12, or 17, or an amino acid sequence at least 95% identical thereto.

[0080] 39. The adenovirus of any one of paragraphs 1 to 36, wherein the bispecific T cell engager comprises a scFv comprising the amino acid sequence set forth in any one of SEQ ID NOs: 7, 11, or 16, or an amino acid sequence that is at least 95% identical thereto.

[0081] 40. The adenovirus of any one of paragraphs 1 to 39, wherein the bispecific T cell engager comprises the amino acid sequence set forth in SEQ ID NO: 2 or 4, or an amino acid sequence that is at least 95% identical thereto, such as the amino acid sequence set forth in SEQ ID NO: 73 or 75.

[0082] 41. The adenovirus of any one of paragraphs 1 to 40, wherein the adenovirus comprises a DNA sequence set forth in any one of SEQ ID NOs: 34 to 37 or a DNA sequence at least 95% identical thereto, such as a DNA sequence set forth in any one of SEQ ID NOs: 79 to 82.

[0083] 42. A composition comprising the adenovirus of any of paragraphs 1 to 41 and a diluent or carrier.

[0084] 43. A method of treating a patient comprising administering a therapeutically effective amount of the adenovirus of any one of paragraphs 1 to 41 or the composition of paragraph 42.

[0085] 44. The method of paragraph 43, for treating cancer, in particular solid tumors. In one embodiment, the adenovirus according to the present disclosure encodes at least one additional transgene, such as 1, 2, 3 or 4 additional transgenes.

[0086] In one embodiment, the cleavage peptide is encoded differently between each gene.

[0087] In one embodiment, all transgenes are located in one location on the virus, for example, at B Y Location.

[0088] Advantageously, the inventors have discovered that carrying an adenovirus with a bispecific T cell engager molecule allows the bispecific antibody fragment molecule to "piggyback" on the adenovirus's ability to selectively infect cancer cells, thereby enabling targeted delivery of the bispecific T cell engager to tumor cells.

[0089] Advantageously, bispecific T cell engagers are small and can be produced in mammalian cells. Therefore, once infected with the adenovirus of the present disclosure, the bispecific T cell engager molecules are synthesized, secreted, and can act locally by the tumor cells, thereby spreading beyond the direct footprint of the virus. This allows the bispecific T cell engager to spread beyond the direct site of infection, but at the same time limits the spread of the virus far beyond the infected tumor cell nest. This minimizes the risk of undesirable off-target effects.

[0090] In one embodiment, the adenovirus is EnAd. Compared to the adenoviruses of the prior art, EnAd has been shown to have enhanced oncolytic activity. EnAd has also been shown to have high selectivity for human epithelial-derived cancer cells, such as colon cancer, lung cancer, bladder cancer, and renal cancer cells. This makes it an ideal delivery vehicle for bispecific T cell engager molecules, because T cells can be activated by bispecific T cell engager molecules to attack target cells, while EnAd simultaneously infects and dissolves cancer cells. This results in a two-pronged attack on tumors with a synergistic oncolytic effect.

[0091] In one embodiment, the surface antigen is a component of the T cell receptor complex (TCR), such as CD3, TCR-α and TCR-β.

[0092] In one embodiment, the surface antigen is CD3, such as CD3ε, CD3γ and CD3δ, specifically CD3ε.

[0093] In one embodiment, one of the binding domains is specific for a tumor antigen, such as CEA; MUC-1; EpCAM; HER receptors (such as HER1, HER2, HER3, HER4); PEM; A33; G250; carbohydrate antigen Le y 、Le x 、Le b ; PSMA; TAG-72; STEAP1; CD166; CD24; CD44; E-cadherin; SPARC; ErbB2 and ErbB3, specifically EpCAM.

[0094] In one embodiment, one of the binding domains is specific for EpCAM, such as EpCAM comprising the amino acid sequence set forth in SEQ ID NO: 28, or a sequence at least 95% identical thereto.

[0095] In one embodiment, one of the binding domains is specific for tumor stroma antigens, such as fibroblast activation protein (FAP), TREM1, IGFBP7, FSP-1, platelet-derived growth factor-alpha receptor (PDGFR-α), platelet-derived growth factor-beta receptor (PDGFR-β) and vimentin. Advantageously, the stromal cells (non-transformed cells) expressing these antigens do not undergo the same level of mutation resistance selection process as transformed cells. Therefore, these cells are more susceptible to targeted cancer therapy because they are not "mobile targets". In addition, the receptor types found in stromal cells are generally common in different types of cancer. Therefore, targeting one of the above-mentioned antigens may be effective for multiple cancer types.

[0096] In one embodiment, one of the binding domains is specific for FAP, such as a FAP comprising the amino acid sequence set forth in SEQ ID NO: 30, or a sequence at least 95% identical thereto. Advantageously, FAP is upregulated on tumor-associated fibroblasts. Fibroblasts are an important component of solid cancers, supporting growth, invasion, and recovery from intervention. They typically comprise 40% to 60% of cells in advanced cancers. Advantageously, fibroblasts are genetically stable cells that are less likely to evade treatment than cancer cells. Activated fibroblasts are also relatively similar across tumor types. Therefore, by activating T cells to target and kill tumor-associated fibroblasts expressing FAP, the adenoviruses of the present disclosure can help reduce a spectrum of immunosuppressive pathways, such as those mediated by IL-10, TGFβ, and IDO.

[0097] Other stromal targets include tumor-associated macrophage and myeloid-derived suppressor cell antigens, such as CD163, CD206, CD68, CD11c, CD11b, CD14, CSF1 receptor, CD15, CD33, CD66b, and combinations of two or more thereof.

[0098] In one embodiment, one of the binding domains in the bispecific T cell engager is specific for a non-TCR activating protein such as CD31, CD2, and CD277.

[0099] In one embodiment, one of the binding domains is specific for a surface antigen on a T cell of interest, such as selected from CD3 (e.g., CD3δ, CD3ε, or CD3γ), a TCR-α chain, and a TCR-β chain, and one binding domain is specific for a tumor antigen.

[0100] In one embodiment, one of the binding domains is specific for CD3 and the other binding domain is specific for a tumor antigen, e.g., selected from the group consisting of: CEA, MUC-1, EpCAM, HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigen Le y 、Le x 、Le b , PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2 and ErbB3.

[0101] In one embodiment, one of the binding domains is specific for CD3 (eg, CD3δ, CD3ε, or CD3γ) and the other binding domain is specific for EpCAM.

[0102] In one embodiment, one of the binding domains is specific for CD3ε and the other binding domain is specific for EpCAM.

[0103] In one embodiment, one of the binding domains is specific for a surface antigen on a T cell of interest, such as selected from CD3 (e.g., CD3δ, CD3ε, or CD3γ), TCR-α, and TCR-β, and the other binding domain is specific for a tumor stromal antigen.

[0104] In one embodiment, one of the binding domains is specific for CD3 (e.g., CD3δ, CD3ε, or CD3γ), and the other binding domain is specific for a tumor stromal antigen, e.g., selected from the group consisting of: fibroblast activation protein (FAP), TREM1, IGFBP7, FSP-1, platelet-derived growth factor-alpha receptor (PDGFR-α), platelet-derived growth factor-beta receptor (PDGFR-β), and vimentin.

[0105] In one embodiment, one of the binding domains is specific for CD3 (eg, CD3δ, CD3ε, or CD3γ) and the other binding domain is specific for FAP.

[0106] In one embodiment, one of the binding domains is specific for CD3ε and the other binding domain is specific for FAP.

[0107] In one embodiment, one of the binding domains is specific for a surface antigen on a T cell of interest, such as CD3, TCR-α, and TCR-β, and the other binding domain is specific for a non-TCR activating protein.

[0108] In one embodiment, one of the binding domains is specific for CD3 (such as CD3δ, CD3ε, or CD3γ) and the other binding domain is specific for a non-TCR activating protein selected from the group consisting of: CD31, CD2, and CD277.

[0109] In one embodiment, one of the binding domains is specific for CD3ε and the other binding domain is specific for a non-TCR activating protein selected from the group consisting of: CD31, CD2, and CD277.

[0110] In one embodiment, B X or B Y At least one of is not a key.

[0111] In one embodiment, B X Not a key.

[0112] In one embodiment, B Y Not a key.

[0113] In one embodiment, B X and B Y None are keys.

[0114] In one embodiment, the adenovirus is chimeric.

[0115] In one embodiment, the adenovirus is oncolytic.

[0116] In one embodiment, the adenovirus is chimeric and oncolytic.

[0117] In one embodiment, the adenovirus is capable of replication.

[0118] In one embodiment, the adenovirus is chimeric, oncolytic, and replication competent.

[0119] In one embodiment, the adenovirus is replication competent.

[0120] In another embodiment, the adenovirus is chimeric, oncolytic, and replication competent.

[0121] In one embodiment, the adenovirus is replication defective, ie, is a vector.

[0122] In one embodiment, B X comprising a transgene or transgene cassette, in particular a transgene cassette encoding a bispecific T cell engager according to the present disclosure.

[0123] In one embodiment, B Y comprising a transgene or transgene cassette, in particular a transgene cassette encoding a bispecific T cell engager according to the present disclosure.

[0124] In one embodiment, B Y comprising a transgene or transgene cassette, in particular a transgene cassette encoding a bispecific T cell engager according to the present disclosure and B X Represents a key.

[0125] In one embodiment, B X and B Y All include a transgene or a transgene cassette.

[0126] In one embodiment, the one or more transgenic or transgenic boxes are controlled by endogenous or exogenous promoters, such as endogenous promoters. Advantageously, when under the control of these promoters, the virus maintains replication ability and is also able to express bispecific T cell adapters and / or other proteins. Therefore, the bispecific T cell adapter selected will be expressed by cancer cells. In certain embodiments, it may be advantageous to adopt an exogenous promoter because the exogenous promoter can strongly and constitutively express antibodies or fragments, which may be particularly useful in some cases, such as when the patient has serious diffuse cancer. It may be advantageous to adopt an endogenous promoter because the endogenous promoter reduces the size of the transgenic box that needs to be incorporated to express the bispecific T cell adapter, that is, because it is not necessary to include an exogenous promoter, the box can be smaller.

[0127] Thus, in one embodiment, the transgene or transgene cassette is under the control of an endogenous promoter selected from the group consisting of an E4 promoter and a major late promoter, in particular the major late promoter. Utilizing an endogenous promoter in a virus may also be advantageous in a therapeutic setting because the transgene is only expressed when the virus replicates in the cancer cell rather than a constitutive exogenous promoter which would continuously transcribe the transgene and potentially result in inappropriate concentrations of the antibody or fragment.

[0128] In one embodiment, the transgene or transgene cassette (e.g., encoding a bispecific T cell engager) is under the control of an exogenous promoter such as CMV. Advantageously, the use of a constitutive exogenous promoter results in continuous transcription of the transgene, which may be desirable in some cases.

[0129] In one embodiment, one transgene or transgene cassette (e.g., encoding a bispecific T cell engager) is under the control of an endogenous promoter and the other transgene or transgene cassette (e.g., encoding a bispecific T cell engager) is under the control of an exogenous promoter.

[0130] In one embodiment, all transgenes or transgene cassettes in the virus (eg, encoding a bispecific T cell engager) are under the control of an endogenous promoter.

[0131] In another embodiment, all transgenes or transgene cassettes in the virus (e.g., encoding a bispecific T cell engager) are under the control of an exogenous promoter.

[0132] In one embodiment, the transgene or transgene cassette further comprises regulatory elements independently selected from the group consisting of:

[0133] i) a splice acceptor sequence,

[0134] ii) internal ribosome entry sequence or highly self-cleaving 2A peptide,

[0135] iii) Kozak sequence and

[0136] iv) combinations thereof.

[0137] Thus, in one embodiment, the transgene cassette comprises i) or ii) or iii) or iv).

[0138] In one embodiment, the transgene cassette comprises i) and ii), or i) and iii), or i) and iv), or ii) and iii), or ii) and iv), or iii) and iv).

[0139] In one embodiment, the transgene cassette comprises i) and ii) and iii), or i) and ii) and iv), or i) and iii) and iv), or ii) and iii) and iv).

[0140] In one embodiment, the transgene cassette includes i) and ii) and iii) and iv).

[0141] In one embodiment, the transgene cassette includes a Kozak sequence at the beginning of the protein (eg, bispecific T cell engager) encoding sequence, which facilitates translation of the mRNA.

[0142] In one embodiment, the transgene cassette encodes a high self-cleavage efficiency 2A peptide.

[0143] In one embodiment, the transgene cassette further comprises a polyadenylation sequence.

[0144] In one embodiment, the transgene cassette further comprises a restriction site located at the 3' end of the DNA sequence and / or at the 5' end of the DNA sequence.

[0145] In one embodiment, at least one transgene cassette encodes a monocistronic mRNA.

[0146] In one embodiment, the bispecific T cell engager molecule has a short half-life, e.g., 48 hours or less.

[0147] In one embodiment, the bispecific T cell engager molecule is selected from E1, E3, BX 、B Y Advantageously, the inventors have determined that a variety of genes can be inserted into B under the control of exogenous or endogenous promoters. X and / or B Y without adversely affecting the viral life cycle or vector stability.

[0148] In one embodiment, a bispecific T cell engager molecule is encoded at least at position B, for example, under the control of a major late promoter. X Advantageously, the transgene or transgene cassette allows for the expression of the bispecific T cell engager or any other molecule along with the adenovirus itself. Importantly, the inventors have successfully demonstrated that expression of the bispecific T cell engager does not significantly affect the ability of the EnAd to replicate, nor does it negatively impact its oncolytic activity.

[0149] In one embodiment, a bispecific T cell engager molecule is encoded at least at position B, for example, under the control of a major late promoter. Y Advantageously, the transgene or transgene cassette allows for the expression of the bispecific T cell engager or any other molecule along with the adenovirus itself. Importantly, the inventors have successfully demonstrated that expression of the bispecific T cell engager does not significantly affect the ability of the EnAd to replicate, nor does it negatively impact its oncolytic activity.

[0150] In one embodiment, the adenovirus further encodes a second bispecific T cell engager.

[0151] In one embodiment, the first bispecific T cell engager molecule is specific for a tumor antigen, e.g., a tumor antigen as described above, and the second bispecific T cell engager molecule is specific for a tumor stromal antigen, e.g., a stromal antigen as described above.

[0152] In one embodiment, the first bispecific T cell engager molecule is specific for a tumor antigen selected from the group consisting of: CEA, MUC-1, EpCAM, HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y 、Le x 、Le b, PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2 and ErbB3, and the second bispecific T cell engager molecule is specific for a tumor stromal antigen selected from the group consisting of: fibroblast activation protein (FAP), TREM1, IGFBP7, FSP-1, platelet-derived growth factor-alpha receptor (PDGFR-α), platelet-derived growth factor-beta receptor (PDGFR-β) and vimentin.

[0153] In one embodiment, the first bispecific T cell engager molecule is specific for EpCAM and the second bispecific T cell engager molecule is specific for a tumor stromal antigen selected from the group consisting of: fibroblast activation protein (FAP), TREM1, IGFBP7, FSP-1, platelet-derived growth factor-alpha receptor (PDGFR-alpha), platelet-derived growth factor-beta receptor (PDGFR-beta), and vimentin.

[0154] In one embodiment, the first bispecific T cell engager molecule is specific for a tumor antigen selected from the group consisting of: CEA, MUC-1, EpCAM, HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y 、Le x 、Le b , PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2 and ErbB3, and the second bispecific T cell engager is specific for FAP.

[0155] In one embodiment, the first bispecific T cell engager molecule is specific for EpCAM and the second bispecific T cell engager molecule is specific for FAP.

[0156] In another embodiment, the first bispecific T cell engager molecule is specific for a tumor antigen and the second bispecific T cell engager molecule is specific for a non-TCR activating protein.

[0157] In one embodiment, the first bispecific T cell engager molecule is specific for a tumor antigen selected from the group consisting of: CEA, MUC-1, EpCAM, HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y 、Le x 、Le b, PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2 and ErbB3.

[0158] In one embodiment, the first bispecific T cell engager molecule is specific for EpCAM and the second bispecific T cell engager molecule is specific for a non-TCR activating protein selected from the group consisting of: CD31, CD2 and CD277.

[0159] In one embodiment, the first bispecific T cell engager molecule is specific for a tumor stromal antigen and the second bispecific T cell engager molecule is specific for a non-TCR activating protein.

[0160] In one embodiment, the first bispecific T cell engager molecule is specific for a tumor stromal antigen selected from the group consisting of: fibroblast activation protein (FAP), TREM1, IGFBP7, FSP-1, platelet-derived growth factor-alpha receptor (PDGFR-alpha), platelet-derived growth factor-beta receptor (PDGFR-beta), and vimentin, and the second bispecific T cell engager molecule is specific for a non-TCR activating protein selected from the group consisting of: CD31, CD2, and CD277.

[0161] In one embodiment, the first bispecific T cell engager molecule is specific for FAP and the second bispecific T cell engager molecule is specific for a non-TCR activating protein selected from the group consisting of: CD31, CD2, and CD277.

[0162] In one embodiment, the adenovirus comprises only one bispecific T cell engager.

[0163] In another embodiment, the adenovirus comprises two bispecific T cell engagers.

[0164] In another embodiment, the adenovirus comprises three bispecific T cell engagers.

[0165] In addition to encoding one, two, or three bispecific T cell engagers, the virus can also encode one, two, three, or four additional transgenes.

[0166] In one embodiment, the adenovirus further encodes a cytokine or chemokine.

[0167] In one embodiment, the adenovirus further encodes a cytokine.

[0168] In one embodiment, the adenovirus further encodes a chemokine.

[0169] In another embodiment, the adenovirus further encodes a cytokine and a chemokine.

[0170] In one embodiment, the adenovirus comprises a bispecific T cell engager and at least one cytokine or chemokine, such as 1, 2 or 3 cytokines, 1, 2 or 3 chemokines or a combination of 2 or 3 genes, each gene independently encoding a chemokine, cytokine or chemokine.

[0171] In another embodiment, the adenovirus comprises two bispecific T cell engagers and at least one cytokine or chemokine, such as 1 or 2 cytokines, 1 or 2 chemokines, or a combination of cytokines and chemokines.

[0172] In another embodiment, the adenovirus comprises three bispecific T cell engagers and at least one cytokine or chemokine.

[0173] In one embodiment, the cytokine or chemokine is selected from: IL-1α, IL-1β, IL-6, IL-9, IL-12, IL-13, IL-17, IL-18, IL-22, IL-23, IL-24, IL-25, IL-26, I L-27, IL-33, IL-35, IL-2, IL-4, IL-5, IL-7, IL-10, IL-15, IL-21, IL-25, IL-1RA, IFNα, IFNβ, IFNγ, TNFα, lymphotoxin α (LTA) and GM-CSF, IL-8, CCL2, CCL3, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCL10, CXCL11, CXCL13, CXCL12, CCL2, CCL19, CCL21, e.g., IL-12, IL-18, IL-22, IL-7, IL-15, IL-21, IFNγ, TNFα, lymphotoxin alpha (LTA), CCL3, CCL5, CXCL9, CXCL12, CCL2, CCL19, and CCL21.

[0174] In one embodiment, the encoded cytokine is selected from the group consisting of: TNFα superfamily (TNFRSF comprises TNF-α, TNF-C, OX40L, CD154, FasL, LIGHT, TL1A, CD70, Siva, CD153, 4-1BB ligand, TRAIL, RANKL, TWEAK, APRIL, BAFF, CAMLG, NGF, BDNF, NT-3, NT-4, GITR ligand, EDA-A, EDA-A2), TGF-β superfamily, IL-1 family (i.e., IL-1 and IL-8), IL-2 family, IL-10 family, IL-17 family, interferon family.

[0175] In one embodiment, the chemokine is selected from the group consisting of: MIP-1α, RANTES, IL-8, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCL10, CXCL11, CXCL13, CXCL12, CCL2, CCL19, and CCL21.

[0176] In one embodiment, the adenovirus further comprises an immunomodulatory factor specific for a checkpoint protein or a co-stimulatory molecule, such as an antibody or antibody fragment, or a protein or peptide ligand, or a specific binding partner for these molecules.

[0177] In one embodiment, the immunomodulator is an antibody or antibody fragment, or a protein or peptide ligand specific for a checkpoint protein, such as CTLA-4, PD-1, PD-L1, PD-L2, VISTA, B7-H3, B7-H4, HVEM, ILT-2, ILT-3, ILT-4, TIM-3, LAG-3, BTLA, LIGHT or CD160, for example, CTLA-4, PD-1, PD-L1 and PD-L2.

[0178] In one embodiment, the immunomodulatory factor is an inhibitor, such as a checkpoint inhibitor.

[0179] In one embodiment, the immunomodulatory factor is an agonist.

[0180] In another embodiment, the immunomodulatory factor is an antibody or antibody fragment, or a protein or peptide ligand specific for a co-stimulatory molecule, such as CD28, CD80, CD86, CD83, ICOS, B7H2, TL1A, and 4-1BB.

[0181] In one embodiment, the adenovirus comprises a first antibody, antibody fragment, protein or peptide ligand specific for a checkpoint protein and a second antibody, antibody fragment, protein or peptide ligand specific for a co-stimulatory molecule.

[0182] In one embodiment, the bispecific T cell engager comprises a VH domain comprising an amino acid sequence set forth in any one of SEQ ID NOs: 8, 13, or 18, or an amino acid sequence that is at least 95% identical thereto.

[0183] In one embodiment, the bispecific T cell engager comprises a VL domain comprising an amino acid sequence set forth in any one of SEQ ID NOs: 9, 12, or 17, or an amino acid sequence that is at least 95% identical thereto.

[0184] In one embodiment, the bispecific T cell engager comprises a scFv comprising the amino acid sequence set forth in any one of SEQ ID NOs: 7, 11, or 16, or an amino acid sequence that is at least 95% identical thereto.

[0185] In one embodiment, the bispecific T cell engager used in the present disclosure (i.e., encoded by an adenovirus) comprises the following two binding domains: a VH domain having a sequence shown in SEQ ID NO: 8 or a sequence at least 95% identical thereto, and a VL domain having a sequence shown in SEQ ID NO: 9 or a sequence at least 95% identical thereto.

[0186] In one embodiment, the bispecific T cell engager used in the present disclosure (i.e., encoded by an adenovirus) comprises the following two binding domains: a VH domain having a sequence as shown in SEQ ID NO: 13 or a sequence at least 95% identical thereto, and a VL domain having a sequence as shown in SEQ ID NO: 12 or a sequence at least 95% identical thereto.

[0187] In one embodiment, the bispecific T cell engager used in the present disclosure (i.e., encoded by an adenovirus) comprises the following two binding domains: a VH domain having a sequence shown in SEQ ID NO: 18 or a sequence at least 95% identical thereto, and a VL domain having a sequence shown in SEQ ID NO: 17 or a sequence at least 95% identical thereto.

[0188] In one embodiment, the bispecific T cell engager used in the present disclosure (i.e., encoded by an adenovirus) includes the following four binding domains: a VH domain having a sequence as shown in SEQ ID NO: 8 or a sequence at least 95% identical thereto; and a VL domain having a sequence as shown in SEQ ID NO: 9 or a sequence at least 95% identical thereto; and a VH domain having a sequence as shown in SEQ ID NO: 13 or a sequence at least 95% identical thereto; and a VL domain having a sequence as shown in SEQ ID NO: 12 or a sequence at least 95% identical thereto.

[0189] In one embodiment, the bispecific T cell engager used in the present disclosure (i.e., encoded by an adenovirus) includes the following four binding domains: a VH domain having a sequence as shown in SEQ ID NO: 8 or a sequence at least 95% identical thereto; and a VL domain having a sequence as shown in SEQ ID NO: 9 or a sequence at least 95% identical thereto; and a VH domain having a sequence as shown in SEQ ID NO: 18 or a sequence at least 95% identical thereto; and a VL domain having a sequence as shown in SEQ ID NO: 17 or a sequence at least 95% identical thereto.

[0190] In one embodiment, the bispecific T cell engager employed in the present disclosure (ie, encoded by an adenovirus) comprises the sequences set forth in SEQ ID NOs: 7, 11, 16, or a sequence at least 95% identical to any one of these sequences.

[0191] In one embodiment, the bispecific T cell engager employed in the present disclosure (ie, encoded by an adenovirus) comprises the sequence set forth in SEQ ID NO: 7, or a sequence that is at least 95% identical thereto.

[0192] In one embodiment, the bispecific T cell engager employed in the present disclosure (ie, encoded by an adenovirus) comprises the sequence set forth in SEQ ID NO: 11, or a sequence that is at least 95% identical thereto.

[0193] In one embodiment, the bispecific T cell engager employed in the present disclosure (ie, encoded by an adenovirus) comprises the sequence set forth in SEQ ID NO: 16, or a sequence that is at least 95% identical thereto.

[0194] In one embodiment, the bispecific T cell engager comprises the amino acid sequence set forth in SEQ ID NO: 2 or 4, or an amino acid sequence that is at least 95% identical thereto, such as the amino acids set forth in SEQ ID NO: 73 or 75.

[0195] In one embodiment, the adenovirus according to the present disclosure comprises a DNA sequence set forth in any one of SEQ ID NOs: 34 to 37, or a DNA sequence that hybridizes thereto under stringent conditions.

[0196] In one embodiment, the adenovirus according to the present disclosure comprises a DNA sequence set forth in any one of SEQ ID NOs: 79 to 82.

[0197] In one embodiment, the adenovirus according to the present disclosure comprises a DNA sequence shown in any one of SEQ ID NOs: 34, 35, 36, 37, 79, 80, 82, 96, 97, 98, 99, 100, 101, 102, 103, 120, 298, or a sequence encoding the same virus, or a sequence that hybridizes to any one of them under stringent conditions.

[0198] In one embodiment, the adenovirus according to the present disclosure comprises a DNA sequence shown in any one of SEQ ID NOs: 34, 35, 36, 37, 79, 80, 82, 96, 97, 98, 99, 100, 101, 102, 103, 120, or 298.

[0199] The skilled artisan recognizes that redundancy exists in the DNA code, and therefore the present disclosure extends to EnAd or Ad11 encoding a bispecific T cell engager having the amino acids disclosed herein.

[0200] A C-terminal deca-His (HHHHHHHHHHH SEQ ID NO: 24) affinity tag can be used to purify the bispecific T cell engager or adenovirus. However, it is optional and can be excluded, for example, in the final product. The skilled person will also appreciate that other affinity tags besides deca-His can be used and that these tags can likewise be excluded without affecting the biological function of the bispecific T cell engager or adenovirus. Thus, in one embodiment, the bispecific T cell engager comprises the amino acid sequence set forth in any one of SEQ ID NOs: 2 or 4, but does not include a deca-His affinity tag at the C-terminus of the sequence, for example, as set forth in SEQ ID NOs: 73 or 75. In another embodiment, the adenovirus comprises the DNA sequence set forth in any one of SEQ ID NOs: 34 to 37, but does not include a deca-His affinity tag, for example, as set forth in any one of SEQ ID NOs: 79 to 82.

[0201] The exclusion of the deca-His affinity tag further extends to all other sequences disclosed herein that include a deca-His affinity tag, i.e., the disclosure encompasses the same amino acid or DNA sequence lacking a C-terminal deca-His tag (HHHHHHHHHH or CATCACCATCACCATCACCACCATCACCATCACCAT), for example, as set forth in any one of SEQ ID NOs: 72 to 82.

[0202] In one embodiment, the bispecific T cell engager encoded by the virus of the present disclosure is under the control of an exogenous promoter, such as a CMV promoter. When the transgene is between the L5 and E4 regions, the exogenous promoter can be placed between the MPL and the encoded transgene.

[0203] When the transgene is between the L5 and E3 regions, exogenous proteins can be placed between the encoded transgene and L5.

[0204] In one aspect, a composition comprising an adenovirus as described herein and a diluent or carrier is provided.

[0205] In one aspect, a method of treating a patient is provided, comprising administering a therapeutically effective amount of an adenovirus or composition as described herein.

[0206] In one embodiment, the method is used to treat cancer, such as epithelial cancer, particularly solid tumors.

[0207] In one embodiment, a treatment method is provided, which comprises administering a virus according to the present disclosure in combination with a checkpoint inhibitor (such as a PD-1 or PDL1 inhibitor), particularly wherein the checkpoint inhibitor is encoded in the virus.

[0208] In one embodiment, a method of treatment is provided comprising administering a virus according to the present disclosure, not in combination with a checkpoint inhibitor (e.g., those listed elsewhere herein, such as a PD-1 or PDL1 inhibitor), particularly wherein the checkpoint inhibitor is not encoded in the virus.

[0209] According to the present disclosure, the bispecific T cell engagers encoded by viruses have the ability to enhance viral cytotoxicity.

[0210] Surprisingly, the virally encoded bispecific T cell engagers according to the present disclosure can activate CD4+ cells and / or CD8+ cells, e.g., cells even in the suppressive environment of a tumor, e.g., T cells in tumor-containing fluid environments such as ascites.

[0211] Advantageously, the virally encoded bispecific T cell engagers according to the present disclosure can activate cytotoxic T cells, for example, even in the suppressive environment of a tumor, such as in tumor-containing fluid environments such as ascites.

[0212] Even more surprisingly, the virally encoded bispecific T cell engagers according to the present disclosure are able to stimulate (activate) T cell proliferation.

[0213] Viruses encoding bispecific T cell engagers according to the present disclosure appear to be able to bypass, overcome, or reverse the immunosuppressive microenvironment of tumors.

[0214] In one embodiment, activation of T cells results in upregulation of T cell markers, such as CD25.

[0215] In one embodiment, the binding of the bispecific T cell engager in a virus according to the present disclosure is specific for a neoantigen.

[0216] The present disclosure also extends to the novel sequences disclosed herein. DETAILED DESCRIPTION

[0217] As used herein, immune cells are cells that have functional roles in the immune system, including (but not limited to) macrophages, neutrophils, dendritic cells, NK cells, and lymphocytes such as T lymphocytes (specifically T cells and NKT cells).

[0218] As used herein, the term antibody refers to an immunoglobulin molecule that is capable of specifically binding to a target antigen, such as a carbohydrate, polynucleotide, lipid, polypeptide, peptide, etc., through at least one antigen recognition site (also referred to herein as a binding site) located in the variable region of the immunoglobulin molecule. Unless the context indicates otherwise, the term extends to full-length antibodies and multispecific antibody molecules including full-length antibodies.

[0219] As used herein, "antibody molecules" encompass antibodies and binding fragments thereof and multispecific forms of any of them.

[0220] As used herein, an antigen binding site refers to the portion of a molecule comprising a pair of variable regions, particularly a cognate pair, that specifically interacts with a target antigen.

[0221] Specifically, as used herein, it is intended to refer to a binding site that recognizes only its specific antigen or a binding site that has a significantly higher binding affinity for the antigen than it has for the antigen for which it is not specific, for example, a binding affinity that is 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold higher.

[0222] As used herein, binding fragment or antibody binding fragment refers to antibody binding fragments and multispecific antibody molecules, including antibody binding fragments, including but not limited to Fab, modified Fab, Fab', modified Fab', F(ab')2, Fv, single domain antibody, scFv, bivalent antibody, trivalent antibody or tetravalent antibody, Bis-scFv, diabody, triabody, tetrabody and epitope binding fragments of any of the above (see, e.g., Holliger and Hudson, 2005, Nature Biotech. 23(9):1126-1136; Adair and Lawson, 2005, Drug Design Reviews-Online 2(3), 209-217). Methods for generating and preparing these antibody fragments are well known in the art (see, e.g., Verma et al., 1998, Journal of Immunological Methods, 216:165-181). Other antibody fragments useful in the present disclosure include Fab and Fab' fragments described in International Patent Applications WO05 / 003169, WO05 / 003170 and WO05 / 003171. Multivalent antibodies may comprise multiple specificities, eg, bispecific or may be monospecific (see, eg, WO92 / 22853 and WO05 / 113605).

[0223] In one embodiment, the adenovirus comprises a multispecific antibody molecule.

[0224] As used herein, a multispecific antibody molecule refers to an antibody molecule that has two or more antigen binding domains, eg, two (bispecific) or three (trispecific) or four (tetraspecific) binding domains.

[0225] The multispecific antibody molecules of the present disclosure can be constructed from various antibody fragments, such as those described above. For example, a diabody is a bispecific antibody molecule composed of a non-covalent dimer of ScFv fragments, while a F(ab')2 is a bispecific antibody molecule composed of two Fab fragments connected by a hinge region. Thus, the skilled artisan will appreciate that different antibody fragments can be arranged in various combinations to produce bispecific or multispecific antibody molecules.

[0226] Examples of trispecific or tetraspecific antibody formats include, but are not limited to, Fab3, triabody, tetrabody, trimer, DVD-Ig, IgG-scFv, ScFv2-Fc, tandAb, and DNL-Fab3.

[0227] As used herein, a bispecific antibody molecule refers to a molecule having two antigen binding domains, which can bind to the same or different antigens. Bispecific T cell engagers are a subclass of bispecific antibody molecules.

[0228] The domains can bind different antigens.

[0229] Alternatively, the domains may all bind to the same antigen, comprise binding to the same epitope on the antigen, or bind to different epitopes on the same antigen.

[0230] Examples of bispecific antibody formats include, but are not limited to, bispecific T cell engager, F(ab')2, F(ab')-ScFv2, di-scFv, diabody, minibody, scFv-Fc, DART, TandAb, ScDiabody, ScDiabody-CH3, diabody-CH3, triabody, minibody, minibody, TriBi minibody, ScFv-CH3 KIH (knob-in-hole), Fab-ScFv, SCFv-CH-CL-scFv, scFv-KIH, Fab-scFv-Fc, tetravalent HCAb, scDiabody-Fc, diabody-Fc, intrabody, docking and locking antibody, ImmTAC, HSAbody, ScDiabody-HSA, human, and tandem ScFv-toxin (see, e.g., Christoph Spiess et al., Molecular Immunology, 67 (2015), pp. 95-106).

[0231] The adenoviruses of the present disclosure include bispecific T cell engagers that are specific for at least one surface antigen on a T cell of interest. Examples of T cell surface antigens include, but are not limited to, CD3, CD2, VLA-1, CD8, CD4, CCR6, CXCR5, CD25, CD31, CD45RO, CD197, CD127, CD38, CD27, CD196, CD277, and CXCR3, specifically CD2, CD3, CD31, and CD277.

[0232] As used herein, a bispecific T cell engager refers to a class of artificial bispecific monoclonal antibodies that include two different antibodies of scFv or amino acid sequences from four different genes on a single peptide chain of about 55KDa. One of the scFvs is specific for immune cells, such as T cell antigens expressed on the surface of T cells, such as the CD3 receptor. The other scFv typically binds to tumor cells through tumor-specific molecules. Therefore, the bispecific T cell engager is able to form a connection between T cells and tumor cells through its specificity for antigens on T cells and antigens on tumor cells. This leads to the activation of T cells and triggers T cells to exert their cytotoxic effects on tumor cells, regardless of MHC I or co-stimulatory molecules. Examples of therapies based on bispecific T cell engagers currently approved or undergoing clinical trials include, for example, Blinatumomab targeting CD19 And it is used to treat non-Hodgkin lymphoma and acute lymphoblastic leukemia and Solitomab, which targets EpCAM and is used to treat gastrointestinal cancer and lung cancer.

[0233] In one embodiment, the immune cell engager (such as a T cell engager) is arranged in the form of VL1-Linker 1-VH1-Linker 2-VH2-Linker 3-VL2, for example using linkers independently selected from the linker sequences disclosed herein.

[0234] In one embodiment, the linkers in the bispecific T cell engager according to the present disclosure are independently selected from SEQ ID NOs: 10, 14, 23, 124 to 162, and 166 to 297.

[0235] In one embodiment, linker 1 and linker 3 have the same sequence, such as SEQ ID NOs: 10, 14, 23, 124 to 162 and 166 to 296, specifically any one of 10, 14 and 23.

[0236] In one embodiment, Linker 1 and Linker 3 have different amino acid sequences, for example, independently selected from SEQ ID NOs: 10, 14, 23, 124 to 162 and 166 to 296, specifically 10, 14 and 23.

[0237] In one embodiment, Linker 1 is SEQ ID NO:10.

[0238] In one embodiment, Linker 1 is SEQ ID NO:14.

[0239] In one embodiment, Linker 3 is SEQ ID NO:10.

[0240] In one embodiment, Linker 3 is SEQ ID NO:14.

[0241] In one embodiment, Linker 1 and Linker 3 are SEQ ID NO:10.

[0242] In one embodiment, Linker 1 and Linker 3 are SEQ ID NO:14.

[0243] In one embodiment, Linker 1 is SEQ ID NO: 10 and Linker 3 is SEQ ID NO: 14.

[0244] In one embodiment, Linker 1 is SEQ ID NO: 14 and Linker 3 is SEQ ID NO: 10.

[0245] In one embodiment, Linker 2 is different from both Linker 1 and Linker 3.

[0246] In one embodiment, Linker 2 is selected from any one of SEQ ID NOs: 10, 14, 23, 124 to 162 and 166 to 297, such as SEQ ID NO: 297.

[0247] In one embodiment, Linker 1 has a length ranging from 10 to 30 amino acids, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30.

[0248] In one embodiment, Linker 3 has a length ranging from 10 to 30 amino acids, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30.

[0249] In one embodiment, Linker 2 has a length ranging from 2 to 10 amino acids, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids.

[0250] In one embodiment, VH1 and VL1 are specific for a T cell antigen according to the disclosure, such as CD3.

[0251] In one embodiment, VH2 and VL2 are specific for an immune cell antigen such as a T cell antigen according to the disclosure, such as CD3.

[0252] In one embodiment, VH1 and VL1 are specific for an antigen or antigens of interest, such as a cancer antigen or a stromal antigen.

[0253] In one embodiment, VH2 and VL2 are specific for an antigen or antigen of interest, such as a cancer antigen or a stromal antigen.

[0254] As used herein, matrix or matrix antigen refers to an antigen therapeutic target in the matrix, including expression in the molecular structure of the matrix matrix, such as connective tissue molecules or molecules associated with this matrix or antigens associated with cellular components of the matrix, such as fibroblasts, tumor-associated macrophages, dendritic cells, NK cells and / or T cells that have infiltrated the matrix. Examples of matrix antigens include but are not limited to FAP, TGFβ, TREM1, IGFBP7, FSP-1, fibroblast-associated antigens, NG2, endosialin (CD248), platelet-derived growth factor alpha receptor (PDGFR-α), platelet-derived growth factor-beta receptor (PDGFR-β) and vimentin.

[0255] Fibroblasts can be targeted by employing the antigen fibroblast activation protein (FAP), specifically a FAP-specific antibody that does not bind CD26 (see US 2012 / 0258119, incorporated herein by reference).

[0256] FAP was originally identified as a serine protease on reactive stromal fibroblasts. Subsequent molecular cloning revealed that FAP is identical to seprase, a 170 kDa membrane-associated gelatinase expressed by melanoma cell lines. The full-length cDNA encodes a 760 amino acid (aa) H-type transmembrane protease that is highly homologous to dipeptidyl peptidase IV (DPPIV), sharing 52% identity across the entire sequence and almost 70% identity in the catalytic domain. US Pat. No. 5,587,299, incorporated herein by reference, describes nucleic acid molecules encoding FAP and their uses.

[0257] FAP and DPPIV have similar gene sizes and are chromosomally adjacent to each other at 2q24, indicating a gene duplication event (Genebank accession number U09278). Both proteins are members of the prolyl peptidase family. This class of enzymes is inducible, active on the cell surface or in the extracellular fluid, and uniquely capable of cleaving N-terminal dipeptides from polypeptides with proline or alanine at the penultimate position. DPPIV, also known as CD26, is constitutively expressed by several cell types, including fibroblasts, endothelial cells and epithelial cells, and leukocyte subsets such as NK cells, T lymphocytes, and macrophages. A small portion of DPPIV circulates in the blood as a soluble protein. In contrast to DPPIV, FAP is not usually expressed in normal adult tissues, and its proteolytically active soluble form is referred to as α2-antiplasmin lyase (APCE). Marked FAP expression occurs in conditions associated with activated matrix, including wound healing, epithelial cancer, osteoarthritis, rheumatoid arthritis, cirrhosis, and pulmonary fibrosis.

[0258] The FAP structure has been solved (PDB ID 1Z68) and is very similar to the structure of DPPIV. FAP is anchored in the plasma membrane by an uncleaved signal sequence of about 20 amino acids and has a short amino-terminal cytoplasmic domain of six amino acids. The main part of the protein containing the catalytic domain is exposed to the extracellular environment. The FAP glycoprotein is a homodimer composed of two identical 97-kDa subunits. Each FAP-monomer subunit consists of two domains, an αβ hydrolase domain (aa 27 to 53 and 493 to 760) and an eight-leaf β propeller domain (aa 54 to 492) surrounding a large cavity. A small pocket in this cavity at the interface of the two regions contains a catalytic triad (Ser624, Asp702, and His734). FAP obtains its enzymatic activity after subunit homodimerization, and in addition to its dipeptidyl peptidase activity, FAP also has type I collagen-specific gelatinase and endopeptidase activity. The β-propeller acts as a scaffold for protein-protein interactions and determines substrate and extracellular matrix (ECM) binding. In addition, the β-propeller participates in the formation of supramolecular complexes of FAP with other prolyl peptidases or with other membrane-bound molecules. It was found that the formation of heteromeric or tetrameric complexes of FAP and DPPIV is associated with the pseudopodia of migrating cells on collagen substrates. Type I collagen induces the tight binding of FAP to β1 integrin, thereby playing a major organizational role in the formation and adhesion of pseudopodia. Although the mechanisms involved are not understood in detail, the formation of this protease-rich membrane domain at the cell invasion front contributes to directional extracellular ECM degradation. This indicates that the interaction between FAP and ECM may affect cell adhesion, migration, proliferation and apoptosis through the integrin pathway, and supports the role of FAP in disease pathogenesis and progression, thereby being closely related to invasive cell behavior. In summary, FAP is considered to be a multifunctional protein that performs its biological functions in a cell-dependent manner through a combination of its protease activity and its ability to form complexes with other cell surface molecules. Overexpression of FAP in epithelial and fibroblast cell lines promotes malignant behavior, pointing to clinical scenarios in which cellular expression levels of FAP correlate with worse clinical outcomes.

[0259] Through paracrine signaling molecules, cancer cells activate stromal fibroblasts and induce FAP expression, which in turn affects cancer cell proliferation, invasion, and migration. Recent studies have demonstrated that TGF-β is a major factor promoting FAP protein expression (Chen, H et al., (2009), Exp and Molec Pathology, doi: 10.1016 / j.yexmp.2009.09.001). FAP is abundantly expressed in reactive stromal fibroblasts in 90% of human epithelial cancers, including breast, lung, colon, and ovarian cancers (Garin-Chesa, P et al., (1990), PNAS USA, 87:7236-7239). Chen et al. recently showed that FAPα affects the invasion, proliferation and migration of HO-8910PM ovarian cancer cells (Chen, H et al. (2009), Experimental and Molecular Pathology, doi: 10.1016 / j.yexmp.2009.09.001).

[0260] FAP can be targeted by binding to the antigen and sterically blocking its interaction with biologically relevant molecules. Alternatively or additionally, crosslinking of a FAP molecule with another FAP molecule or a different molecule, such as an antigen on the surface of a cancer cell, can be achieved using multispecific antibody molecules such as bispecific antibody molecules. This crosslinking increases the visibility of the antigen-bearing cells to the immune system, which can then be activated to neutralize or destroy the immune system.

[0261] Tumor-associated macrophages (TAMs) are thought to express TREM1, CD204, CD68 (alone or in combination with CD163 or CD206). These markers can be used to target TAMs.

[0262] The adenoviruses disclosed herein have the ability to infect tumor cells, and specifically, they preferentially infect tumor cells. Oncolytic viral infection causes the death and lysis of cancer cells, releasing newly generated viral particles. Incorporated transgenes encoding antibodies, bispecific T cell engagers, and other "payloads" are newly synthesized and actively secreted by tumor cells before they die, and some molecules are also released upon cell lysis.

[0263] Antibody molecules with a short half-life may be particularly suitable for use in the present disclosure as this minimizes off-target effects since the body will quickly clear the molecule if it becomes systemically available.

[0264] NKT cells have the ability to target and destroy tumor-associated macrophages. However, their activity appears to be suppressed by the hypoxic environment of the tumor. This activity can be restored by providing IL-2 and / or IL-15, for example, encoded in the viruses disclosed herein, to NKT cells.

[0265] Therefore, in one embodiment, the virus according to the present disclosure further encodes a cytokine to activate NKT cells, for example, selected from IL-2, IL-15 and a combination thereof. The gene encoding the cytokine can be located at the same position or at a different position than the gene encoding the antibody molecule, for example, independently selected from E1, E3, E4, B X and B Y .

[0266] Thus, adenoviruses according to the present disclosure possess at least two or three mechanisms to attack tumors, including an indirect mechanism that destroys the tumor stroma.

[0267] As used herein, a transgenic gene is a gene that has been inserted into a genomic sequence that is not natural to the virus (exogenous) or a gene that is not normally found in a specific location in the virus. Examples of transgenic genes are as follows. As used herein, a transgenic gene also includes a functional fragment of a gene, which is a portion of a gene that, when inserted, is adapted to perform the function or a substantial portion of the function of the full-length gene.

[0268] Unless the context indicates otherwise, transgenic and coding sequence are used interchangeably in the context of insertion into a viral genome. As used herein, coding sequence refers to, for example, a DNA sequence that encodes a functional RNA, peptide, polypeptide, or protein. Typically, a coding sequence is a cDNA that encodes a transgenic functional RNA, peptide, polypeptide, or protein of interest. Functional RNAs, peptides, polypeptides, and proteins of interest are described below.

[0269] Obviously, viral genomes contain coding sequences of DNA. In the context of this specification, endogenous (naturally occurring genes) in the genomic sequences of viruses are not considered to be transgenic unless subsequently modified by recombinant technology, such as they are in a non-natural location or in a non-natural environment.

[0270] In one embodiment, as used herein, a transgene refers to a DNA segment containing a gene or cDNA sequence that has been isolated from one organism and introduced into a different organism, i.e., a virus of the present disclosure. In one embodiment, this non-natural DNA segment can retain the ability to produce functional RNA, peptides, polypeptides, or proteins.

[0271] Thus, in one embodiment, the inserted transgene encodes a human or humanized protein, polypeptide, or peptide.

[0272] In one embodiment, the inserted transgene encodes a non-human protein, polypeptide or peptide (e.g., a non-human mammalian protein, polypeptide or peptide) or an RNA molecule, e.g., from a mouse, rat, rabbit, camel, llama, or the like. Advantageously, the viruses of the present disclosure allow transgene transport within cancer cells. Thus, such intracellular delivery can minimize the response generated by a human patient to a non-human sequence (e.g., a protein).

[0273] The DNA sequence may comprise more than one transgene, for example 1, 2, 3 or 4 transgenes, such as 1 or 2.

[0274] A transgene cassette can include more than one transgene, for example 1, 2, 3 or 4 transgenes, such as 1 or 2.

[0275] In one or more embodiments, the cartridge is arranged as shown in one or more of the Figures or Examples.

[0276] As used herein, a transgene cassette refers to a DNA sequence encoding one or more transgenes in the form of one or more coding sequences and one or more regulatory elements.

[0277] The transgene cassette may encode one or more monocistronic and / or polycistronic mRNA sequences.

[0278] In one embodiment, the transgene or transgene cassette encodes a monocistronic or polycistronic mRNA and, for example, the cassette is suitable for insertion into the adenoviral genome at a position under the control of an endogenous promoter or an exogenous promoter, or a combination thereof.

[0279] As used herein, monocistronic mRNA refers to an mRNA molecule that encodes a single functional RNA, peptide, polypeptide, or protein.

[0280] In one embodiment, the transgene cassette encodes a monocistronic mRNA.

[0281] In one embodiment, a transgene cassette, in the context of a cassette encoding a monocistronic mRNA, refers to a DNA segment optionally containing an exogenous promoter (which is a regulatory sequence that will determine when and where the transgene is active) or splice sites (which are regulatory sequences that determine when the mRNA molecule will be cleaved by the spliceosome) coding sequence (i.e., the transgene), typically derived from the cDNA of the protein of interest, optionally containing a polyA signal sequence and a terminator sequence.

[0282] In one embodiment, the transgene cassette may encode one or more polycistronic mRNA sequences.

[0283] As used herein, a polycistronic mRNA refers to an mRNA molecule that encodes two or more functional RNAs, peptides or proteins, or a combination thereof. In one embodiment, the transgene cassette encodes a polycistronic mRNA.

[0284] In one embodiment, in the context of a cassette encoding a polycistronic mRNA, a transgene cassette comprises a DNA segment optionally containing an exogenous promoter (which is a regulatory sequence that determines when and where the transgene is active) or splice sites (which are regulatory sequences that determine when the mRNA molecule will be cleaved by the spliceosome), two or more coding sequences (i.e., transgenes), typically derived from the cDNA of a protein or peptide of interest, for example, wherein each coding sequence is separated by an IRES or 2A peptide. Following the last coding sequence to be transcribed, the cassette may optionally contain a polyA sequence and a terminator sequence.

[0285] In one embodiment, the transgene cassette encodes a monocistronic mRNA followed by a polycistronic mRNA. In another embodiment, the transgene cassette encodes a polycistronic mRNA followed by a monocistronic mRNA.

[0286] In one embodiment, the adenovirus is a human adenovirus. As used herein, "adenovirus," "serotype," or "adenovirus serotype" refers to any adenovirus that can be assigned to any of the more than 50 currently known adenovirus serotypes, which are classified into subgroups A to F, and further extends to any adenovirus serotype that has not yet been identified or classified. See, for example, Strauss, "Adenovirus infections in humans," in Adenoviruses, Ginsberg, ea., Plenum Press, New York, NY, USA, pp. 451-596 (1984) and Shenk, "Adenoviridae: The Viruses and Their Replication," in Field of Virology, Vol. 2, No. 4, Knipe, 35 ea., Lippincott Williams and Wilkins, pp. 2265-2267 (2001), as shown in Table 1.

[0287] Table 1

[0288]

[0289] The adenovirus of the present disclosure is a subgroup B virus, namely Ad11, specifically Ad11p (Slobitski strain) and its derivatives, such as EnAd.

[0290] Adenoviruses are designated to their group / serotype based on the capsid, such as hexon and / or fiber.

[0291] The adenoviruses of the present disclosure are not Group A, Group C, Group D, Group E, or Group F viruses. The viruses of the present disclosure do not include an adenovirus death protein.

[0292] In one embodiment, the adenovirus of the present disclosure is chimeric. When the adenovirus is chimeric, the characteristics of the outer capsid are used to determine the serotype. As used herein, a chimera refers to a virus that includes DNA from at least two different viral serotypes, including different serotypes within the same group.

[0293] In one embodiment, the oncolytic virus has fiber, hexon and penton proteins from the same serotype, such as Ad11, specifically Ad11p, such as found at positions 30812 to 31789, 18254 to 21100 and 13682 to 15367 of the latter's genome sequence, where the nucleotide positions are relative to genbank ID 217307399 (accession number: GC689208).

[0294] In one embodiment, the adenovirus is enadenotucirev (also known as EnAd, and formerly known as EnAd). Enadenotucirev as used herein refers to the chimeric adenovirus of SEQ ID NO: 38. It is a replicating oncolytic chimeric adenovirus that has enhanced therapeutic properties compared to wild-type adenovirus (see WO2005 / 118825). EnAd has a chimeric E2B region that has DNA from Ad11p and Ad3, as well as a deletion in E3 / E4. The structural changes in enadenotucirev result in a genome that is approximately 3.5 kb smaller than Ad11p, thereby providing additional "space" for the insertion of transgenes.

[0295] Enadenotucirev (EnAd) is a chimeric oncolytic adenovirus, formerly known as EnAd (WO2005 / 118825), with fibers, pentons, and hexons from Ad11p, making it a subgroup B virus. It has a chimeric E2B region that includes DNA from Ad11p and Ad3. Almost all of the E3 region and a portion of the E4 region are deleted in EnAd. Therefore, it has significant space in the genome to accommodate additional genetic material while maintaining viability. In addition, because EnAd is a subgroup B adenovirus, pre-existing immunity in humans is not as common as, for example, Ad5. Other examples of chimeric oncolytic viruses with Ad11 fibers, pentons, and hexons include OvAd1 and OvAd2 (see WO2006 / 060314).

[0296] EnAd appears to preferentially infect tumor cells, rapidly replicate within them, and cause cytolysis. This, in turn, can generate an inflammatory immune response, thereby stimulating the body to fight the cancer. Part of EnAd's success is hypothesized to be related to the rapid viral replication in the body.

[0297] Although EnAd selectively lyses tumor cells, additional beneficial properties can be introduced, for example to increase the therapeutic activity of the virus or reduce its side effects by carrying it with a transgene, such as a transgene encoding a cell signaling protein or antibody or a transgene encoding an entity that stimulates one or more cell signaling proteins.

[0298] Advantageously, using viruses to carry DNA encoding certain proteins, such as bispecific T-cell engagers, that can be expressed inside cancer cells can enable the body's own defenses to be more effectively deployed against tumor cells, for example by making the cells more visible to the immune system or by preferentially delivering therapeutic genes / proteins to target tumor cells.

[0299] Furthermore, the ability to insert transgenes into the genome that act as reporter genes can aid in clinical or preclinical studies.

[0300] It is important that the expression of the transgene does not adversely affect viral replication or other beneficial properties. Therefore, the gene or genes must be inserted in a location that does not compromise the viral replication and other beneficial properties. In addition, the adenoviral genome is densely packed, making it difficult to find a suitable location for transgene insertion. This also limits the size of the transgene that can be accommodated.

[0301] OvAd1 and OvAd2 are also chimeric adenoviruses similar to enadenotucirev, which also have additional "space" in the genome (see WO 2008 / 080003). Thus, in one embodiment, the adenovirus is OvAd1 or OvAd2.

[0302] In one embodiment, the adenovirus is oncolytic. As used herein, an oncolytic adenovirus refers to an adenovirus that preferentially kills cancer cells over non-cancerous cells.

[0303] In one embodiment, the oncolytic virus is apoptotic, that is, it accelerates programmed cell death.

[0304] In one embodiment, the oncolytic virus is cytolytic. The cytolytic activity of the oncolytic adenovirus of the present disclosure can be determined in representative tumor cell lines, and the data converted to a measure of efficacy, for example, using an adenovirus belonging to subgroup C such as Ad5 as a standard (ie, efficacy of 1). A suitable method for determining cytolytic activity is the MTS assay (see Example 4 of WO2005 / 118825, Figure 2, which is incorporated herein by reference).

[0305] In one embodiment, the oncolytic virus is necrotic. That is, it causes or accelerates cell necrosis or immunogenic cell death. In one embodiment, necrotic cell death is advantageous because it triggers and induces the patient's (host) immune response.

[0306] Unless the context indicates otherwise, adenovirus as used herein refers to viruses that are capable of replication (ie, replication-competent viruses) as well as replication-defective viral vectors.

[0307] Capable of replication as used herein refers to a replicative virus or a virus whose replication is dependent on factors in cancer cells, such as up-regulating factors such as p53 or the like.

[0308] In one embodiment, the virus is replicating. Functional replication in the context of this specification refers to a virus that has all the necessary machinery to replicate in cells in vitro and in vivo, i.e., without the assistance of a packaging cell line. For example, a viral vector that is deleted in the E1 region and capable of replicating in a complementing packaging cell line is not a replicating virus in this context.

[0309] Viral vectors are replication-defective and require the packaging cells to provide a complementary gene to allow replication.

[0310] As used herein, the adenoviral genome refers to the DNA sequence encoding the structural proteins and elements associated with the function / life cycle of the adenovirus.

[0311] All human adenovirus genomes checked so far have the same general organization, that is, the gene encoding a specific function is located in the same position (referred to as structural element in this article) in the viral genome. Each end of the viral genome has a short sequence called inverted terminal repeats (or ITR), which is necessary for viral replication. The viral genome contains five early transcription units (E1A, E1B, E2, E3 and E4), three delayed early units (IX, IVa2 and E2 late) and is processed to generate a late unit (main late) of five late mRNA families (L1 to L5). The protein encoded by the early genes mainly participates in the duplication and regulation of the host cell's response to infection, and the late genes encode viral structural proteins. Early genes are prefixed with the letter E, and late genes are prefixed with the letter L.

[0312] The adenovirus genome is densely packed, meaning that non-coding sequences are nearly absent, making it difficult to find suitable locations for transgene insertion. The inventors have identified two DNA regions that tolerate transgenes. Specifically, the identified sites are suitable for accommodating complex transgenes, such as those encoding antibodies. That is, transgenes can be expressed without adversely affecting the viability of the virus, such as its oncolytic properties or its replication.

[0313] In one embodiment, an oncolytic virus or a portion of an oncolytic virus according to the present disclosure may be the result of a deletion in the E4 and / or E3 regions, such as a deletion in a portion of the E4 region or a complete deletion in the E3 region, or alternatively a deletion in a portion of the E4 region (such as E4 or f4) and a complete deletion in the E3 region, such as exemplified in the sequences disclosed herein.

[0314] In one embodiment, the oncolytic viruses of the present disclosure are chimeric. As used herein, a chimera refers to a virus that includes DNA from two or more different serotypes and has oncolytic virus properties.

[0315] In one embodiment, the oncolytic virus is EnAd or an active derivative thereof that retains the essential beneficial properties of the virus. EnAd is disclosed in WO2005 / 118825 (incorporated herein by reference) and the complete sequence of the virus is provided herein as SEQ ID NO: 38. The chimeric E2B region is disclosed herein as SEQ ID NO: 71.

[0316] Alternative oncolytic viruses include OvAd1 and OvAd2, which are disclosed in WO 2008 / 080003 as SEQ ID NO: 2 and SEQ ID NO: 3, respectively, and are incorporated herein by reference.

[0317] Advantageously, the adenoviruses of the present disclosure exhibit similar viral activities, such as replication and / or infectivity, as EnAd after infecting a variety of different colon cancer cell lines in vitro.

[0318] Structural elements of adenovirus

[0319] The present disclosure also relates to novel sequences of the viruses or viral components / constructs disclosed herein, such as plasmids.

[0320] In one embodiment, the adenovirus comprises a genome consisting of a sequence of formula (I)

[0321] 5'ITR-B1-B A -B2-B X -B B -B Y -B3-3'ITR(I)

[0322] Among them: B1 includes E1A, E1B or E1A-E1B; B A Includes E2B-L1-L2-L3-E2A-L4; B2 is a key or includes E3; B X is a bond or DNA sequence comprising a restriction site, one or more transgenes (particularly a transgene encoding at least one bispecific T cell engager according to the present disclosure, e.g., under the control of an exogenous promoter), or both; B B Including L5; B Y is a bond or includes the following DNA sequences: a restriction site, one or more transgenes (specifically, a transgene encoding at least one bispecific T cell engager according to the present disclosure, e.g., under the control of an endogenous promoter such as MPL or under the control of an exogenous promoter such as a CMV promoter), or both; B3 is a bond or includes E4; wherein B X and B Y At least one of the sequences is not a bond and includes a transgene or a restriction site or both; and encodes a multispecific antigen molecule comprising at least two binding domains, at least one of which is specific for a surface antigen on a T cell of interest. In one embodiment, the adenovirus comprises a genome consisting of a sequence of formula (I), wherein B1 B X It is a key.

[0323] In one embodiment, the adenovirus comprises a genome consisting of a sequence of formula (I), wherein: B Y It is a key.

[0324] In one embodiment, the adenovirus comprises a genome consisting of the sequence of formula (Ia):

[0325] 5'ITR-B A -B2-B X -B B -B Y -B3-3'ITR(Ia)

[0326] Among them: B A Includes E2B-L1-L2-L3-E2A-L4; B2 is a key or includes E3; B X is a bond or DNA sequence comprising a restriction site, one or more transgenes (particularly a transgene encoding at least one bispecific T cell engager according to the present disclosure, e.g., under the control of an exogenous promoter), or both; B B Including L5; B Yis a bond or includes the following DNA sequences: a restriction site, one or more transgenes (specifically, a transgene encoding at least one bispecific T cell engager according to the present disclosure, e.g., under the control of an endogenous promoter such as MPL or under the control of an exogenous promoter such as a CMV promoter), or both; B3 is a bond or includes E4; wherein B X and B Y At least one of the sequences is not a bond, and at least one comprises a transgene or a restriction site, such as a transgene.

[0327] In one embodiment, the adenovirus comprises a genome consisting of a sequence of formula (Ia), wherein B X It is a key.

[0328] In one embodiment, the adenovirus comprises a genome consisting of a sequence of formula (Ia), wherein B Y It is a key.

[0329] In one embodiment, the adenovirus comprises a genome consisting of the sequence of formula (Ib):

[0330] 5'ITR-B A -B X -B B -B Y -B3-3'ITR(Ib)

[0331] Among them: B A Including E2B-L1-L2-L3-E2A-L4; B X is a bond or DNA sequence comprising a restriction site, one or more transgenes (particularly a transgene encoding at least one bispecific T cell engager according to the present disclosure, e.g., under the control of an exogenous promoter), or both; B B Including L5; B Y is a bond or includes the following DNA sequences: a restriction site, one or more transgenes (specifically, a transgene encoding at least one bispecific T cell engager according to the present disclosure, e.g., under the control of an endogenous promoter such as MPL or under the control of an exogenous promoter such as a CMV promoter), or both; B3 is a bond or includes E4; wherein B X and B Y At least one of the is not a bond and includes a transgene or a restriction site or both, such as a transgene.

[0332] In one embodiment, the adenovirus comprises a genome consisting of a sequence of formula (Ib), wherein B X It is a key.

[0333] In one embodiment, the adenovirus comprises a genome consisting of a sequence of formula (Ib), wherein B Y It is a key.

[0334] In one embodiment, the adenovirus comprises a genome consisting of the sequence of formula (Ic):

[0335] 5'ITR-B A -B2-B X -B B -B Y -3'ITR(Ic)

[0336] Among them: B A Including E2B-L1-L2-L3-E2A-L4; B2 is E3; B X is a bond or DNA sequence comprising a restriction site, one or more transgenes (particularly a transgene encoding at least one bispecific T cell engager according to the present disclosure, e.g., under the control of an exogenous promoter), or both; B B Including L5; B Y is a DNA sequence that is or includes a restriction site, one or more transgenes (specifically, a transgene encoding at least one bispecific T cell engager according to the present disclosure, e.g., under the control of an endogenous promoter such as MPL or under the control of an exogenous promoter such as a CMV promoter), or both; wherein B X and B Y At least one of the is not a bond and includes a transgene or a restriction site or both, such as a transgene.

[0337] In one embodiment, the adenovirus comprises a genome consisting of a sequence of formula (Ic), wherein B X It is a key.

[0338] In one embodiment, the adenovirus comprises a genome consisting of a sequence of formula (Ic), wherein B Y It is a key.

[0339] In one embodiment, the adenovirus comprises a genome consisting of the sequence of formula (Id):

[0340] 5'ITR-B1-B A -B X -B B -B Y -B3-3'ITR(Id)

[0341] Among them: B1 includes E1A, E1B or E1A-E1B; B A Including E2B-L1-L2-L3-E2A-L4; B X is a bond or DNA sequence comprising a restriction site, one or more transgenes (particularly a transgene encoding at least one bispecific T cell engager according to the present disclosure, e.g., under the control of an exogenous promoter), or both; B B Including L5; BY is a bond or includes the following DNA sequences: a restriction site, one or more transgenes (specifically, a transgene encoding at least one bispecific T cell engager according to the present disclosure, e.g., under the control of an endogenous promoter such as MPL or under the control of an exogenous promoter such as a CMV promoter), or both; B3 is a bond or includes E4; wherein B X and B Y At least one of the sequences is not a bond and includes a transgene, a restriction site, or both.

[0342] In one embodiment, the adenovirus comprises a genome consisting of a sequence of formula (Id), wherein B X It is a key.

[0343] In one embodiment, the adenovirus comprises a genome consisting of a sequence of formula (Id), wherein B Y It is a key.

[0344] In one embodiment, the adenovirus comprises a genome consisting of the sequence of formula (Ie):

[0345] 5'ITR-B1-B A -B2-B B -B Y -3'ITR(Ie)

[0346] Among them: B1 includes E1A, E1B or E1A-E1B; B A Includes E2B-L1-L2-L3-E2A-L4; B2 includes E3; B B Including L5; B Y is a DNA sequence that is keyed to or includes the following: one or more transgenes according to the present disclosure encode at least one bispecific T cell engager (e.g., under the control of an endogenous promoter such as MPL or under the control of an exogenous promoter such as a CMV promoter); wherein B X and B Y At least one of the sequences is not a bond and includes a transgene, a restriction site, or both.

[0347] In one embodiment, a compound of Formula (I), (Ia), (Ib), (Ic), (Id), or (Ie) is provided, wherein B X and B Y is not a bond and includes a transgenic restriction site or both, such as B X and B Y All are genetically modified.

[0348] In one embodiment of Formula (I), (Ia), (Ib), (Ic) or (Id), only B XEncodes one or two bispecific T cell engagers, e.g., one bispecific T cell engager (and B Y does not encode a bispecific T cell engager), specifically one or more bispecific T cell engagers are under the control of an exogenous promoter such as a CMV promoter. In one embodiment of Formula (I), (Ia), (Ib), (Ic) or (Id), only B Y Encodes one or two bispecific T cell engagers, e.g., one bispecific T cell engager (and B X does not encode a bispecific T cell engager), specifically one or more bispecific T cell engagers are under the control of an endogenous promoter such as MPL or an exogenous promoter such as CMV promoter. In one embodiment of formula (I), (Ia), (Ib), (Ic) or (Id), B X encodes a bispecific T cell engager (e.g., under the control of an exogenous promoter such as a CMV promoter) and B Y Encodes a bispecific T cell engager (e.g., under the control of an endogenous promoter such as MPL or under the control of an exogenous promoter such as the CMV promoter).

[0349] A bond refers to a covalent bond that joins one DNA sequence to another DNA sequence, for example, one segment of a viral genome to another. Thus, when a variable in Formula (I), (Ia), (Ib), (Ic), (Id), or (Ie) herein represents a bond, the feature or element represented by the bond is absent, i.e., missing.

[0350] Because adenovirus structures are generally similar, the elements discussed below are based on structural elements and reference to common terms, which are known to those skilled in the art. When referring to an element in this article, we are referring to the DNA sequence encoding the element or the DNA sequence encoding the same structural protein of the element in adenovirus. The latter is relevant because of the redundancy of the DNA code. It may be necessary to consider the virus's preference for codon usage to achieve optimal results.

[0351] Any structural element from the adenovirus employed in the viruses of the present disclosure may include or consist of a native sequence, or may have at least 95% similarity over a given length, such as 96%, 97%, 98%, 99%, or 100%. The original sequence may be modified to omit 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the genetic material. The skilled artisan will appreciate that when making changes, the viral reading frame must not be disrupted in order to disrupt expression of the structural proteins.

[0352] In one embodiment, a given element is a full-length sequence, ie, a full-length gene.

[0353] In one embodiment, a given element is less than the full length and retains the same or corresponding function as the full length sequence.

[0354] In one embodiment, for a given element optionally in the constructs of the present disclosure, the DNA sequence may be less than full length and non-functional.

[0355] The structural genes encoding the structural or functional proteins of adenoviruses are typically linked by non-coding regions of DNA. Thus, in order to insert a transgene into the viruses of the present disclosure, there is some flexibility in where to "cut" the genomic sequence of the structural element of interest (particularly its non-coding region). Thus, for the purposes of this specification, the elements will be considered to be reference structural elements to the extent that they are appropriate for the purpose and do not encode foreign material. Thus, if appropriate, the genes will be associated with appropriate non-coding regions, such as those found in the native structure of the virus.

[0356] Thus, in one embodiment, the insert (e.g., DNA encoding restriction sites and / or transgenes) is inserted into a non-coding region of the genomic viral DNA, such as an intron or intergenic sequence. As already mentioned, some non-coding regions of adenovirus may have functions, such as in alternative splicing, transcriptional regulation, or translational regulation, and this may need to be taken into account.

[0357] The sites identified herein associated with the L5 region (e.g., between the L5 and E4 regions) are suitable for accommodating various DNA sequences encoding complex entities, such as RNAi, cytokines, single-chain or multimeric proteins, such as antibodies, such as bispecific T cell engagers.

[0358] As used herein, gene refers to coding and any non-coding sequences associated therewith, such as introns and associated exons. In one embodiment, a gene includes or consists only of essential structural components, such as coding regions.

[0359] Following is a discussion of specific structural elements of adenoviruses.

[0360] The inverted terminal repeat (ITR) sequences are common to all known adenoviruses and are so named due to their symmetry and serve as the origin of viral chromosomal replication.Another property of these sequences is their ability to form hairpins.

[0361] As used herein, a 5' ITR refers to a portion or all of the ITR from the 5' end of an adenovirus that retains ITR function when incorporated into an adenovirus at the appropriate location. In one embodiment, the 5' ITR comprises or consists of a sequence from about 1 bp to 138 bp of SEQ ID No: 38, or a sequence that is 90%, 95%, 96%, 97%, 98%, or 99% identical along the entire length, and more particularly, consists of a sequence from about 1 bp to 138 bp of SEQ ID No: 38.

[0362] As used herein, a 3' ITR refers to part or all of the ITR at the 3' end of an adenovirus that retains ITR function when incorporated into an adenovirus at the appropriate location. In one embodiment, the 3' ITR comprises or consists of a sequence from about 32189 bp to 32326 bp of SEQ ID No: 38, or a sequence that is 90%, 95%, 96%, 97%, 98%, or 99% identical along the entire length, specifically consisting of a sequence from about 32189 bp to 32326 bp of SEQ ID No: 38.

[0363] As used herein, B1 refers to a DNA sequence encoding: part or all of the E1A region of an adenovirus, part or all of the E1B region of an adenovirus, and independently part or all of the E1A region and E1B region of an adenovirus.

[0364] When B1 is a bond, then the E1A and E1B sequences will be omitted from the virus. In one embodiment, B1 is a bond, and thus the virus is a vector.

[0365] In one embodiment, B1 further comprises a transgene. It is known in the art that the E1 region can accommodate a transgene, which can be disruptively inserted into the E1 region (i.e., in the "middle" of the sequence) or part or all of the E1 region can be deleted to provide more space to accommodate genetic material.

[0366] As used herein, E1A refers to a DNA sequence encoding part or all of the adenoviral E1A region. The latter is referred to herein as the polypeptide / protein E1A. It can be mutated such that the protein encoded by the E1A gene has conservative or non-conservative amino acid changes, such that it has: the same function as the wild-type protein (i.e., the corresponding non-mutated protein); increased function compared to the wild-type protein; decreased function, such as no function compared to the wild-type protein; or a new function compared to the wild-type protein, or appropriate combinations thereof.

[0367] As used herein, E1B refers to a DNA sequence encoding part or all of the adenovirus E1B region (i.e., a polypeptide or protein), which can be mutated so that the protein encoded by the E1B gene / region has conservative or non-conservative amino acid changes, so that it has: the same function as the wild-type (i.e., the corresponding non-mutated protein); increased function compared to the wild-type protein; decreased function, such as no function compared to the wild-type protein; or a new function compared to the wild-type protein or an appropriate combination thereof.

[0368] Thus, B1 may be modified or unmodified relative to a wild-type E1 region, such as wild-type E1A and / or E1B. A skilled person can easily identify whether E1A and / or E1B is present or (partially) missing or mutated.

[0369] As used herein, wild type refers to a known adenovirus. A known adenovirus is an adenovirus that has been identified and named, regardless of whether the sequence is available.

[0370] In one embodiment, B1 has a sequence of 139 bp to 3932 bp of SEQ ID No:38.

[0371] As used in this paper, B A Refers to the DNA sequence encoding the E2B-L1-L2-L3-E2A-L4 region, including any non-coding sequences, as appropriate. Typically, this sequence will not include a transgene. In one embodiment, the sequence is substantially similar or identical to a contiguous sequence from a known adenovirus, such as a serotype shown in Table 1, specifically a Group B virus, such as Ad3, Ad7, Ad11, Ad14, Ad16, Ad21, Ad34, Ad35, Ad51, or a combination thereof, such as Ad3, Ad11, or a combination thereof. In one embodiment, E2B-L1-L2-L3-E2A-L4 refers to a region comprising these elements and other structural elements associated with the region, such as B. A It will typically contain a sequence encoding protein IV2a, for example as follows: IV2A IV2a-E2B-L1-L2-L3-E2A-L4

[0372] In one embodiment, the E2B region is chimeric. That is, it includes DNA sequences from two or more different adenovirus serotypes, such as Ad3 and Ad11, such as Ad11p. In one embodiment, the E2B region comprises the sequence from 5068 bp to 10355 bp of SEQ ID NO: 38, or a sequence that is 95%, 96%, 97%, 98%, or 99% identical thereto, over its entire length.

[0373] In one embodiment, component B AE2B in comprises the sequence shown in SEQ ID NO: 71 (which corresponds to SEQ ID NO: 3 disclosed in WO2005 / 118825).

[0374] In one embodiment, B A The sequence has a length from 3933 bp to 27184 bp of SEQ ID No: 38.

[0375] As used herein, E3 refers to a DNA sequence encoding part or all of the adenovirus E3 region (i.e., protein / polypeptide), which can be mutated so that the protein encoded by the E3 gene has conservative or non-conservative amino acid changes, such that it has the same function as the wild-type (corresponding unmutated protein); has increased function compared to the wild-type protein; has decreased function, such as having no function compared to the wild-type protein, or has a new function compared to the wild-type protein, or a combination thereof, as the case may be.

[0376] In one embodiment, the E3 region forms an adenovirus serotype or a combination thereof given in Table 1, in particular a group B serotype, such as Ad3, Ad7, Ad11 (in particular Ad11p), Ad14, Ad16, Ad21, Ad34, Ad35, Ad51 or a combination thereof, such as Ad3, Ad11 (in particular Ad11p) or a combination thereof.

[0377] In one embodiment, the E3 region is partially deleted, for example, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% deleted.

[0378] In one embodiment, B2 is a bond, wherein DNA encoding the E3 region is not present.

[0379] In one embodiment, the DNA encoding the E3 region may be replaced or interrupted by a transgene. As used herein, replacing the E3 region with a transgene as used herein includes replacing part or all of the E3 region with a transgene.

[0380] In one embodiment, region B2 includes the sequence from 27185 bp to 28165 bp of SEQ ID NO:38.

[0381] In one embodiment, B2 consists of the sequence from 27185 bp to 28165 bp of SEQ ID NO:38.

[0382] As used in this paper, B X Refers to B BThe DNA sequence near the 5' end of the L5 gene in B. As used herein, near or proximal to the 5' end of the L5 gene refers to: a non-coding region adjacent to (adjacent to) the 5' end of the L5 gene or inherently associated with it, i.e., a non-coding region that is immediately adjacent to or adjacent to the 5' major end of the L5 gene or inherently associated with it. Alternatively, near or proximal may refer to a closed L5 gene such that in B X There is no coding sequence between the 5' end of the L5 gene and the 5' end of the L5 gene.

[0383] Therefore, in one embodiment, B X Directly linked to the base of L5, it represents the start of the coding sequence of, for example, the L5 gene.

[0384] Therefore, in one embodiment, B X A base directly linked to L5, which represents, for example, the start of a non-coding sequence, or directly linked to a non-coding region naturally associated with L5. As used herein, a non-coding region naturally associated with L5 refers to a portion of all non-coding regions that are part of the L5 gene or are adjacent to it but not part of another gene.

[0385] In one embodiment, B X A sequence comprising SEQ ID NO: 39. This sequence is an artificial non-coding sequence into which a DNA sequence, such as a transgene (or transgene cassette), a restriction site, or a combination thereof, can be inserted. This sequence is advantageous because it acts as a buffer, allowing for some flexibility in the exact location of the transgene while minimizing disruptive effects on viral stability and viability.

[0386] One or more insertions may be present in SEQ ID NO: 39 from the 5' end, the 3' end, or between bp 1 and bp 20 / 21, 21 / 22, 22 / 23, 23 / 24, 24 / 25, 25 / 26, 26 / 27, 27 / 28, 28 / 29, 29 / 30, 30 / 31, 31 / 32, 32 / 33, 33 / 34, 34 / 35, 35 / 36, 36 / 37, 37 / 38, 38 / 39, 39 / 40, 40 / 41, 41 / 42, 42 / 43, 43 / 44, 44 / 45, 45 / 46, 47 / 48, 48 / 49, 50 / 51, 51 / 52, 52 / 53, 53 / 54, 54 / 55, 55 / 56, 56 / 57, 57 / 58, 58 / 59, 59 / 60, 60 / 61, 61 / 62, 62 / 63, 64 / 64, 65 / 65 41, 41 / 42, 42 / 43, 43 / 44, 44 / 45, 45 / 46, 46 / 47, 47 / 48, 48 / 49, 49 / 50, 50 / 51, 51 / 52, 52 / 53, 53 / 54, 54 / 55, 55 / 56, 56 / 57, 57 / 58, 58 / 59, 59 / 60, 60 / 61, 61 / 62, 62 / 63, 63 / 64, 64 / 65, 65 / 66, 66 / 67, 67 / 68, 68 / 69, 69 / 70, 70 / 71, 71 / 72, 72 / 73, 73 / 74, 74 / 75, 75 / 76, 76 / 77, 77 / 78, 78 / 79, 79 / 80, 80 / 81、81 / 82、82 / 83、83 / 84、84 / 85、85 / 86、86 / 87、87 / 88、88 / 89、89 / 90、90 / 91、91 / 92、92 / 93、93 / 94、94 / 95、95 / 96、96 / 97、97 / 98、98 / 99、99 / 100、100 / 101、101 / 102、102 / 103、103 / 104、104 / 105、105 / 106、106 / 107、107 / 108、108 / 109、109 / 110、110 / 111、111 / 112、112 / 113、113 / 114、114 / 115、 115 / 116、116 / 117、117 / 118、118 / 119、119 / 120、120 / 121、121 / 122、122 / 123、123 / 124、124 / 125、125 / 126、126 / 127、127 / 128、128 / 129、129 / 130、130 / 131、131 / 132、132 / 133、133 / 134、134 / 135、135 / 136、136 / 137、137 / 138、138 / 139、139 / 140、140 / 141、141 / 142、142 / 143、143 / 144、144 / 145、145 / 146、146 / 147、147 / 148、148 / 149、150 / 151、151 / 152、152 / 153、153 / 154、154 / 155、155 / 156、156 / 157、157 / 158、158 / 159、159 / 160、160 / 161、161 / 162、162 / 163、163 / 164、164 / 165、165 / 166、166 / 167、167 / 168、168 / 169、169 / 170、170 / 171、171 / 172、172 / 173、1 Between 73 / 174, 174 / 175, 175 / 176, 176 / 177, 177 / 178, 178 / 179, 179 / 180, 180 / 181, 181 / 182, 182 / 183, 183 / 184, 184 / 185, 185 / 186, 186 / 187, 187 / 188, 189 / 190, 190 / 191, 191 / 192, 192 / 193, 193 / 194, 194 / 195, 195 / 196, 196 / 197, 197 / 198, 198 / 199, 199 / 200 or 200 / 201.

[0387] In one embodiment, B X Included are SEQ ID NO: 39, wherein the DNA sequence is inserted between bp 27 and bp 28 or at a position corresponding to positions 28192 bp and 28193 bp of SEQ ID NO: 38.

[0388] In one embodiment, the insert is a restriction site insert. In one embodiment, the restriction site insert includes one or two restriction sites. In one embodiment, the restriction site is a 19bp restriction site insert including 2 restriction sites. In one embodiment, the restriction site insert is a 9bp restriction site insert including 1 restriction site. In one embodiment, the restriction site insert includes one or two restriction sites and at least one transgene, such as one or two transgenes. In one embodiment, the restriction site is a 19bp restriction site insert including 2 restriction sites and at least one transgene, such as one or two transgenes. In one embodiment, the restriction site is a 9bp restriction site insert including 1 restriction site and at least one transgene, such as one, two or three transgenes, such as one or two. In one embodiment, two restriction sites are sandwiched between one or more, such as two transgenes (e.g., in a transgenic cassette). In one embodiment, when B X When two restriction sites are included, the restriction sites are different from each other. In one embodiment, B XThe one or more restriction sites in B are non-naturally occurring in the particular adenoviral genome into which they have been inserted. X The one or more restriction sites in the adenoviral vector are different from other restriction sites located elsewhere in the adenoviral genome, for example, from naturally occurring restriction sites and / or restriction sites introduced into other parts of the genome, such as those introduced into B Y Thus, in one embodiment, one or more restriction sites allow for specific cleavage of the DNA in the segment.

[0389] Advantageously, the use of "unique" restriction sites can provide selectivity and control over the location of cleavage in the viral genome simply by using the appropriate restriction enzymes.

[0390] Specifically, as used herein, cleavage refers to cleaving the virus only at the desired position (usually one position), although occasionally it can be a pair of positions, using an enzyme specific for a restriction site. As used herein, a pair of positions refers to two restriction sites that are close to each other and are designed to be cleaved by the same enzyme (i.e., cannot be distinguished from each other).

[0391] In one embodiment, the restriction site insert is SEQ ID NO:50.

[0392] In one embodiment, B X The sequence has 28166 bp to 28366 bp of SEQ ID No: 38.

[0393] In one embodiment, B X It is a key.

[0394] In one embodiment, B X Includes restriction sites, such as 1, 2, 3 or 4 restriction sites, such as 1 or 2. In one embodiment, B X In one embodiment, B X The invention relates to a gene encoding a transgene comprising at least one transgene, for example one or two transgenes, and one or more restriction sites, for example two or three restriction sites, in particular wherein the restriction sites are interspersed with a gene or a DNA sequence comprising a gene to allow it / them to be specifically excised and / or replaced from the genome. Alternatively, the restriction sites may be interspersed with each gene, for example when two transgenes are present, three different restriction sites may be required to ensure that the genes can be selectively excised and / or replaced. In one embodiment, one or more, for example all, transgenes are in the form of a transgene cassette. In one embodiment, B XIn one embodiment, SEQ ID NO: 39 is interrupted, for example, by a transgene. In one embodiment, SEQ ID NO: 39 is uninterrupted. In one embodiment, B X In one embodiment, B X In one embodiment, B x comprising or consisting of one or more transgenes.

[0395] In one embodiment, B Y Includes restriction sites, such as 1, 2, 3 or 4 restriction sites, such as 1 or 2. In one embodiment, B Y In one embodiment, B Y The invention relates to a gene encoding a transgene comprising at least one transgene, for example one or two transgenes, and one or more restriction sites, for example two or three restriction sites, in particular wherein the restriction sites are interspersed with a gene or a DNA sequence comprising a gene to allow it / them to be specifically excised and / or replaced from the genome. Alternatively, the restriction sites may be interspersed with each gene, for example when two transgenes are present, three different restriction sites may be required to ensure that the genes can be selectively excised and / or replaced. In one embodiment, one or more, for example all, transgenes are in the form of a transgene cassette. In one embodiment, B Y In one embodiment, SEQ ID NO: 40 is interrupted, for example, by a transgene. In one embodiment, SEQ ID NO: 40 is uninterrupted. In one embodiment, B Y In one embodiment, B Y In one embodiment, B Y comprising or consisting of one or more transgenes.

[0396] In one embodiment, B X and B Y Each includes a restriction site, for example 1, 2, 3 or 4 restriction sites, such as 1 or 2. In one embodiment, B X and B Y Each comprises at least one transgene, such as 1 or 2 transgenes. In one embodiment, B X and B YEach comprises at least one transgene, for example one or two transgenes, and one or more restriction sites, for example two or three restriction sites, in particular wherein the restriction sites sandwich a gene or a DNA sequence comprising a gene to allow it to be specifically excised and / or replaced from the genome. Alternatively, the restriction sites may sandwich each gene, for example when two transgenes are present, three different restriction sites are required to ensure that genes can be selectively excised and / or replaced. In one embodiment, one or more, for example all, transgenes are in the form of a transgene cassette. In one embodiment, B X and B Y In one embodiment, B X and B Y In one embodiment, B X is a key and B Y In one embodiment, B Y is a key and B X Not a key.

[0397] As used in this paper, B B "Refers to the DNA sequence encoding the L5 region. As used herein, the L5 region refers to the DNA sequence containing the gene encoding the fiber polypeptide / protein, as appropriate in the context. The fiber gene / region encodes the fiber protein, which is the major capsid component of adenoviruses. Fiber plays a role in receptor recognition and contributes to the ability of adenoviruses to selectively bind to and infect cells."

[0398] In the viruses of the present disclosure, the fibers can be from any serotype 11 adenovirus strain, such as Ad11p.

[0399] In one embodiment, B B The sequence has a length from 28367 bp to 29344 bp of SEQ ID No: 38.

[0400] As used in this paper, B Y The related DNA sequence is B B The DNA sequence near the 3' end of the L5 gene of the present invention. As used herein, near or proximal to the 3' end of the L5 gene refers to: the non-coding region adjacent to (adjacent to) the 3' end of the L5 gene or inherently associated with it, i.e., the non-coding region that is close to or adjacent to the 3' major end of the L5 gene or inherently associated with it (i.e., all or part of the non-coding sequence endogenous to L5). Alternatively, near or proximal can refer to the closed L5 gene, such that in B Y There is no coding sequence between the L5 region and the 3' end of the L5 gene.

[0401] Therefore, in one embodiment, BY The base directly connected to L5 represents the "end" of the coding sequence.

[0402] Therefore, in one embodiment, B Y Directly linked to the base of L5, which represents the "end" of the non-coding sequence, or directly linked to the non-coding region naturally associated with L5.

[0403] Inherently and naturally are used interchangeably herein. In one embodiment, B Y A sequence comprising SEQ ID NO: 40. This sequence is a non-coding sequence into which a DNA sequence, such as a transgene (or transgene cassette), a restriction site, or a combination thereof, can be inserted. This sequence is advantageous because it acts as a buffer, allowing for some flexibility in the exact location of the transgene while minimizing disruptive effects on viral stability and viability.

[0404] One or more insertions may occur in SEQ ID NO:40 from the 5' end, the 3' end, or at any point between bp 1 and bp 35, for example, between base pairs 1 / 2, 2 / 3, 3 / 4, 4 / 5, 5 / 6, 6 / 7, 7 / 8, 8 / 9, 9 / 10, 10 / 11, 11 / 12, 12 / 13, 13 / 14, 14 / 15, 15 / 16, 16 / 17, 17 / 18, 18 / 19, 19 / 20, 20 / 21, 21 / 22, 22 / 23, 23 / 24, 24 / 25, 25 / 26, 26 / 27, 27 / 28, 28 / 29, 29 / 30, 30 / 31, 31 / 32, 32 / 33, 33 / 34, or 34 / 35.

[0405] In one embodiment, B YIncluding SEQ ID NO: 40, wherein the DNA sequence is inserted between positions bp 12 and bp 13, or at positions corresponding to 29356 bp and 29357 bp in SEQ ID NO: 38. In one embodiment, the insert is a restriction site insert. In one embodiment, the restriction site insert comprises one or two restriction sites. In one embodiment, the restriction site is a 19 bp restriction site insert comprising two restriction sites. In one embodiment, the restriction site insert is a 9 bp restriction site insert comprising one restriction site. In one embodiment, the restriction site insert comprises one or two restriction sites and at least one transgene, such as one or two or three transgenes, such as one or two transgenes. In one embodiment, the restriction site is a 19 bp restriction site insert comprising two restriction sites and at least one transgene, such as one or two transgenes. In one embodiment, the restriction site insert is a 9 bp restriction site insert comprising one restriction site and at least one transgene, such as one or two transgenes. In one embodiment, two restriction sites are sandwiched between one or more, such as two transgenes (e.g., in a transgene cassette). In one embodiment, when B Y When two restriction sites are included, the restriction sites are different from each other. In one embodiment, B Y The one or more restriction sites in B are non-naturally occurring (e.g., rare) in the particular adenoviral genome into which they have been inserted. In one embodiment, B Y The one or more restriction sites in the adenoviral vector are different from other restriction sites located elsewhere in the adenoviral genome, for example, from naturally occurring restriction sites or restriction sites introduced into other parts of the genome, such as B X Thus, in one embodiment, one or more restriction sites allow for specific cleavage of the DNA in the segment.

[0406] In one embodiment, the restriction site insert is SEQ ID NO:51.

[0407] In one embodiment, B Y The sequence has the range from 29345 bp to 29379 bp of SEQ ID No: 38.

[0408] In one embodiment, B Y It is a key.

[0409] In one embodiment, the insert is after bp 12 in SEQ ID No:40.

[0410] In one embodiment, the insert is located at position approximately 29356 bp of SEQ ID NO:38.

[0411] In one embodiment, the insert is a transgene cassette comprising one or more transgenes, eg, 1, 2, or 3, such as 1 or 2.

[0412] As used herein, E4 refers to a DNA sequence encoding part or all of the adenovirus E4 region (i.e., polypeptide / protein region), which can be mutated so that the protein encoded by the E4 gene has conservative or non-conservative amino acid changes and has the same function as the wild-type protein (corresponding non-mutated protein); has increased function compared to the wild-type protein; has decreased function, such as having no function compared to the wild-type protein or having a new function compared to the wild-type protein or a combination thereof, as appropriate. In one embodiment, the E4 region is deleted from E4 or f4.

[0413] In one embodiment, the E4 region is partially deleted, for example, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or 5% deleted. In one embodiment, the E4 region has a sequence of 32188 bp to 29380 bp of SEQ ID NO: 38.

[0414] In one embodiment, B3 is a bond, ie, wherein E4 is not present.

[0415] In one embodiment, B3 has a sequence consisting of 32188 bp to 29380 bp of SEQ ID NO:38.

[0416] As used herein, numerical ranges are inclusive.

[0417] The skilled artisan will appreciate that the elements of the formulae herein, such as formulas (I), (Ia), (Ib), (Ic), (Id), and (Ie), are contiguous and may comprise non-coding DNA sequences as well as the genes and coding DNA sequences (structural features) mentioned herein. In one or more embodiments, the formulae disclosed herein are intended to describe naturally occurring sequences in the adenovirus genome. In this context, the skilled artisan will appreciate that the formulations are intended to characterize the major elements of the relevant segments of the genome and are not intended to be an exhaustive description of genomic stretches of DNA.

[0418] As used herein, E1A, E1B, E3 and E4 each independently refer to wild-type and equivalents thereof, such as mutant or partially deleted forms of each region as described herein, particularly wild-type sequences from known adenoviruses.

[0419] As used herein, "insertion" refers to a DNA sequence incorporated at the 5' end, 3' end, or within a given DNA sequence reference segment, interrupting the reference sequence. The latter is the reference sequence used as a reference point relative to the location of the insert. In the context of this disclosure, an insert typically appears in SEQ ID NO: 10 or SEQ ID NO: 11. The insert can be a restriction site insertion, a transgene cassette, or both. When a sequence is interrupted, the virus will still include the original sequence, but typically it will sandwich two segments within the insert.

[0420] In one embodiment, the transgene or transgene cassette does not include a non-biased insertion transposon, such as the TN7 transposon or a portion thereof. As used herein, the Tn7 transposon refers to a non-biased insertion transposon as described in WO2008 / 080003.

[0421] In one embodiment, one or more restriction sites in BX and BY are independently selected from restriction sites specific for the enzymes described herein, such as NotI, FseI, AsiSI, SgfI and SbfI, and in particular the inserted restriction sites are all different, such as the NotI specific site and the FseI specific site in BX and the SgfI and SbfI in BY.

[0422] As discussed above in one embodiment, region B X and / or B Y No restriction sites are included. Advantageously, the viruses and constructs of the present disclosure can be prepared without restriction sites, for example, using synthetic techniques. These techniques provide great flexibility in creating viruses and constructs. Furthermore, the inventors have determined that when viruses and constructs are prepared by synthetic techniques, their properties are not degraded.

[0423] promoter

[0424] As used herein, a promoter refers to a DNA region that initiates the transcription of one or more specific genes. A promoter is typically located at the proximal end of a gene that is transcribed on the same chain and upstream (i.e., 5') of the DNA. As used in this context, the proximal end means sufficiently close to function as a promoter. In one embodiment, the promoter is within 100bp of the transcription start site. Therefore, as used herein, an endogenous promoter refers to a promoter that occurs naturally (i.e., naturally occurring) in an adenovirus (or construct) that is inserted into a transgenic gene. In one or more embodiments, the endogenous promoter employed is a promoter that occurs naturally in the virus of its original position in the viral genome, specifically the main or unique promoter employed in one or more transgenic expressions. In one embodiment, the endogenous promoter used to promote translation and optionally transgenic transcription is a resident promoter, i.e., an endogenous promoter that is integrated into the adenovirus genome and not previously introduced by recombinant technology.

[0425] As used herein, under the control of an endogenous promoter means that the transgene / transgene cassette is inserted in the proper orientation to be under the control of the endogenous promoter. That is, the cassette is inserted when the promoter is typically on the antisense strand, e.g., in the antisense orientation.

[0426] That being said, a gene can be expressed in either orientation. However, for a given (specific) transgene, one orientation generally provides higher expression levels than the other.

[0427] In one embodiment, the cassette is in the sense orientation. That is, it is transcribed in a 5' to 3' direction. In one embodiment, the cassette is in the antisense orientation. That is, it is transcribed in a 3' to 5' direction.

[0428] For example, endogenous promoters in viruses can be utilized by employing genes encoding a transgene and a splice acceptor sequence. Thus, in one embodiment, when under the control of an endogenous promoter, the cassette will include a splice acceptor sequence. Thus, in one embodiment, a coding sequence, such as a sequence encoding an antibody or antibody binding fragment, further includes a splice acceptor sequence.

[0429] In one embodiment, one or more transgenes, or transgene cassettes, are under the control of an E4 promoter or a major late promoter, such as the major late promoter (ML promoter).

[0430] As used herein, controlled means that the transgene is activated, ie, transcribed, when directed by a particular promoter.

[0431] As used herein, the major late promoter (ML promoter or MLP) refers to an adenovirus promoter that controls the expression of "late-expressed" genes, such as the L5 gene. The MLP is a "sense strand" promoter. That is, the promoter affects genes downstream of the promoter in a 5' to 3' direction. As used herein, the major late promoter refers to the original major late promoter located in the viral genome.

[0432] As used herein, the E4 promoter refers to the adenovirus promoter in the E4 region. The E4 region is an antisense region; therefore, the promoter is an antisense promoter. That is, the promoter is located upstream of the E4 region in the 3' to 5' direction. Therefore, any transgenic cassette controlled by the E4 promoter may need to be oriented appropriately. In one embodiment, the cassette controlled by the E4 promoter is in the antisense orientation. In one embodiment, the cassette is controlled by the E4 promoter in the sense orientation. As used herein, the E4 promoter refers to the original E4 promoter located in the viral genome.

[0433] Therefore, in one embodiment, a replicative oncolytic adenovirus serotype 11 (such as Ad11p) or a viral derivative thereof is provided, wherein the fiber, hexon and capsid are serotype 11 (such as Ad11p), wherein the viral genome comprises a DNA sequence encoding a therapeutic antibody or antibody binding fragment (such as a bispecific T cell engager), wherein the DNA sequence is controlled by an endogenous promoter of the adenovirus, selected from E4 and a major late promoter (i.e., an E4 promoter or a major late promoter), such that the transgene does not interfere with viral replication, for example, associated with the L5 region (i.e., before or after the region), such as located after L5 in the viral genome, specifically between the L5 region and the E4 region.

[0434] In one embodiment, an endogenous promoter is introduced into the viral genome at a desired location by recombinant techniques, for example into a transgene cassette. However, in the context of this specification, this arrangement is generally referred to as an exogenous promoter.

[0435] In one embodiment, the transgenic cassette includes an exogenous promoter. As used herein, an exogenous promoter refers to a promoter that does not naturally occur in the adenovirus into which the transgene is inserted. Typically, exogenous promoters are derived from other viruses or mammalian promoters. As used herein, an exogenous promoter refers to a DNA element typically located upstream of a gene of interest that regulates transcription of the gene.

[0436] In one embodiment, the regulator of gene expression is an exogenous promoter, such as CMV (cytomegalovirus promoter), CBA (chicken beta-actin promoter) or PGK (phosphoglycerate kinase 1 promoter), such as the CMV promoter.

[0437] In one embodiment, the CMV exogenous promoter employed has the nucleotide sequence of SEQ ID NO: 52. In one embodiment, the PGK exogenous promoter employed has the nucleotide sequence of SEQ ID NO: 53. In one embodiment, the CBA exogenous promoter employed has the nucleotide sequence of SEQ ID NO: 54.

[0438] In one embodiment, a replicating oncolytic adenovirus serotype 11 (such as Ad11p) or a viral derivative thereof is provided, wherein the fiber, hexon and capsid are serotype 11 (such as Ad11p), wherein the viral genome includes a DNA sequence encoding a therapeutic antibody or antibody binding fragment (such as a bispecific T cell engager according to the present disclosure), which is located in a portion of the viral genome that is expressed late in the viral replication cycle and that does not interfere with viral replication, wherein the DNA sequence is controlled by a promoter exogenous to the adenovirus (e.g., a CMV promoter). In one embodiment, the DNA sequence encoding the antibody or fragment (such as a bispecific T cell engager according to the present disclosure) is associated with the L5 region, as described elsewhere herein, specifically between the L5 region and the E4 region.

[0439] In one embodiment, the exogenous promoter is an antigen presenting cell promoter. As used herein, an antigen presenting cell promoter refers to a promoter of a gene that is selectively expressed by antigen presenting cells, such as dendritic cells or macrophages. These genes include, but are not limited to, FLT-3, FLT-3 ligand, TLRs, CD1a, CD1c, CD11b, CD11c, CD80, CD83, CD86, CD123, CD172a, CD205, CD207, CD209, CD273, CD281, CD283, CD286, CD289, CD287, CXCR4, GITR ligand, IFN-α2, IL-12, IL-23, ILT1, ILT2, ILT3, ILT4, ILT5, ILT7, TSLP receptor, CD141, CD303, CADM1, CLEC9a, XCR1, or CD304; antigen processing and presentation mediators such as CTIIA or GILT. Thus, in one embodiment, the exogenous promoter is suitable for selectively expressing the transgene in the antigen-presenting cells.

[0440] Other regulatory sequences

[0441] As used herein, "gene expression regulator" (or regulatory / regulatory element) refers to a genetic feature such as a promoter, enhancer or splice acceptor sequence that plays a role in gene expression, typically by initiating or enhancing transcription or translation.

[0442] As used herein, "splice acceptor sequence," "splice acceptor," or "splice site" refers to a regulatory sequence that determines when an mRNA molecule will be recognized by the small nuclear ribonucleoproteins of the spliceosomal complex. Once assembled, the spliceosome catalyzes splicing between the splice acceptor site and the upstream splice donor site of the mRNA molecule, thereby producing a mature mRNA molecule that can be translated to produce a single polypeptide or protein.

[0443] Different sized splice acceptor sequences may be employed in the present invention, and these may be described as short splice acceptor (small), splice acceptor (medium) and branched splice acceptor (large).

[0444] As used herein, SSA refers to a short splice acceptor, typically including only a splice site, e.g., 4 base pairs. As used herein, SA refers to a splice acceptor, typically including a short splice acceptor and a polypyrimidine tract, e.g., 16 bp. As used herein, bSA refers to a branched splice acceptor, typically including a short splice acceptor, a polypyrimidine tract, and a branch point, e.g., 26 base pairs.

[0445] In one embodiment, the splice acceptor employed in the constructs of the present disclosure is shown in SEQ ID NO: 55 to SEQ ID NO: 57. In one embodiment, SSA has the nucleotide sequence of SEQ ID NO: 55. In one embodiment, SA has the nucleotide sequence of SEQ ID NO: 56. In one embodiment, bSA has the nucleotide sequence of SEQ ID NO: 57. In one embodiment, the splice acceptor sequences are independently selected from the group consisting of TGCTAATCTT CCTTTCTCTCTTCAGG (SEQ ID NO: 57), CCTTTCTCTCTT CAGG (SEQ ID NO: 56), and CAGG (SEQ ID NO: 55).

[0446] In one embodiment, the splice site is immediately preceded by a consensus Kozak sequence comprising CCACC (i.e., proceeding in the 5' to 3' direction). In one embodiment, the splice site and the Kozak sequence are interspersed with up to 100 base pairs or less. In one embodiment, the Kozak sequence has the nucleotide sequence of SEQ ID NO: 58.

[0447] Typically, when under the control of an endogenous or exogenous promoter (e.g., an endogenous promoter), the coding sequence will be immediately preceded by a Kozak sequence. The start of the coding region is indicated by the start codon (AUG), for example, in the context of the sequence (gcc)gccRccAUGg [SEQ ID NO: 59], the start of the coding sequence is indicated by the bases in bold. Lowercase letters indicate the common base at this position (although it can vary) and uppercase letters indicate highly conserved bases, i.e., the "AUGG" sequence is constant or rarely, if ever, varies; "R" indicates that a purine (adenine or guanine) is usually observed at this position, and the sequence in brackets (gcc) has an uncertain meaning. Thus, in one embodiment, the start codon AUG is incorporated into the Kozak sequence.

[0448] As used herein, an internal ribosome entry DNA sequence refers to a DNA sequence encoding an internal ribosome entry sequence (IRES). As used herein, an IRES refers to a nucleotide sequence that allows the initiation of translation of a messenger RNA (mRNA) sequence, including the start of initiation within the mRNA sequence. This is particularly useful when the cassette encodes a polycistronic mRNA. An IRES is used to produce a polycistronic mRNA that is translated into multiple individual proteins or peptides. In one embodiment, the internal ribosome entry DNA sequence has the nucleotide sequence of SEQ ID NO: 60. In one embodiment, a particular IRES is used only once in a genome. This may be beneficial to the stability of the genome.

[0449] As used herein, "high self-cleavage efficiency 2A peptides" or "2A peptides" refer to peptides that are efficiently cleaved after translation. Suitable 2A peptides include P2A, F2A, E2A, and T2A. The inventors have noted that once a specific DNA sequence encoding a given 2A peptide has been used once, the same specific DNA sequence may not be used again. However, the redundancy in the DNA code can be used to generate a DNA sequence that translates into the same 2A peptide. The use of 2A peptides is particularly useful when the cassette encodes a polycistronic mRNA. The use of 2A peptides results in a single translated polypeptide chain being modified after translation to generate multiple separate proteins or peptides.

[0450] In one embodiment, the encoded P2A peptide employed has the amino acid sequence of SEQ ID NO: 61. In one embodiment, the encoded F2A peptide employed has the amino acid sequence of SEQ ID NO: 62. In one embodiment, the encoded E2A peptide employed has the amino acid sequence of SEQ ID NO: 63. In one embodiment, the encoded T2A peptide employed has the amino acid sequence of SEQ ID NO: 64.

[0451] In one embodiment, the or each mRNA encoded by one or more transgenes includes a polyadenylation signal sequence, such as typically at the end of the mRNA sequence, for example as set forth in SEQ ID NO: 65. Thus, one embodiment of a transgene or transgene cassette includes at least one sequence encoding a polyadenylation signal sequence.

[0452] As used herein, "Poly A," "polyadenylation signal," or "polyadenylation sequence" refers to a DNA sequence, typically containing an AATAAA site, which, once transcribed, is recognized by a multiprotein complex that cleaves and polyadenylates the nascent mRNA molecule.

[0453] In one embodiment, the polyadenylation sequence has the nucleotide sequence of SEQ ID NO:65.

[0454] In one embodiment, the construct does not comprise a polyadenylation sequence.In one embodiment, the regulator of gene expression is a splice acceptor sequence.

[0455] In one embodiment, the sequence encoding a protein / polypeptide / peptide, such as an antibody or antibody fragment (such as a bispecific T cell engager according to the present disclosure) further comprises a polyadenylation signal.

[0456] Molecules encoded by transgenes

[0457] As described herein, at least one transgene in the virus encodes a bispecific T cell engager, wherein one binding domain is specific for a T cell surface antigen. The second binding domain can target a suitable antigen, such as a pathogen antigen, a cancer antigen, or a stromal antigen.

[0458] Cancer antigens (also called tumor antigens) are of particular interest and include, for example, antigens selected from the group consisting of CEA, MUC-1, EpCAM, HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigens Le y 、Le x 、Le b, PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2, ErbB3, WT1, MUC1, LMP2, idiotype, HPV E6 and E7, EGFRvIII, HER-2 / neu, MAGE A3, p53 non-mutant, p53 mutant, NY-ESO-1, GD2, PSMA, PCSA, PSA, MelanA / MART1, Ras mutant, proteinase 3 (PR1), bcr-abl, tyrosinase, survivin, PSA, hTERT, specifically WT1, MUC1, HER-2 / neu, NY-ESO-1, survivin and hTERT.

[0459] Stromal antigens include fibroblast antigens, such as those described herein, such as FAP, tumor-associated macrophage antigens, and myeloid-derived suppressor cell antigens, including, for example, CD163, CD206, CD68, CD11c, CD11b, CD14, CSF1 receptor, CD15, CD33, and CD66b.

[0460] If appropriate, the list of targets below can be encoded in the bispecific T cell engager according to the present disclosure, or alternatively can be provided as an additional therapeutic transgene, or both.

[0461] In one embodiment, one or more transgenes independently encode proteins, peptides, RNA molecules, such as RNA molecules. Advantageously, the transgene can be delivered intracellularly and subsequently transcribed and, if appropriate, translated. Examples of genetic material encoded by the transgene include, for example, antibodies or their binding fragments, chemokines, cytokines, immunomodulatory factors, enzymes (e.g., capable of converting prodrugs in active agents), and RNAi molecules.

[0462] As used herein, a peptide refers to an amino acid sequence of 2 to 50 residues, for example, 5 to 20 residues. As used herein, a polypeptide refers to an amino acid sequence of more than 50 residues that does not have a tertiary structure, specifically, does not have a secondary structure or a tertiary structure. A protein refers to an amino acid sequence of more than 50 residues that has a secondary and / or tertiary structure, specifically, has a secondary structure or a tertiary structure.

[0463] In one embodiment, the coding sequence encodes a therapeutic RNA, therapeutic peptide, therapeutic polypeptide, or therapeutic protein (ie, a therapeutic gene).

[0464] As used herein, an immunomodulatory gene or transgene refers to a gene that encodes a peptide or protein molecule that can qualitatively or quantitatively modify one or more activities of a cell of the immune system.

[0465] As used herein, a therapeutic gene means a gene encoding an entity that can be used to treat, ameliorate or prevent a disease, e.g., the gene expresses a therapeutic protein, polypeptide, peptide or RNA that at least slows, stops or reverses the progression of a disease such as cancer.

[0466] In one embodiment, the entity encoded by the transgene, when transcribed or translated in a cell such as a cancer cell, increases the danger signal produced by the cell. As used herein, "danger signal" refers to various molecules produced by cells that undergo injury, stress, or non-apoptotic death that serve as alarm signals, for example, by stimulating a direct response of cells of the innate immune system and for enhancing activation of cells of the adaptive immune system.

[0467] It is well known that the tumor microenvironment often undergoes changes that downregulate the natural human immune response. Therefore, the ability to re-initiate the immune response from within the tumor could be very interesting in cancer therapy.

[0468] In one embodiment, the encoded therapeutic peptide or protein is designed to be secreted into the extracellular environment. In one embodiment, the functional RNA, peptide, polypeptide or protein (such as an antibody) is released into the external microenvironment of the cell, for example, into the culture supernatant, or in vivo: tissue, matrix, circulation, blood and / or lymphatic system.

[0469] In one embodiment, the peptide, polypeptide, or protein encoded by the transgene (comprising a bispecific T cell engager according to the present disclosure) includes a signal sequence. As used herein, a signal peptide refers to a short 13 to 36 residue peptide sequence located at the N-terminus of a protein that facilitates entry of the protein into the secretory pathway for secretion or membrane expression. In one embodiment, the leader sequence (signal peptide) has the amino acid sequence of SEQ ID NO: 66 or SEQ ID NO: 67.

[0470] In another embodiment, the encoded therapeutic peptide or protein, such as an antibody, is designed to be expressed in a membrane-anchored form in the surface membrane of a cell, for example by including a site encoding a transmembrane domain or for attachment of a lipid membrane anchor in the protein. Typically, one or more bispecific T cell engagers of the present disclosure are not expressed in a cell surface-anchored form.

[0471] In one embodiment, functional RNA, peptides, polypeptides, or proteins, such as antibodies, are released from cells infected by the adenovirus, for example, by active secretion or as a result of cell lysis. Thus, in one embodiment, the adenovirus lyses the cells, thereby releasing functional RNA, peptides, polypeptides, or proteins, such as antibodies.

[0472] In another embodiment, the encoded additional therapeutic peptide or protein, such as an antibody, is designed to be retained within the intact cell.

[0473] Advantageously, functional RNA, peptides, polypeptides, or proteins, such as antibodies expressed by the adenoviruses of the present disclosure, can be detected in tissues in vivo as mRNA and antibody proteins. In addition, functional RNA, peptides, or proteins, such as antibodies, can bind to their ligands in ELISA. Still further, functional RNA, peptides, polypeptides, or proteins, such as antibodies, can be detected early (e.g., within 3 days after infection) and expression persists for several weeks.

[0474] In one embodiment, the adenovirus of the present disclosure expresses a functional RNA, peptide, polypeptide or protein, such as an antibody, such as within about 3 days or more of infection, such as within about 36 hours, 48 ​​hours, 60 hours or 72 hours, or such as 2 days, 3 days, 4 days, 5 days or 6 days.

[0475] In one embodiment, the adenovirus of the present disclosure expresses a functional RNA, peptide, polypeptide, or protein, such as an antibody, for several weeks, such as about 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, or 6 weeks, such as 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 33 days, 34 days, 35 days, 36 days, 37 days, 38 days, 39 days, 40 days, 41 or 42 days.

[0476] Advantageously, the functional RNA, peptide or protein expression, such as antibody expression, is sufficient to enable detection of the functional RNA, peptide, polypeptide or protein, such as the antibody in blood.

[0477] In one embodiment, functional RNA, peptides, or proteins such as antibodies expressed by the adenoviruses of the present disclosure enter the bloodstream and / or lymphatic system.

[0478] In one embodiment, the adenovirus of the present disclosure is an oncolytic virus having an enhanced therapeutic index for cancer cells.

[0479] In one embodiment, the coding sequence further encodes a functional RNA, such as a therapeutic RNA.

[0480] As used herein, functional RNA refers to an RNA with a function other than encoding a protein or peptide, and includes, for example, an RNA construct suitable for inhibiting or reducing gene activity, including RNAi such as shRNA and miRNA. As used herein, shRNA refers to a short hairpin RNA, which is an RNA sequence that produces a tight hairpin turn, which can be used to silence target gene expression by RNA interference (RNAi). As used herein, miRNA (microRNA) refers to a small non-coding RNA molecule (containing about 22 nucleotides) that acts by base pairing with a complementary sequence within an mRNA molecule to regulate gene expression at the transcriptional or post-transcriptional level. The mRNA chains bound by miRNA are silenced because they can no longer be translated into protein by ribosomes, and this complex is typically actively decomposed by cells.

[0481] In one embodiment, the transgene encodes a protein. As used herein, a protein comprises a protein ligand, a protein receptor, or an antibody molecule.

[0482] As used herein, a protein ligand refers to a binding fragment of a cell surface membrane or secreted protein that binds to a cell receptor or otherwise binds to a cell receptor to affect cellular function, such as by stimulating intracellular signaling and regulating gene transcription within the cell. In one embodiment, the expressed protein is engineered to be expressed on the cell surface and / or secreted from the cell.

[0483] In one embodiment, the encoded protein is a bispecific antibody such as a bispecific T cell engager.

[0484] In one embodiment, the transgene further encodes an enzyme, such as an enzyme that helps degrade the extracellular matrix of the tumor, such as DNAse, collagenase, matrix metalloproteinase (such as MMP2 or 14), or the like.

[0485] Suitable antibodies and antibody fragments can be agonistic or antagonistic, and include antibodies and antibody fragments with anti-cancer activity and antibodies and antibody fragments that modify the host cell response to cancer, for example, agonist or antagonist antibodies or antibody fragments can reduce angiogenesis or normalize tumor angiogenesis. In one embodiment, agonistic antibodies or other encoded proteins can make host cells more visible to the host's innate and adaptive immune responses, for example by expressing antigens, danger signals, cytokines or chemokines to attract and activate host cells, or by binding to co-stimulatory or checkpoint pathway molecules to enhance the adaptive immune response.

[0486] As used herein, a therapeutic antibody or antibody binding fragment refers to an antibody or antibody binding fragment that, when incorporated into an oncolytic virus, has a beneficial effect on the patient's pathology, such as the cancer being treated.

[0487] As used herein, beneficial effect refers to a desirable and / or advantageous effect of an antibody expressed in vivo.

[0488] Classes of therapeutic antibodies and antibody-binding fragments include: anti-EGF antibodies, anti-VEGF antibodies, anti-PDGF antibodies, anti-CTLA antibodies, anti-PD1 antibodies, anti-PDL1 antibodies, and anti-FGF antibodies.

[0489] Registered therapeutic antibodies suitable for incorporation into the disclosed viruses include abciximab, adalimumab, alemtuzumab, basiliximab, belimumab, bevacizumab, brentuximab, canakinumab, cetuximab, certolizumab pegol, daclizumab, denosumab, eculizumab, efalixumab, gemtuzumab, golimumab, ibritumomab tiuxetan, infliximab, ipilimumab, muromonab-CD3, ofatumumab, palivizumab, panitumumab, ranibizumab, rituximab, tocilizumab, tositumomab, and trastuzumab.

[0490] In one embodiment, the antibody or antibody fragment employed has an antibody variable region sequence that is similar to that of bevacizumab (also known as ) are 95% to 100% similar or identical, such as 96%, 97%, 98% or 99% similar or identical to the variable regions of the proteins.

[0491] Also suitable for incorporation into the viruses of the present disclosure are coding sequences for antibodies and binding fragments thereof that are approved for cancer indications, such as trastuzumab, tositumomab, rituximab, panitumumab, ofatumumab, ipilimumab, ibritumomab tiuxetan, gemtuzumab, denosumab, cetuximab, brentuximab, bevacizumab, and adalimumab.

[0492] In one embodiment, the antibody or antibody fragment employed has an antibody variable region sequence that is 95% to 100% similar or identical to the variable region of a known antibody or an antibody disclosed herein.

[0493] As used herein, "antibody molecules" include antibodies and binding fragments thereof.

[0494] As used herein, antibodies generally refer to full-length antibodies and bispecific or multispecific forms including full-length antibodies.

[0495] Antibody binding fragments include antibody fragments that are capable of targeting an antigen with the same, similar, or better specificity than the original "antibody" from which they were derived. Antibody fragments include: Fab, modified Fab, Fab', modified Fab', F(ab')2, Fv, single domain antibodies (e.g., VH or VL or VHH), scFv, bivalent antibodies, trivalent antibodies or tetravalent antibodies, double scFv, double antibodies, three antibodies, four antibodies, and epitope binding fragments of any of the above (see, e.g., Holliger and Hudson, 2005, Nature Biotechnology, 23(9):1126-1136; Adair and Lawson, 2005, Drug Design Reviews-Online 2(3), 209-217). Methods for generating and preparing these antibody fragments are well known in the art (see, e.g., Verma et al., 1998, Journal of Immunological Methods, 216, 165-181). Other antibody fragments useful in the present invention include Fab and Fab' fragments described in International Patent Applications WO2005 / 003169, WO2005 / 003170 and WO2005 / 003171. Multivalent antibodies may comprise multiple specificities, such as bispecifics or may be monospecific (see, for example, WO 92 / 22853, WO05 / 113605, WO2009 / 040562 and WO2010 / 035012).

[0496] As used herein, specificity refers to an antibody or fragment that recognizes only its specific antigen, or an antibody or fragment that has a significantly higher binding affinity for the antigen than for an antigen for which it is not specific, e.g., a 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold higher binding affinity.

[0497] Known antibodies or antibody binding fragments can be used to generate alternative antibody formats having the same CDRs or the same variable regions. For example, a full-length antibody can be readily converted into a Fab, Fab' or scFv fragment.

[0498] A variety of different forms of antibodies can be employed in the constructs of the present disclosure, including antibody molecules from non-human animals, human antibody molecules, humanized antibody molecules, and chimeric antibody molecules.

[0499] In one embodiment, the antibody or binding fragment is monoclonal. Monoclonal antibodies can be prepared by any method known in the art, such as hybridoma technology (Kohler & Milstein, 1975, "Nature", 256:495-497); trioma technology, human B cell hybridoma technology (Kozbor et al., 1983, "Today's Immunology", 4:72) and EBV-hybridoma technology (Cole et al., "Monoclonal Antibodies and Cancer Therapy", pp. 77 to 96, Alan R Liss, Inc., 1985).

[0500] In one embodiment, the antibody or binding fragment is non-human, ie, is derived entirely from a non-human source. This is possible because antibodies and fragments can be delivered within cancer cells via viruses.

[0501] In one embodiment, the antibody is chimeric, eg, having one or more human constant regions and non-human variable regions.

[0502] In one embodiment, the antibody or binding fragment is human, ie, derived from a fully human origin.

[0503] In one embodiment, antibody or binding fragment is humanized.Humanized antibody (it comprises the antibody of CDR grafting) is the antibody molecule with one or more complementary determining regions (CDR) from non-human species and the framework region from human immunoglobulin molecule (see, for example, US 5,585,089; WO91 / 09967).It should be understood that it may only be necessary to transfer the specificity determining residues of CDR instead of the entire CDR (see, for example, Kashmiri et al., 2005, " Methods ", 36,25-34).Humanized antibody can optionally further include one or more framework residues derived from non-human species, such as CDR derived from these residues.

[0504] In one embodiment, the coding sequence encodes an antibody heavy chain, an antibody light chain, or an antibody fragment. As used herein, a heavy chain (HC) refers to a large polypeptide subunit of an antibody. As used herein, a light chain (LC) refers to a small polypeptide subunit of an antibody. In one embodiment, an antibody light chain includes a CL domain, κ, or λ.

[0505] Antibodies for use in the present disclosure can be obtained using any suitable method known in the art. Antigenic polypeptides / proteins include fusion proteins, and cells (recombinant or natural) expressing the polypeptides (such as activated T cells) can be used to produce antibodies that specifically recognize the antigen. The polypeptide can be a "mature" polypeptide or a biologically active fragment or derivative thereof.

[0506] Screening of antibodies can be performed using assays to measure binding to an antigen and / or assays to measure the ability to antagonize a receptor. An example of a binding assay is an ELISA, specifically using a fusion protein (optionally including a reporter molecule) immobilized on a plate and employing a conjugated secondary antibody to detect antigen-antibody binding to the fusion protein.

[0507] If present, the constant region domains of the antibody molecules of the present invention can be selected taking into account the function of the proposed antibody molecule, and in particular the effector functions that may be required. For example, the constant region domains can be human IgA, IgD, IgE, IgG or IgM domains. In particular, when the antibody molecule is used for therapeutic purposes and antibody effector functions are required, human IgG constant region domains, especially IgG1 and IgG3 isotypes, can be used. Alternatively, when the antibody molecule is intended to be used for therapeutic purposes and antibody effector functions are not required, IgG2 and IgG4 isotypes can be used, for example, for simple agonistic activity or for target neutralization. It should be understood that sequence variants of these constant region domains can also be used. For example, an IgG4 molecule can be used in which the serine at position 241 has been changed to a proline as described in Angal et al., Molecular Immunology, 1993, 30(1), 105-108.

[0508] For certain antibody functions, such as for delivering activation signals to cells carrying an antibody target molecule, such as cells of the immune system, it may be advantageous to use a membrane-anchored form of the antibody so that the antibody will be expressed on the surface of the expressing cell. Such cell-surface expressed binding molecules can achieve efficient multimeric interactions between target signaling molecules on the surface of another cell, which enhances the delivery of the activation signal from the target molecule to the recipient cell.

[0509] Advantageously, the adenoviruses of the present disclosure can express full-length antibodies, antibody fragments such as scFv, multispecific antibodies, and in particular bispecific antibodies such as the bispecific T cell engagers described herein.

[0510] In one embodiment, the sequence encoding the antibody or antibody fragment (such as a bispecific T cell adapter according to the present disclosure) includes or further includes an internal ribosome entry sequence. As used herein, an internal ribosome entry sequence (IRES) means a nucleotide sequence that allows translation to begin in the middle of a messenger RNA (mRNA) sequence.

[0511] In one embodiment, the encoded therapeutic protein or peptide is a target-specific protein, polypeptide, or peptide.

[0512] As used herein, a target-specific protein or peptide refers to the target protein itself, or a different protein or peptide that directly binds (e.g., is specific for the target) or otherwise modifies the level of the target protein or peptide. Examples of the former are cytokines, while examples of the latter are antibodies against the cytokines.

[0513] The target of interest generally relates to a specific cell, cell product, antigen, or signaling pathway associated with a disease, in particular a cancer. Depending on the context, a target also relates to an mRNA or analog transcribed from a gene encoding a protein or polypeptide, which can be inhibited, for example, by RNAi-type techniques. Thus, in the context of RNA, such as RNAi techniques, the target is the mRNA encoded by the target gene.

[0514] Examples of targets of interest include, but are not limited to, stimulatory T cell co-receptors and their ligands, checkpoint inhibitory T cell co-receptor molecules and their ligands, receptors expressed by regulatory T cells and their ligands, myeloid-derived suppressor cells and immunosuppressive immune cells, dendritic cell and antigen-presenting cell receptors and their ligands, antigen processing and presentation mediators, cytokines and cytokine receptors, chemokines and chemokine receptors, transcription factors and transcriptional regulators, intracellular trafficking molecules and regulators of cellular function, tumor cell and tumor microenvironment receptors and products, intracellular tumor cell enzymes such as IDO, and antigens for recognition by immune cells.

[0515] In one embodiment, as used herein, target refers to a protein or polypeptide that can be, for example, inhibited, neutralized or activated by an antibody or a binding fragment thereof when appropriate. In the context of a cytokine, target refers to a cytokine itself or an antibody or a binding fragment thereof that is specific to the cytokine. Therefore, a virus can encode and express the cytokine itself because its release can stimulate a "host" immune response. In the context of a ligand, the mutant form of the ligand can be encoded by a virus that competes with a natural ligand to bind to a receptor. The ligand of mutation can have an increased binding affinity to the receptor, for example, such that it has a slow dissociation rate, thereby occupying the receptor and increasing or reducing its signal transduction. Alternatively, compared with the wild-type ligand, the activity of the mutant ligand can be reduced, thereby reducing the combination and overall activity of the receptor by the natural ligand.

[0516] In one embodiment, a virus or construct according to the present disclosure encodes a prodrug, an immunomodulatory factor, and / or an enzyme.

[0517] As used herein, a prodrug is a molecule that is administered as an inactive (or less than fully active) derivative that is subsequently converted into an active pharmacological agent in vivo, typically by normal metabolic processes. A prodrug serves as a precursor of the intended drug. A prodrug-converting enzyme serves as an enzyme that converts a prodrug into its pharmacologically active form.

[0518] As used herein, an immunomodulatory factor refers to a regulatory factor of an immune response. An immunomodulatory factor plays a role in regulating the immune response to a desired level, such as immune enhancement, immunosuppression, or induction of immune tolerance.

[0519] T cells need two signals to be fully activated.Antigen-specific first signal is provided by T cell receptor, which interacts with the peptide-MHC molecules on antigen presenting cell (APC) membrane.The second signal, i.e., costimulatory signal, is antigen nonspecific and is provided by the interaction between costimulatory molecules expressed on APC membrane and T cells.Therefore, as used herein, costimulatory molecules mean molecules that provide complementary signals for the antigen-specific signals required for T cell activation, proliferation and survival.Examples of costimulatory molecules include but are not limited to CD28, CD80, CD86, CD83 and 4-1BB.

[0520] As used herein, enzyme means a substance that acts as a catalyst in a living organism, regulating the rate at which a chemical reaction proceeds without itself being altered in the process.

[0521] The following is a non-exhaustive discussion of exemplary target peptides / polypeptides and proteins.

[0522] In one embodiment, the target is a checkpoint protein, such as an immune checkpoint or a cell cycle checkpoint protein. Examples of checkpoint proteins include, but are not limited to, CTLA-4, PD-1, PD-L1, PD-L2, VISTA, B7-H3, B7-H4, HVEM, ILT-2, ILT-3, ILT-4, TIM-3, LAG-3, BTLA, LIGHT, or CD160, such as CTLA-4, PD-1, PD-L1, and PD-L2. In one embodiment, an antibody or binding fragment thereof specific for one of them is provided. Therefore, in one embodiment, the transgene or transgene cassette encodes an antibody or antibody fragment specific for CTLA-4, PD-1, PD-L1, or PD-L2. In one embodiment, the adenovirus expresses an antibody or antibody fragment specific for CTLA-4, PD-1, PD-L1, or PD-L2.

[0523] In one embodiment, the antibody is a checkpoint inhibitor antibody, such as anti-PD-L1. In one embodiment, the adenovirus expresses a full-length anti-human PD-L1 antibody. In one embodiment, expression of the full-length anti-human PD-L1 antibody is controlled by an endogenous promoter such as the major late promoter (MLP), specifically at position B. Y In one embodiment, the adenovirus expresses an anti-human PD-L1 antibody in the form of a scFv. In one embodiment, the expression of the anti-human PD-L1 antibody in the form of a scFv is controlled by an endogenous promoter such as the major late promoter, specifically at position B.Y .

[0524] In one embodiment, viruses or constructs encoding antibodies or binding fragments thereof according to the present disclosure are provided, for example, full-length antibodies or scFvs specific for CTLA-4 as exemplified herein.

[0525] In one embodiment, the target is one or more independently selected from the group consisting of CD16, CD25, CD33, CD332, CD127, CD31, CD43, CD44, CD162, CD301a, CD301b, and Galectin-3. In one embodiment, an antibody or binding fragment thereof, such as a full-length antibody or scFv, specific therefor is provided.

[0526] In one embodiment, the target that can be targeted, for example, by the antibody or binding fragment is one or more independently selected from the group consisting of: FLT-3, FLT-3 ligand, TLRs, TLR ligand, CCR7, CD1a, CD1c, CD11b, CD11c, CD80, CD83, CD86, CD123, CD172a, CD205, CD207, CD209, CD273, CD281, CD283, CD286, CD289, CD287, CXCR4, GITR ligand, IFN-α2, IL-12, IL-23, ILT1, ILT2, ILT3, ILT4, ILT5, ILT7, TSLP receptor, CD141, CD303, CADM1, CLEC9a, XCR1 and CD304.

[0527] In one embodiment, the target of the bispecific T cell engager employed in the present disclosure is a tumor cell antigen.

[0528] In one embodiment, the target is one or more independently selected from the group consisting of: CEA, MUC-1, EpCAM, HER receptors HER1, HER2, HER3, HER4, PEM, A33, G250, carbohydrate antigen Le y 、Le x 、Le b , PSMA, TAG-72, STEAP1, CD166, CD24, CD44, E-cadherin, SPARC, ErbB2, ErbB3.

[0529] In one embodiment, the target of the bispecific T cell engager employed in the present disclosure is a tumor stromal antigen.

[0530] In one embodiment, the target of the bispecific T cell engager employed in the present disclosure is one or more independently selected from the group consisting of: FAP, TREM1, IGFBP7, FSP-1, platelet-derived growth factor-α receptor (PDGFR-α), platelet-derived growth factor-β receptor (PDGFR-β) and vimentin.

[0531] In one embodiment, a target, e.g., that can be targeted by an antibody or binding fragment (e.g., a bispecific T cell engager) is a cancer target.

[0532] In one embodiment, the target is one or more independently selected from the group consisting of OX40, OX40 ligand, CD27, CD28, CD30, CD40, CD40 ligand, TL1A, CD70, CD137, GITR, 4-1BB, ICOS or ICOS ligand, such as CD40 and CD40 ligand.

[0533] In one embodiment, the transgene cassette encodes a ligand comprising CD40 or a CD40 ligand, or an antibody, antibody fragment, or shRNA targeting CD40 or a CD40 ligand. In one embodiment, the adenovirus expresses a ligand comprising CD40 or a CD40 ligand, or an antibody, antibody fragment, or shRNA targeting (specific for) CD40 or a CD40 ligand.

[0534] In one embodiment, the target is one or more cytokines independently selected from the group consisting of IL-1α, IL-1β, IL-6, IL-9, IL-12, IL-13, IL-17, IL-18, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-33, IL-35, interleukin-2 (IL-2), IL-4, IL-5, IL-7, IL-10, IL-15, IL-21, IL-25, IL-1RA, IFNα, IFNβ, IFNγ, TNFα, TGFβ, lymphotoxin alpha (LTA), and GM-CSF.

[0535] In one embodiment, the transgene cassette encodes an antibody or antibody fragment specific for IL-12, IL-18, IL-22, IL-7, IL-15, IL-21, IFNα, IFNγ, TNFα, TGFβ, or lymphotoxin alpha (LTA). In one embodiment, the adenovirus expresses IL-12, IL-18, IL-22, IL-7, IL-15, IL-21, IFNα, IFNγ, TNFα, TGFβ, or lymphotoxin alpha (LTA).

[0536] In one embodiment, the amino acid sequence of IFNγ is SEQ ID NO: 68. In one embodiment, the amino acid sequence of IFNα is SEQ ID NO: 69. In one embodiment, the amino acid sequence of TNFα is SEQ ID NO: 70.

[0537] In one embodiment, the target is, e.g., one or more chemokines independently selected from the group consisting of IL-8, CCL3, CCL5, CCL17, CCL20, CCL22, CXCL9, CXCL10, CXCL11, CXCL13, CXCL12, CCL2, CCL19, CCL21, CXCR2, CCR2, CCR4, CCR5, CCR6, CCR7, CCR8, CXCR3, CXCR4, CXCR5, and CRTH2.

[0538] In one embodiment, the transgene cassette encodes an antibody or antibody fragment specific for CCL5, CXCL9, CXCL12, CCL2, CCL19, CCL21, CXCR2, CCR2, CCR4, or CXCR4. In the context of chemokines, the target includes the location where the virus encodes and expresses the chemokine, for example, to induce or enhance the host immune response to cancer.

[0539] In one embodiment, the adenovirus expresses an antibody or antibody fragment specific for CCL5, CXCL9, CXCL12, CCL2, CCL19, CCL21, CXCR2, CCR2, CCR4, or CXCR4.

[0540] In one embodiment, the target is one or more independently selected from the group consisting of STAT3, STAT1, STAT4, STAT6, CTIIA, MyD88 and NFκB family members, such as a protein targeted by an inhibitor, such as an antibody or a binding fragment thereof, or mRNA transcribed from a related gene is inhibited by a mechanism such as RNAi.

[0541] In one embodiment, the target is HSp70 or a regulator of cell survival and death such as survivin, for example, the protein is targeted by an inhibitor, such as an antibody or binding fragment thereof, or mRNA transcribed from the relevant gene is inhibited by a mechanism such as RNAi.

[0542] In one embodiment, the target is one or more independently selected from the group consisting of amphiregulin, BTC, NRG1a, NRG1b, NRG3, TGFα, LRIG1, LRIG3, EGF, EGF-L6, epithelial cell mitogen-activated protein kinase antibody, HB-EGF, EGFR, Her2, Her3 and Her4, for example, the protein is targeted by an inhibitor, such as an antibody or a binding fragment thereof, or the mRNA transcribed from the relevant gene is inhibited by a mechanism such as RNAi.

[0543] In one embodiment, the target is a ligand or receptor for one or more independently selected from the group consisting of hedgehog, FGF, IGF, Wnt, VEGF, TNF, TGFβ, PDGF, and Notch.

[0544] In one embodiment, the adenovirus expresses an antibody or antibody fragment specific for VEGF. In one embodiment, the antibody is an anti-VEGF antibody. For example, an antibody having the amino acid sequence of the antibody bevacizumab or its equivalent. In one embodiment, the adenovirus expresses a full-length anti-human VEGF antibody. In one embodiment, expression of the full-length anti-human VEGF antibody is controlled by an endogenous promoter such as the major late promoter (MLP), specifically at position B. Y In one embodiment, the adenovirus expresses an anti-human VEGF antibody in the form of a scFv. In one embodiment, the expression of the anti-human VEGF antibody in the form of a scFv is controlled by an endogenous promoter such as the major late promoter, specifically at position B. Y .

[0545] In one embodiment, the target is IDO.

[0546] In one embodiment, the target is an antigen for immune cell recognition (such as a T cell engaged by a bispecific T cell engager) is one or more proteins or peptides independently selected from the group consisting of: immunogenic proteins from infectious organisms, such as cytomegalovirus antigens, influenza antigens, hepatitis B surface and core antigens, diphtheria toxoid, Crm197, tetanus toxoid; peptides derived from these antigens that are known T cell or antibody epitopes, or genetically engineered complexes or multimers of these antigens; tumor-derived proteins as antigens; peptides derived from these antigens that are known T cell or antibody epitopes; and genetically engineered complexes or multimers of these antigens, such as WT1, MUC1, LMP2, idiotype, HPV E6 and E7, EGFRvIII, HER-2 / neu, MAGE A3, p53 non-mutant, p53 mutant, NY-ESO-1, GD2, PSMA, PCSA, PSA, gp100, CEA, MelanA / MART1, Ras mutant, proteinase 3 (PR1), bcr-abl, tyrosinase, survivin, PSA, hTERT, specifically WT1, MUC1, HER-2 / neu, NY-ESO-1, survivin, or hTERT.

[0547] The skilled artisan will understand that due to codon redundancy, there are many possibilities for nucleic acid sequences encoding a given amino acid sequence, that silent nucleic acid base pair mutations are tolerated, and that all nucleic acid sequences encoding a given amino acid sequence as defined in any one of the SEQ ID NOs are contemplated by the present disclosure.

[0548] In one embodiment, the peptide, polypeptide, or protein encoded by the transgene is a mimotope. As used herein, a mimotope is a molecule, typically a peptide, that mimics the structure of an epitope. This latter property elicits an antibody response similar to that elicited by the epitope. Antibodies directed against a given epitope will recognize a mimotope that mimics that epitope. Mimotopes are typically obtained from phage display libraries by biopanning. Vaccines utilizing mimotopes are under development. Thus, antibodies of known specificity can be used to screen libraries (e.g., peptide libraries in phage display - e.g., libraries of Ab sequences or non-antibody peptide libraries, particularly those optimized for the production of peptides with more stable 3D conformations) - and the generation of mimotopes is well described in the art (see Tribbick G, Rodda S. Combinatorial methods for discovering peptide ligands that bind to antibody-like molecules. J Mol Recognit. 2002 15(5):306-10; Masuko T, Ohno Y, Masuko K, Yagi H, Uejima S, Takechi M, Hashimoto Y. .A robust strategy for therapeutic antibodies against membrane oncoproteins using rats immunized with transfectants expressing the target molecule fused to green fluorescent protein. Cancer Sci. 2011 102(1):25-35).

[0549] In one embodiment, mimetic epitopes or other designed vaccine antigens are encoded by transgenes and expressed to induce an antibody response in a recipient patient, wherein the induced antibodies have the desired therapeutic effect. In one embodiment, a GFP-peptide fusion protein with a peptide sequence from a desired human ligand is used to induce an anti-self target antibody response, for example, a peptide region of PD-L1 known to be important for binding to the target molecule PD-1 can be genetically linked to GFP or other highly immunogenic foreign carrier protein genes, such that the immune antibody response to the peptide includes antibodies that cross-react with the native PDL1 molecule and thus block the PD-L1:PD-1 interaction in the same manner as directly encoding an anti-PDL1 antibody. The concept of vaccines for inducing anti-self therapeutic antibody responses is well described in the art (see Spohn G, Bachmann MF. Therapeutic vaccination to block receptor-ligand interactions. Expert Opin Biol Ther. 2003 3(3):469-76; Link A, Bachmann MF. Immunopharmaceuticals: disrupting B- but not T-cell tolerance with therapeutic anti-cytokine vaccines. Immunotherapy 2010 2(4):561-74; Delavallée L, Assier E, Semerano L, Bessis N, Boissier MC. Emerging applications of anti-cytokine vaccines. Expert Rev Vaccines 2008 7(10):1507-17).

[0550] In one or more embodiments, the transgene used encodes the sequence shown in any one of SEQ ID NOs: 2, 4, 7, 11, or 16.

[0551] In another embodiment, the transgene employed encodes a sequence that excludes a deca-His affinity tag at the C-terminus, such as that shown in the virus set forth in any one of SEQ ID NOs: 72 to 78.

[0552] Advantageously, the adenovirus of the present disclosure expresses and releases antibody forms (such as bispecific T cell engagers) and other proteins such as cytokines encoded by the transgene therein into in vitro culture supernatants or into the tumor tissue matrix in vivo. The leader sequence can help the encoded protein / polypeptide or peptide leave the cancer cell. Therefore, in one embodiment, the encoded "protein" includes a leader sequence. As used herein, a leader sequence refers to a polynucleotide sequence located between the promoter sequence and the coding region, which can regulate gene expression at the transcriptional or translational level.

[0553] In one embodiment, the coding sequence encodes a peptide. As used herein, a peptide refers to an amino acid chain that is not a complete functional protein. Typically, a fragment retaining some or all of the functions of a protein is a fragment of the immune system, or can be recognized by the immune system, such as a peptide of 8 or more amino acids that can be recognized by T cells.

[0554] In one embodiment, the transgene is a reporter gene encoding, for example, an imaging agent including bioluminescence, a fluorescent imaging agent (including an activatable fluorescent imaging agent), such as luciferase, GFP or eGFP, or red fluorescent protein.

[0555] As used herein, reporter gene or reporter sequence means the gene or DNA sequence of the product produced in eukaryotic cells that is easily detected, and can be used as a marker to determine the activity of another gene tightly connected or combined with its DNA. Reporter gene gives the characteristic or selectable marker of the cell or organism expressing them that is easy to identify and measure. Reporter gene is generally used as indicating whether a certain gene has been absorbed or expressed by cell or biological colony. Examples of common reporter genes include but are not limited to: LacZ, luciferase, GFP, eGFP, neomycin phosphotransferase, chloramphenicol acetyltransferase, sodium iodide symporter (NIS), nitroreductase (such as NfsA, NfsB) intracellular metalloproteinase, HSV1-tk or estrogen receptor.

[0556] In one embodiment, the genetic material (particularly the transgene) does not encode or express a reporter gene such as an imaging agent, luciferase, GFP, or eGFP.

[0557] By examining the lytic potential in a panel of tumor cells, the preference of viruses according to the present disclosure for specific tumor types can be studied, for example, colon tumor cell lines including HT-29, DLD-1, LS174T, LS1034, SW403, HCT116, SW48, and Colo320DM. Any available colon tumor cell line is also useful for this assessment.

[0558] Prostate cell lines include DU145 and PC-3 cells. Pancreatic cell lines include Panc-1 cells. Breast tumor cell lines include the MDA231 cell line, and ovarian cell lines include the OVCAR-3 cell line. Hematopoietic cell lines include, but are not limited to, Raji and Daudi B lymphocytes, K562 erythroblastoid cells, U937 bone marrow cells, and HSB2 T lymphocytes. Other available tumor cell lines are also useful.

[0559] The present disclosure also extends to novel sequences of the present disclosure. In one embodiment, the virus is represented by any one of the sequences disclosed herein, for example any one of SEQ ID NOs: 34 to 37, or a sequence at least 95% identical thereto, for example as set forth in any one of SEQ ID NOs: 79 to 82.

[0560] Preparations

[0561] The present disclosure also relates to pharmaceutical formulations of the viruses as described herein.

[0562] In one embodiment, a liquid parenteral formulation is provided, for example for infusion or injection of an oncolytic replica according to the present disclosure, wherein the formulation provides a dose in the range of 1×10 10 to 1×10 14 Virus particles.

[0563] Parenteral formulations refer to formulations that are not designed to be delivered through the gastrointestinal tract. Typical parenteral delivery routes include injection, implantation, or infusion. In one embodiment, the formulation is provided in the form of a bolus delivery.

[0564] In one embodiment, the parenteral formulation is in the form of an injection. Injection includes intravenous, subcutaneous, intratumoral, or intramuscular injection. As used herein, injection means injecting a liquid into the body via a syringe. In one embodiment, the methods of the present disclosure do not involve intratumoral injection.

[0565] In one embodiment, the parenteral formulation is in the form of an infusion.

[0566] As used herein, infusion refers to administering a fluid at a slower rate by drip, infusion pump, syringe driver, or equivalent device. In one embodiment, the infusion is administered over a period of 1.5 minutes to 120 minutes, such as about 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 60 minutes, 65 minutes, 70 minutes, 65 minutes, 80 minutes, 85 minutes, 90 minutes, 95 minutes, 100 minutes, 105 minutes, 110 minutes, or 115 minutes.

[0567] In one embodiment, a dose of the formulation is less than 100 ml, such as 30 ml, for example, when administered via a syringe driver. In one embodiment, a dose of the formulation is less than 10 ml, such as 9 ml, 8 ml, 7 ml, 6 ml, 5 ml, 4 ml, 3 ml, 2 ml, or 1 ml. In one embodiment, a dose of the formulation is less than 1 ml, such as 0.9 ml, 0.8 ml, 0.7 ml, 0.6 ml, 0.5 ml, 0.4 ml, 0.3 ml, 0.2 ml, or 0.1 ml.

[0568] In one embodiment, the injection is administered as a slow injection, for example, over a period of 1.5 minutes to 30 minutes.

[0569] In one embodiment, the formulation is for intravenous (iv) administration. This approach is particularly effective for the delivery of oncolytic viruses because they can quickly enter most organs and tissues and are particularly suitable for the treatment of metastases, such as established metastases, especially those located in highly vascularized areas such as the liver and lungs.

[0570] The therapeutic formulations are generally sterile and stable under the conditions of manufacture and storage. The compositions can be formulated as solutions, microemulsions, liposomes or other parenteral formulations suitable for administration to humans and can be formulated into pre-filled devices such as syringes or vials, particularly as single doses.

[0571] The formulations generally include a pharmaceutically acceptable diluent or carrier, such as a non-toxic and isotonic carrier that is compatible with the virus and in which the virus is stable for a desired period of time.

[0572] The carrier can be a solvent or dispersion medium, and it contains for example water, ethanol, polyol (for example glycerol, propylene glycol and liquid polyethylene glycol etc.) and suitable mixture thereof.For example, by using a dispersant or surfactant, such as lecithin or such as nonionic surfactants such as polysorbate 80 or 40, suitable fluidity can be maintained.In dispersion, the required particle size can be assisted to maintain by the presence of a surfactant.The example of an isotonic agent comprises the sugar in the composition, such as polyols such as mannitol, sorbitol or sodium chloride.

[0573] In one embodiment, the parenteral formulation employed may include, for example, one or more of the following buffers: 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, phosphate buffer and / or Tris buffer, a sugar such as dextrose, mannose, sucrose or the like, a salt such as sodium chloride, magnesium chloride or potassium chloride, a detergent such as a nonionic surfactant such as briji, PS-80, PS-40 or the like. The formulation may also include a preservative such as EDTA or ethanol or a combination of EDTA and ethanol, which is believed to prevent one or more potential degradation pathways.

[0574] In one embodiment, the formulation will include a purified oncolytic virus according to the present disclosure, for example, 1×10 10 to 1×10 14 Virus particles, such as 1×10 per dose 10 to 1×10 12 In one embodiment, the concentration of the virus in the formulation ranges from 2×10 8 vp / mL to 2×10 14 vp / mL, such as 2×10 12 vp / ml.

[0575] In one embodiment, the parenteral formulation includes glycerol.

[0576] In one embodiment, the formulation includes an oncolytic adenovirus as described herein, HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid), glycerol, and a buffer.

[0577] In one embodiment, a parenteral formulation consists of a virus of the disclosure, eg, 5 mM HEPES, eg, 5% to 20% (v / v) glycerol, hydrochloric acid, eg, to adjust the pH to a range of 7 to 8, and water for injection.

[0578] In one embodiment, the concentration is 2×10 12 0.7 mL of the disclosed virus was formulated in 5 mM HEPES, 20% glycerol at a final pH of 7.8 at vp / mL.

[0579] A thorough discussion of pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences (Mack Publishing Company, NJ, 1991).

[0580] In one embodiment, the formulation is provided as a formulation for topical administration involving inhalation.

[0581] Suitable inhalable formulations comprise inhalable powders, metered aerosols containing a propellant gas or inhalable solutions without a propellant gas.Inhalable powders according to the present disclosure typically contain a virus as described herein and a physiologically acceptable excipient.

[0582] These inhalable powders may contain monosaccharides (e.g. glucose or arabinose), disaccharides (e.g. lactose, sucrose, maltose), oligosaccharides and polysaccharides (e.g. dextran), polyols (e.g. sorbitol, mannitol, xylitol), salts (e.g. sodium chloride, calcium carbonate) or mixtures thereof. Suitable monosaccharides or disaccharides are lactose or glucose, in particular but not limited to their hydrated forms.

[0583] Particles for deposition in the lungs need to be less than 10 microns in size, such as 1 to 9 microns, for example 0.1 μm to 5 μm, specifically 1 to 5 μm. The size of the particles carrying the virus is most important, and therefore, in one embodiment, the virus according to the present disclosure can be adsorbed or absorbed onto particles, such as lactose particles of a given size.

[0584] Propellant gases that can be used to prepare inhalable aerosols are known in the art. Suitable propellant gases are selected from hydrocarbons, such as n-propane, n-butane or isobutane, and halogenated hydrocarbons, such as chlorinated and / or fluorinated derivatives of methane, ethane, propane, butane, cyclopropane or cyclobutane. The above-mentioned propellant gases can be used alone or in mixtures thereof.

[0585] Particularly suitable propellant gases are halogenated alkane derivatives selected from TG 11, TG 12, TG 134a and TG 227. Of the above halogenated hydrocarbons, TG 134a (1,1,1,2-tetrafluoroethane) and TG 227 (1,1,1,2,3,3,3-heptafluoropropane) and mixtures thereof are particularly suitable.

[0586] The inhalable aerosol containing the propellant gas may also contain other ingredients such as cosolvents, stabilizers, surfactants, antioxidants, lubricants and means of adjusting pH. All of these ingredients are known in the art.

[0587] The inhalable aerosol according to the invention containing a propellant gas may contain up to 5% by weight of active substance. The aerosol according to the invention may contain, for example, 0.002% to 5% by weight, 0.01% to 3% by weight, 0.015% to 2% by weight, 0.1% to 2% by weight, 0.5% to 2% by weight or 0.5% to 1% by weight of active ingredient.

[0588] Alternatively, local administration to the lungs can also be by administering a liquid solution or suspension formulation, for example, using a device such as a nebulizer, for example, a nebulizer connected to a compressor (e.g., the Pari LC-Jet Plus(R) nebulizer connected to a Pari Master(R) compressor manufactured by Pari Respiratory Equipment, Inc. of Richmond, Virginia).

[0589] Virus of the present invention can be dispersed in a solvent and sent, for example, with the form of solution or suspension, for example, as described above for parenteral preparation.It can be suspended in a suitable physiological solution, for example, acceptable solvent or buffer solution on saline or other pharmacological lines.Buffer solution known in the art can contain 0.05mg to 0.15mg of disodium edetate, 8.0mg to 9.0mg sodium chloride, 0.15mg to 0.25mg polysorbate, 0.25mg to 0.30mg anhydrous citric acid and 0.45mg to 0.55mg sodium citrate / 1ml water, to reach a pH of approximately 4.0 to 5.0.

[0590] Therapeutic suspensions or solution formulations can also contain one or more excipients. Excipients are well known in the art and include buffers (e.g., citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer), amino acids, urea, alcohol, ascorbic acid, phospholipids, proteins (e.g., serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, and glycerol. Solutions or suspensions can be encapsulated in liposomes or biodegradable microspheres. Preparations are typically provided in a substantially sterile form using aseptic manufacturing methods.

[0591] This may involve the production and sterilization of buffer solvents / solutions for formulation by filtration, the sterile suspension of the antibody in the sterile buffer solvent solution, and dispensing the formulation into sterile containers by methods familiar to those of ordinary skill in the art.

[0592] The aerosolizable formulations according to the present disclosure can be provided, for example, as single-dose units packaged in foil envelopes (e.g., sealed plastic containers or vials). Each vial contains a unit dose in a volume, for example, 2 mL of solvent / solution buffer.

[0593] treat

[0594] In further aspects, the disclosure relates to a virus or formulation thereof as described herein for use in therapy, in particular for the treatment of cancer.

[0595] In one embodiment, the therapeutic method is used to treat tumors, particularly solid tumors.

[0596] As used herein, a tumor refers to an abnormal mass of tissue caused by excessive cell division, which is uncontrolled and progressive, also known as a tumor. Tumors can be benign (non-cancerous) or malignant. Tumors encompass all forms of cancer and metastasis.

[0597] In one embodiment, the tumor is a solid tumor. Solid tumors can be localized or metastatic.

[0598] In one embodiment, the tumor is of epithelial origin.

[0599] In one embodiment, the tumor is a malignant tumor, such as colorectal cancer, liver cancer, prostate cancer, pancreatic cancer, breast cancer, ovarian cancer, thyroid cancer, kidney cancer, bladder cancer, head and neck cancer, or lung cancer.

[0600] In one embodiment, the tumor is a colorectal malignancy.

[0601] As used herein, malignancy refers to cancerous cells.

[0602] In one embodiment, an oncolytic adenovirus is used to treat or prevent metastasis.

[0603] In one embodiment, the methods or formulations herein are used to treat drug-resistant cancers.

[0604] In one embodiment, the virus is administered in combination with administration of a further cancer treatment or therapy.

[0605] In one embodiment, provided are viruses or formulations according to the present disclosure for the manufacture of a medicament for treating cancer, such as the cancers described above.

[0606] In a further aspect, provided is a method of treating cancer comprising administering a therapeutically effective amount of a virus or formulation according to the disclosure to a patient in need thereof, such as a human patient.

[0607] In one embodiment, the oncolytic viruses or formulations herein are administered in combination with another therapy.

[0608] As used herein, "in combination" is intended to encompass where the oncolytic virus is administered prior to, concurrently with, and / or after a cancer treatment or therapy.

[0609] Cancer treatments include surgery, radiation therapy, targeted therapy, and / or chemotherapy.

[0610] As used herein, cancer treatment refers to treatment with a therapeutic compound or biologic, such as an antibody intended for the treatment of cancer and / or its maintenance therapy.

[0611] In one embodiment, the cancer treatment is selected from any other anti-cancer therapy, including chemotherapeutic agents, targeted anti-cancer agents, radiation therapy, radioisotope therapy, or any combination thereof.

[0612] In one embodiment, viruses such as oncolytic adenoviruses of the present disclosure can be used as a pre-treatment for a therapy such as surgery (neoadjuvant therapy) to shrink the tumor, treat metastasis, and / or prevent metastasis or further metastasis. Oncolytic adenoviruses can be used after a therapy such as surgery (adjuvant therapy) to treat metastasis and / or prevent metastasis or further metastasis.

[0613] As used herein, concurrently is administration of the additional cancer therapy at the same time or about the same time as the oncolytic adenoviral formulation. The treatments can be contained in the same formulation or administered as separate formulations.

[0614] In one embodiment, the virus is administered in combination with administration of a chemotherapeutic agent.

[0615] As used herein, a chemotherapeutic agent refers to a specific anti-tumor chemical agent or a drug that selectively destroys malignant cells and tissues. For example, alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, and other anti-tumor agents. Other examples of chemotherapy include doxorubicin, 5-fluorouracil (5-FU), paclitaxel, capecitabine, irinotecan, and platinums such as cisplatin and oxaliplatin. The preferred dosage can be selected by the physician based on the nature of the cancer being treated.

[0616] In one embodiment, the therapeutic agent is ganciclovir, which can help control the immune response and / or tumor angiogenesis.

[0617] In one embodiment, one or more of the therapies employed in the methods herein is metronomic therapy, which is continuous or frequent treatment with low doses of an anticancer drug, often accompanied by other therapeutic approaches.

[0618] Subgroup B oncolytic adenoviruses, specifically Ad11 and its derivatives such as EnAd, may be particularly synergistic with chemotherapeutic agents because they appear to have a mechanism of action that is largely independent of apoptosis, killing cancer cells through a primarily necrotic mechanism. Furthermore, the immunosuppression that occurs during chemotherapy may allow oncolytic viruses to act more effectively.

[0619] As used herein, a therapeutic dose refers to an amount of a virus such as an oncolytic adenovirus that is suitable for achieving the desired therapeutic effect when employed in an appropriate treatment regimen, such as improving symptoms or conditions of the disease. A dose can be considered a therapeutic dose for treating cancer or metastasis when the number of viral particles is sufficient to result in: a slowing or cessation of tumor or metastatic growth, or a reduction in the size of the tumor or metastasis and / or an extension of the patient's lifespan. An appropriate therapeutic dose is typically a balance between therapeutic effect and tolerable toxicity, e.g., side effects and toxicity are tolerable given the benefits obtained from the treatment.

[0620] In one embodiment, a virus or therapeutic construct according to the disclosure (including formulations consisting thereof) is administered weekly, for example, one dose per week on day 1, day 3, day 5, and then one dose each subsequent week.

[0621] In one embodiment, a virus or therapeutic construct according to the present disclosure (including formulations consisting thereof) is administered every two or three weeks, for example, on days 1, 3, and 5 of week 1, and also on days 1, 3, and 5 of week 2 or week 3. This dosing regimen can be repeated multiple times as appropriate.

[0622] In one embodiment, a virus or therapeutic construct according to the disclosure (including formulations consisting thereof) is administered monthly.

[0623] In one embodiment, the viruses and constructs of the present disclosure are prepared by recombinant techniques. The skilled artisan will appreciate that plasmids carrying adenoviral genomes can be made by other techniques, including completely synthetic genomes or plasmids comprising a portion of all genomes. The skilled artisan will appreciate that in the case of synthetic genomes, the insertion region may not include restriction site nucleotides, as the latter are an artifact of the gene insertion process using cloning methods.

[0624] In one embodiment, the carrier adenoviral genome is completely synthetically produced, for example according to SEQ ID NOs: 34 to 37.

[0625] The present disclosure further extends to an adenovirus of formula (I) or subformulae thereof obtained or obtainable by insertion of a transgene or transgene cassette.

[0626] As used herein, "is" means including.

[0627] In the context of this specification, "comprising" should be interpreted as "including".

[0628] Embodiments of the present invention that include certain features / elements are also intended to extend to alternative embodiments that "consist of" or "consist essentially of" the relevant elements / features.

[0629] The embodiments of the present invention may be combined where technically appropriate.

[0630] Technical references such as patents and applications are incorporated herein by reference.

[0631] Any embodiment specifically and explicitly described herein may form the basis of a disclaimer either alone or in combination with one or more further embodiments.

[0632] This application claims priority to GB1614607.8, GB1700663.6, GB1706219.1 and GB1713765.4, which are incorporated herein by reference. These documents may be used to correct errors in this specification, in particular errors in the sequence listing.

[0633] The invention is further described by way of the following examples only, with reference to the accompanying drawings, in which: BRIEF DESCRIPTION OF THE DRAWINGS

[0634] FIG1(A) is a schematic diagram of a bispecific T cell engager antibody according to the present disclosure including or lacking an optional decahistidine affinity tag. Ig SP: signal peptide; 10His: decahistidine affinity tag; L: GS linker; V L : variable light domain; V H Variable heavy domain. (B) Plasmid map of the pSF-CMV-EpCAM bispecific T cell engager. (C) Plasmid map of the pSF-CMV-FAP bispecific T cell engager. (D) Plasmid map of the pSF-CMV-control bispecific T cell engager.

[0635] Figure 2 (A) Dot blot showing quantification of recombinant bispecific T cell engagers. (B) Graph showing ELISA results for FAP. (C) Graph showing ELISA results for EpCAM.

[0636] FIG3 shows a graph showing the expression levels of CD69 (A) and CD25 (B) on T cells alone or co-cultured with NHDF cells in the presence of a FAP bispecific T cell engager and a control bispecific T cell engager, measured using flow cytometry.

[0637] Figure 4 (A) shows a graph of IFNγ expression levels of T cells co-cultured with NHDF cells in the presence of FAP bispecific T cell adapters and control bispecific T cell adapters measured by intracellular cytokine staining. Figures (B) and (C) show the expression levels of CD69 and CD25 of T cells co-cultured with DLD cells in the presence of EpCAM bispecific T cell adapters, and control bispecific T cell adapters were measured using flow cytometry.

[0638] Figure 5 (A) shows a graph of IFNγ expression levels of T cells co-cultured with DLD cells in the presence of EpCAM bispecific T cell engagers and a control bispecific T cell engager measured by intracellular cytokine staining. Figures (B) and (C) show the levels of CD69 and CD25 of PBMCs co-cultured with DLD cells in the presence of EpCAM bispecific T cell engagers, and the control bispecific T cell engager was measured using flow cytometry.

[0639] Figure 6 (A) Graph showing the results of an LDH assay of the cytotoxicity of NHDF cells co-cultured with T cells and a FAP bispecific T cell engager or a control bispecific T cell engager. (B) Graph showing the results of an LDH assay of the cytotoxicity of BTC100 cells co-cultured with T cells and a FAP bispecific T cell engager or a control bispecific T cell engager. (C) Graph of NHDF cells co-cultured with T cells and a FAP bispecific T cell engager and a control bispecific T cell engager.

[0640] Figure 7 (A) shows a scatter plot of FAP expression in multiple patient-derived cells. (B) shows a graph showing the percentage of cells expressing EpCAM and FAP across multiple cells and cell lines.

[0641] Figure 8 (A) shows a graph of the NHDF dose response of the FAP bispecific T cell engager as the concentration of the bispecific T cell engager increases. Figures (B) and (C) show the results of an LDH assay showing the cytotoxicity of DLD cells co-cultured with T cells and EpCAM bispecific T cell engagers or a control bispecific T cell engager.

[0642] Figure 9 (A) shows a graph showing the results of an LDH assay of the cytotoxicity of SKOV cells co-cultured with T cells and an EpCAM bispecific T cell engager or a control bispecific T cell engager. (B) shows a graph showing the results of an LDH assay of the cytotoxicity of MCF7 cells co-cultured with T cells and an EpCAM bispecific T cell engager or a control bispecific T cell engager.

[0643] Figure 10 Shown is a graph showing the NHDF dose response of the EpCAM bispecific T cell engager with increasing concentrations of the bispecific T cell engager.

[0644] Figure 11 (A) shows a graph of FAP expression in CHO cells as determined by FAP or isotope control antibodies and analyzed by flow cytometry. (B) shows a graph showing the results of an LDH assay of the cytotoxicity of CHO or CHO-FAP cells co-cultured with T cells and a FAP bispecific T cell engager or a control bispecific T cell engager.

[0645] Figure 12 Shown is a graph analyzing T cell activation (based on CD69 and CD25 expression levels) of CHO vs. CHO-FAP cells using flow cytometry.

[0646] Figure 13 (A) shows a graph of EpCAM expression of parental cell lines versus stably transfected variants as determined by staining with EpCAM or isotope control antibodies and analyzed using flow cytometry. (B) shows a graph showing the results of an LDH assay of the cytotoxicity of CHO or CHO-EpCAM cells co-cultured with T cells and an EpCAM bispecific T cell engager or a control bispecific T cell engager.

[0647] Figure 14 Shown is a graph analyzing T cell activation (based on CD69 and CD25 expression levels) of CHO vs. CHO-EpCAM cells using flow cytometry.

[0648] Figure 15 (A) Graph showing the ability of FAP bispecific T cell engagers to activate CD4+ or CD8+ T cells (based on CD69 and CD25 expression levels) analyzed using flow cytometry. (B) Graph showing the results of an LDH assay of the cytotoxicity of NHDF cells co-cultured with CD4+ or CD8+ T cells and FAP bispecific T cell engagers or a control bispecific T cell engager.

[0649] Figure 16 (A) Graph showing CD4+ and CD8+ T cell activation (based on CD69 and CD25 expression levels) by DLD cells in the presence of EpCAM or a control bispecific T cell engager using flow cytometry analysis. (B) Graph showing the results of an LDH assay demonstrating the cytotoxicity of DLD cells co-cultured with CD4+ or CD8+ T cells and an EpCAM bispecific T cell engager or a control bispecific T cell engager.

[0650] Figure 17(A) Graph showing the number of CD3+ T cells in ascites cultured with a control or FAP bispecific T cell engager. (B) Graph showing the CD25 expression levels of T cells in ascites cultured with a control or FAP bispecific T cell engager. (C) Graph showing the number of FAP+ cells in ascites cultured with a control or FAP bispecific T cell engager.

[0651] Figure 18 (A) Schematic representation of the genome of the adenovirus of the present disclosure. (B) Graph comparing the kinetics of expression driven by CMV vs. SA promoters.

[0652] Figure 19 (A) Graph showing quantification of the number of viral genomes detected per cell for NG-601, NG-602, NG-603, NG-604, NG-605, NG-606, and EnAd. (B) Graph showing the oncolytic activity of NG-601, NG-602, NG-603, NG-604, NG-605, NG-606, or EnAd assessed by infection of A549 cells.

[0653] Figure 20 (A) shows a graph of T cell activation (based on CD69 and CD25 expression levels) when co-cultured with CHO-FAP by NG-601, NG-602, NG-605, and NG-606 using flow cytometry analysis. (B) shows a graph of T cell activation (based on CD69 and CD25 expression levels) when co-cultured with CHO-EpCAM by NG-601, NG-602, NG-605, and NG-606 using flow cytometry analysis.

[0654] Figure 21 Shown are graphs showing the results of experiments determining the amount of FAP bispecific T cell engagers produced from NG-605 and NG-606.

[0655] Figure 22 Shown are graphs showing the results of experiments determining the amount of EpCAM bispecific T cell engagers produced from NG-601 and NG-602.

[0656] Figure 23 Shown are microscopic images of Ad293 cells infected with NG-607, NG-608, NG-609, and NG-610.

[0657] Figure 24(A) Graph showing the cytotoxicity of DLD cells infected with EnAd, analyzed using XCELLigence. (B) Graph showing the cytotoxicity of SKOV cells infected with EnAd, analyzed using XCELLigence. (C) Graph showing the cytotoxicity of NHDF cells infected with EnAd, analyzed using XCELLigence.

[0658] Figure 25 (A) is a graph showing the ability of NG-603, NG-604, NG-605, NG-606, and EnAd to kill NHDF cells as analyzed using XCELLigence. (B) is a graph showing the ability of NG-603, NG-604, NG-605, NG-606, and EnAd to kill NHDF cells as analyzed using the LDH assay.

[0659] Figure 26 Shown are graphs showing T cell activation (based on CD69 and CD25 expression levels) by NG-603, NG-604, NG-605, NG-606 co-cultured with NHDF cells, SKOV and T cells using flow cytometry analysis.

[0660] Figure 27 (A) Graph showing T cell activation (based on CD69 and CD25 expression levels) by NG-603, NG-604, NG-605, and NG-606 in co-culture with NHDF and multiple SKOV cells against a single SKOV cell using flow cytometry analysis. (B) Graph showing the cytotoxicity of NHDF cells infected with NG-605 and NG-606 using LDH assay analysis.

[0661] Figure 28 Shown are still frame images from timelapse videos of NHDF cell lysis by recombinant FAP bispecific T cell engager, EnAd, NG-603, or NG-605.

[0662] Figure 29 Shown are still frame images from timelapse videos of NHDF cell lysis by NG-607, NG-608, NG-609, or NG-610.

[0663] Figure 30 Shown are graphs indicating the cytotoxicity of DLD cells infected with EnAd, NG-601, NG-602, NG-603, and NG-604 in the presence or absence of T cells as analyzed using XCELLigence.

[0664] Figure 31Shown are graphs indicating the cytotoxicity of DLD cells infected with EnAd, NG-601, NG-602, NG-603, and NG-604 in the presence or absence of T cells, analyzed using the LDH assay.

[0665] Figure 32 Shown are graphs showing T cell activation (based on CD69 and CD25 expression levels) by EnAd, NG-601, NG-602, NG-603, and NG-604 using flow cytometry analysis.

[0666] Figure 33 The use of xCELLigence to assess the presence or absence of CD3 + Results from experiments determining the ability of NG-601 to kill DLD tumor cells at different multiplicities of infection (MOI) using T cells.

[0667] Figure 34 Instructions for using xCELLigence to assess the presence or absence of CD3 + Figure 3 shows the ability of EnAd and NG-601, NG-602, NG-603, and NG-604 to kill SKOV tumor cells using T cells.

[0668] Figure 35 Instructions are shown for using the LDH assay to assess the presence or absence of CD3 + Figure 3 shows the ability of EnAd and NG-601, NG-602, NG-603, and NG-604 to kill SKOV tumor cells using T cells.

[0669] Figure 36 Shown are graphs showing T cell activation (based on CD69 and CD25 expression levels) by EnAd, NG-601, NG-602, NG-603, and NG-604 co-cultured with SKOV tumor cells using flow cytometry analysis.

[0670] Figure 37 Shown are graphs showing T cell activation (based on CD69 and CD25 expression levels) by EnAd, NG-601, NG-602, NG-603, and NG-604 co-cultured with ascites cells using flow cytometry analysis.

[0671] Figure 38 Shown are still frame images from timelapse videos of NHDF cell lysis by EpCAM bispecific T cell engager, EnAd, NG-601, or NG-603.

[0672] Figure 39Shown are microscopic images of ascitic cells obtained from patients, infected with the viruses of the present disclosure and stained with EnAd-CMV-GFP and EnAd-SA-GFP as reporter genes to determine infection and late viral gene expression.

[0673] Figure 40 (A) Graph indicating the expression level of CD25 on CD3+ T cells in ascites samples infected with the viruses of the present disclosure. (B) Graph indicating the number of FAP+ cells in ascites samples infected with the viruses of the present disclosure.

[0674] Figure 41 Shown are microscopic images of ascites cells obtained from cancer patients, which were infected with the viruses of the present disclosure and stained with EnAd-CMV-GFP and EnAd-SA-GFP as reporter genes to determine infection and late viral gene expression.

[0675] Figure 42 Shown are graphs indicating the number of CD3+ T cells in ascites samples obtained from cancer patients and infected with the viruses of the present disclosure.

[0676] Figure 43 Shown are graphs indicating the expression levels of CD25 on CD3+ T cells in ascites samples obtained from cancer patients and infected with the viruses of the present disclosure.

[0677] Figure 44 Shown are graphs indicating the number of FAP+ cells in ascites samples obtained from cancer patients and infected with the viruses of the present disclosure.

[0678] Figure 45 Characterization of EpCAM bispecific T cell engagers and their effects on PBMC-derived T cells

[0679] (A) Schematic diagram of the structures of the EpCAM-targeting bispecific T cell engager and a nonspecific control bispecific T cell engager. The VL and VH domains are linked to a flexible peptide linker (L) rich in serine and glycine for flexibility and solubility. Ig SP, light chain immunoglobulin signal peptide; 10His, decahistidine affinity tag. (B) Induction of activation markers CD69 and (C) CD25 on CD3-purified PBMCs cultured alone or with DLD cells (5:1) in the presence of supernatant containing the bispecific T cell engager. CD69 and CD25 were measured by flow cytometry after 24 hours of coculture. Significance was assessed for IgG isotypes. (D) Percentage of IFNγ-positive T cells after 6 hours of coculture with DLD cells (5:1) and supernatant containing the bispecific T cell engager. (E) The fractional index of the T cells co-cultured with DLD cells (5: 1) and the supernatant containing bispecific T cell adapters and the proliferation represented by the percentage of the parental T cell group entering the proliferation. Fluorescence was measured by flow cytometry 5 days after co-cultivation. The fractional index was modeled using FlowJo proliferation tools. (F) T cell degranulation measured by CD107a externalization was co-cultivated with DLD cells (5: 1) and the supernatant containing bispecific T cell adapters. Externalization was assessed by co-cultivation with CD107a specific antibodies for 6 hours, and then flow cytometry analysis was performed. (G) In the presence of supernatant containing bispecific T cell adapters, supernatant from the co-culture of T cells and DLD cells (5: 1) was used to measure cytokine levels 48 hours by the LEGENDplex human Th cytokine panel. Each condition was measured in biological triplicate, and the data are expressed as mean ± SD. Unless otherwise stated, significance was assessed using one-way ANOVA test with Tukey's Post Hoc analysis for the significance of treatment versus no treatment. * p<0.05, ** p<0.01, *** p<0.001.

[0680] Figure 46 Characterization of recombinant EpCAM bispecific T cell engagers

[0681] (A) Dot blot to estimate the amount of EpCAM bispecific T cell engager produced by transfected HEK293A cells. (B) ELISA to measure EpCAM binding levels by control or recombinant EpCAM or nonspecific bispecific T cell engager. Significance was assessed by one-way ANOVA test using Tukey's post hoc analysis compared to empty vector control samples. *** p<0.001

[0682] Figure 47 Antigen-specific assessment of T cell cytotoxicity mediated by EpCAM bispecific T cell engagers

[0683] (A) Induction of activation marker CD25 on CD3+ T cells co-cultured with CHO or CHO-EpCAM cells (5:1) and supernatant containing bispecific T cell adapters, measured by FACS analysis after 24 hours of co-culture. (B) Cytotoxicity of CHO or CHO-EpCAM cells cultured with supernatant containing bispecific T cell adapters alone or co-cultured with T cells. Cytotoxicity was assessed by releasing LDH into the culture supernatant after 24 hours of incubation. (C) Cytotoxicity of various EpCAM-positive cancer cells after 24 hours of co-culture with T cells (1:5) and supernatant containing bispecific T cell adapters. Viability was measured by MTS assay after 24 hours of co-culture. (D) EpCAM expression levels assessed by FACS analysis of EpCAM-positive cell lines in (C) compared to background fluorescence measured by using isotype control antibodies (N=1). (AC) Each condition was measured in biological triplicate and is expressed as mean ± SD. Significance was assessed against untreated or T cell-only controls using a one-way ANOVA test with Tukey's Post Hoc analysis. * p<0.05, ** p<0.01, *** p<0.001.

[0684] Figure 48 Cytotoxicity of EnAd-expressing EpCAM bispecific T cell engager in SKOV3 cells

[0685] SKOV3 cells were incubated with EnAd or recombinant virus in the absence (A) or presence (B) of T cells, and cytotoxicity was measured by LDH release at the indicated time points. Significance was assessed by one-way ANOVA test using Tukey's post hoc analysis compared to uninfected control wells. *** p<0.001

[0686] Figure 49 Identifying which T cells are responsible for bispecific T cell engager-mediated cytotoxicity

[0687] (A) T cell activation of CD4 and CD8 cells mediated by bispecific T cell adapter 24 hours after CD3 T cells were co-cultured with DLD cells (5: 1) and supernatant containing bispecific T cell adapter. Activation was assessed by surface expression of CD69 and CD25 and measured by flow cytometry. (B) Proliferation response of CD4 and CD8 T cells stained with CFSE and co-cultured with DLD cells and incubated with supernatant containing bispecific T cell adapter. After incubation for 5 days, fluorescence was measured by FACS analysis. (C) Degranulation of CD4 and CD8 cells after 6 hours of co-culture with DLD cells and supernatant containing bispecific T cell adapter. CD107a-specific antibody was added to the culture medium during co-culture, and degranulation was assessed by flow cytometry. (D) Cytotoxicity of CD4 or CD8 T cell subsets was assessed by LDH release into the supernatant after incubation of DLD cells with CD4 or CD8 purified T cells (1:5) and supernatant containing bispecific T cell engagers for 24 h. Each condition was measured in biological triplicate and expressed as mean ± SD. Unless otherwise stated, EpCAM bispecific T cell engager treatment was compared to control bispecific T cell engager and significance was assessed using a one-way ANOVA test with Tukey's Post Hoc analysis. * p<0.05, ** p<0.01, *** p<0.001.

[0688] Figure 50 Cytotoxicity and T cell activation via EnAd-expressing EpCAM bispecific T cell engager in DLD cells

[0689] Figure 2 shows cytotoxicity of DLD cells infected in the absence (A) or presence of T cells (B). DLD cells were infected and co-cultured with T cells, and cytotoxicity was measured by LDH release at specific time points. (CD) T cells from (B) were collected and stained for activation markers CD69 (C) or CD25 (D) and analyzed by flow cytometry. (EF) Quantification of EpCAM bispecific T cell adapters produced from DLD cells infected with recombinant viruses. DLD releases LDH standard curve (Ab) in co-culture with CD3+ cells and different known amounts of recombinant EpCAM bispecific T cell adapters (E). In parallel, the co-cultures were incubated with diluted supernatants (10,000 times) from 3-day infected DLD cells (F). For EnAd-CMV-EpCAM bispecific T cell adapters and EnAd-SA-EpCAM bispecific T cell adapters, the standard curves allowed the approximate determination of EpCAM bispecific T cell adapters produced in 165 μg and 50 μg / million DLD cells, respectively. Significance was assessed by one-way ANOVA test using Tukey's Post Hoc analysis compared to uninfected control wells. *** p<0.001

[0690] Figure 51 Characterization of the oncolytic virus EnAd expressing the EpCAM bispecific T cell engager using cell lines and PBMC-derived T cells

[0691] (A) DLD cells were infected with parental EnAd or recombinant virus (100 vp / cell) and wells were collected at 24 or 72 hours. Replication was assessed by measuring genome using qPCR for viral hexon. (B) Cytotoxicity of DLD cells infected with EnAd or recombinant virus was assessed with the increase in viral concentration. Cytotoxicity was measured by MTS assay after 5 days of infection. (C) Transgenic expression of supernatants from HEK293A cells that were not infected or infected with the virus on the 3rd day was assessed by immunoblotting analysis and probed with anti-His antibodies. (D) Induction of activation marker CD25 from CD3 positive T cells cultured with CHO or CHO-EpCAM (E:T 5:1) and diluted HEK293A supernatants from (D). Activation was measured by flow cytometry through the surface expression of CD25. (E) Cytotoxicity of CHO or CHO-EpCAM cells incubated with HEK293A supernatant from (D) or co-cultured with CD3-purified PBMC (E:T 5:1). HEK293A supernatant was diluted 300-fold. Cytotoxicity was assessed by LDH released into the supernatant after 24 hours of incubation. Each condition was measured in biological triplicate and expressed as mean ± SD. Each condition was compared to the untreated condition and significance was assessed using a one-way ANOVA test with Tukey's post hoc analysis. * p<0.05, ** p<0.01, *** p<0.001.

[0692] Figure 52 Cellular composition of malignant exudates

[0693] (A) Representative images (pleural effusion samples from Figure 57 (B) Absolute numbers of each cell type are reported in the table (10,000 cells per sample).

[0694] Figure 53 Superior efficacy of EnAd expressing the EpCAM bispecific T cell engager in some EnAd-resistant cancer cell lines

[0695] (AB) Real-time monitoring of SKOV3 cell viability over 160 hours using an xCELLigence-based cytotoxicity assay. SKOV3 cells were seeded and infected with EnAd or EnAd virus carried by a bispecific T cell engager at 0 hours; uninfected cells served as a negative control. In (B), CD3-purified PBMCs were added 2 hours post-infection (5:1 ratio), and impedance was measured at 15-minute intervals. (CD) CD3-purified PBMCs were co-cultured with SKOV3 cells infected with parental EnAd or recombinant carrier virus (5:1 ratio). At each time point, T cells were harvested and analyzed by flow cytometry for surface expression of CD69 (C) or CD25 (D). (E) Time-lapse sequence showing co-cultures of SKOV3 cancer cells (unstained), NHDF fibroblasts (red), and CD3-purified PBMCs (blue) infected with EnAd, the EnAd-CMVEpCAM bispecific T cell engager, or uninfected. Apoptosis was visualized using the CellEvent Caspase 3 / 7 detection reagent (green). Images were taken at 15-minute intervals for 96 hours on a Nikon TE 2000-E Eclipse inverted microscope. Representative images were recorded at the times shown; original magnification ×10; scale bar 100 μm. (AD) Each condition was measured in biological triplicate and expressed as mean ± SD. Significance was assessed by one-way ANOVA test using Tukey's post hoc analysis compared to uninfected controls. * p<0.05, ** p<0.01, *** p<0.001.

[0696] Figure 54 Effects of PD1 expression and PD1 antibodies on T cell activation mediated by bispecific T cell engagers

[0697] (A) PD1 expression by endogenous T cells after initial isolation of pleural effusions was assessed by flow cytometry. (BD) Unpurified total cells from pleural effusions (from three different patients) were incubated in 100% fluid from the same pleural effusions in the presence of free bispecific T cell engagers, EnAd, or recombinant viruses. After 5 days, total cell populations were harvested and (B) the number of CD3+ T cells and (C) the number of CD25+ cells were quantified. (D) The number of EpCAM+ cells was measured using flow cytometry. Significance was assessed by comparison with untreated control wells using a one-way ANOVA test with Tukey's Post Hoc analysis. *** p<0.001

[0698] Figure 55EnAd expressing the EpCAM bispecific T cell engager selectively kills primary human tumor cells from chemotherapy-pretreated patients

[0699] (A) Cytotoxicity of EpCAM+ cells or (B) FAP+ fibroblasts, first isolated from ascites of three patients and expanded ex vivo, then incubated with recombinant bispecific T cell adapters or infected with EnAd or recombinant viruses. Cytotoxicity was measured by flow cytometry after 5 days. (C) Induction of the activation marker CD25 on CD3-positive T cells cultured with ascites-derived EpCAM+ and FAP+ cells from (A+B). Each condition was measured in biological triplicate and expressed as mean ± SD. Significance was assessed by one-way ANOVA test using Tukey's Post Hoc analysis compared to untreated patients, *p < 0.05, **p < 0.01, ***p < 0.001.

[0700] Figure 56 EpCAM bispecific T cell engager can overcome the immunosuppressive effects of ascites fluid and activate endogenous T cells

[0701] (AB) PBMC-derived T cells were incubated with anti-CD3 antibodies in RPMI medium or in the presence of 100% peritoneal ascites fluid from five ovarian cancer patients. (A) Induction of T cell activation markers CD69 and CD25 was analyzed at 24 hours, and (B) T cell degranulation was measured by CD107a externalization using flow cytometry. (C) Viability of MCF7 cells was monitored in real time over 60 hours by xCELLigence-based cytotoxicity assay. MCF7 cells were seeded and incubated with control or EpCAM bispecific T cell adapters in the presence of RPMI medium or 100% ascites fluid #1 or #2 for 25 hours. Untreated cells were used as negative controls. CD3-purified PBMCs were added simultaneously (5:1) and impedance was measured at 15-minute intervals. (D) Endogenous unpurified total cells from peritoneal ascites were incubated in 100% ascites fluid in the presence of free EpCAM or control bispecific T cell adapters. After 24 hours, the total cell population was harvested and the number of CD3+ / CD69+ and CD3+ / CD25+ cells was measured by flow cytometry. Each condition was measured in biological triplicate and expressed as mean ± SD. Significance was assessed by one-way ANOVA test using Tukey's Post Hoc analysis compared to RPMI (A+B), untreated (D), or control bispecific T cell engager (E). * p<0.05, ** p<0.01, *** p<0.001.

[0702] Figure 57 EnAd expressing the EpCAM bispecific T cell engager can activate endogenous T cells to kill endogenous tumor cells in malignant pleural effusions

[0703] Unpurified total cells from pleural effusions (from four different patients) were incubated in 100% fluid from the same pleural effusion in the presence of free bispecific T cell adapters, EnAd, or recombinant viruses. After 5 days, the total cell population was collected and (A) the number of CD3+ T cells and (B) the number of CD25+ cells were quantified. (C) The number of EpCAM+ cells was measured using flow cytometry. (D) Representative images (magnification × 10; scale bar 100 μm) and flow cytometric analysis of pleural effusion cells of patient 3 (cancer cells and lymphocytes) after treatment with EnAd or EnAd-CMVEpCAM bispecific T cell adapters. (E) On day 5, cytokine levels were measured using the LEGENDplex human Th cytokine panel using pleural effusion cultures after incubation with free recombinant bispecific T cell adapters or infection with EnAd or recombinant viruses. Each condition was measured in biological triplicate and expressed as mean ± SD. Significance was assessed by one-way ANOVA test using Tukey's Post Hoc analysis of control samples compared to untreated control samples, *p<0.05, **p<0.01, ***p<0.001.

[0704] Figure 58 Shown are the amounts of IL-10 measured in normal serum (NS) or patient malignant effusions (A: peritoneal ascites, P: pleural effusion) using a human IL-10 ELISA MAX kit (Biolegend, 430604).

[0705] Figure 59 Shown is CD3 / 28 bead-mediated PBMC T cell activation (based on CD69 / CD25 levels) in patient fluids compared to normal serum as measured by flow cytometry. A: patient exudate, P: pleural effusion.

[0706] Figure 60 CD3 / 28 bead-mediated PBMC T cell degranulation (based on CD107a expression) in patient body fluids is shown. A: ascites, P: pleural effusion.

[0707] Figure 61 Shown is the correlation between IL-10 levels in patient fluids and CD3 / CD28 bead-mediated T cell degranulation.

[0708] Figure 62EpCAM bispecific T cell engager bead-mediated PBMC T cell activation (based on CD69 / CD25 expression) in patient body fluids is shown. A: ascites, P: pleural effusion.

[0709] Figure 63 EpCAM bispecific T cell engager bead-mediated PBMC T cell degranulation (based on CD107a expression) in patient body fluids is shown. A: ascites, P: pleural effusion.

[0710] Figure 64 Figure 2 shows the cytotoxicity of SKOV3 mediated by EpCAM bispecific T cell engager beads in patient body fluids. A: ascites, P: pleural effusion.

[0711] Figure 65 Shown is the relationship between EpCAM bispecific T cell engager-mediated T cell activation (based on CD25 / CD69 expression) in RPMI medium and ascites fluid.

[0712] FIG66 shows the relationship between T cell-mediated target cell lysis induced by EnAd-SA-EpCAM bispecific T cell engager and EnAd-SA-control bispecific T cell engager in RPMI medium and ascites fluid. (A) Number of CD3+ cells. (B) CD25 expression on T cells. (C) Number of EpCAM+ cells determined by flow cytometry.

[0713] FIG67 shows the ability of the EnAd-SA-EpCAM bispecific T cell engager and the EnAd-SA-control bispecific T cell engager to induce T cell-mediated target cell lysis in ascites fluid (7 patient samples).

[0714] (A) Number of CD3+ cells. (B) CD25 expression on T cells. (C) Number of EpCAM+ cells determined by flow cytometry. Figure 67A .

[0715] Figure 68 Comparison of cytokine production by T cells activated with recombinant FAP bispecific T cell engager protein in the presence of human fibroblasts and polyclonal activation with anti-CD3 / CD28 beads is shown. (A) IFNγ levels measured by ELISA. (B) Cytokine levels measured by cytokine bead array.

[0716] Figure 69FAP targeting bispecific T cell adapter induces T cell degranulation and specific cytotoxicity of FAP+ cells (A) T cells in culture are degranulated with NHDF cells (5: 1) and (B) supernatants containing bispecific T cell adapters. Degranulation is assessed by externalization of CD107a after 6 hours of culture with CD107a specific antibodies and measured by flow cytometry. CD3 / CD28 magnetic beads are used as positive controls. (C) Cytotoxicity of NHDF cells after 24 hours of co-culture with T cells (1: 5) and 10 times serial dilutions of supernatants containing bispecific T cell adapters. Cytotoxicity is assessed by releasing LDH into the culture supernatant. (D) After 24 hours of co-culture with PBMC-derived T cells (1: 5) from six healthy donors and supernatants containing bispecific T cell adapters, LDH release (left) and CD25 induction (right) on T cells are assessed for dissolution of NHDF.

[0717] Figure 70 EnAd expressing a FAP bispecific T cell engager selectively kills FAP + fibroblasts and decreased TGFb in peritoneal ascites samples

[0718] (A, B) FAP after 72 h of culture of PBMC-derived T cells with EnAd or recombinant virus + Fibroblasts (A) and EpCAM + The number of tumor cells (B). First, ascites cells were isolated from three patients' ascites and expanded in vitro. Cell number was measured by flow cytometry 72 hours after infection. (C) Induction of the activation marker CD25 on CD3 cells derived from PBMCs in (A) was measured 72 hours after infection. (D) The level of TGFb was measured by ELISA using the supernatant collected from (A).

[0719] Figure 71 Activation of endogenous tumor-associated T cells and associated FAP+ cell killing in patient malignant ascites biopsies by the FAP bispecific T cell engager protein and EnAd-FAP bispecific T cell engager virus are shown. (A) T cell activation measured by CD25 expression. (B) Residual number of FAP+ cells measured by flow cytometry.

[0720] Figure 72 Effects of PD-L1 blocking antibodies on bispecific T cell engager-mediated T cell activation in patient samples

[0721] (A) Endogenous T cell and PD-L1 expression on FAP+ cells after initial isolation from peritoneal ascites was assessed by flow cytometry. (B) Unpurified total cells from peritoneal ascites were incubated in 50% fluid from the same exudate in the presence of free bispecific T cell engagers, EnAd, or recombinant virus, with or without anti-PD-L1 blocking antibodies. After 2 days, the total cell population was harvested, and the number of CD25+ T cells was quantified by flow cytometry. (C) The amount of interferon gamma in the culture supernatant from (B, D) was measured by ELISA. (D) The number of residual FAP+ cells in (B) was measured by flow cytometry.

[0722] Figure 73 EnAd expressing a bispecific T cell engager activates and redirects T cells from patient biopsies to lyse NHDF fibroblasts

[0723] (A) PD-1 expression in endogenous T cells isolated from healthy donors or malignant effusion cancer biopsy samples. PD-1 expression was measured by flow cytometry. (B) CD3 + (C) Interferon-γ levels measured by ELISA in culture supernatants collected from (B) 120 hours after treatment. (D) Viability of NHDF fibroblasts was monitored in real time over 130 hours by the xCELLigence cytotoxicity assay when co-cultured with PBMCs or total cancer biopsy cells (1:5) and supernatants containing bispecific T cell engagers.

[0724] Figure 74 Shown are the effects of immunosuppressive ascites fluid samples on FAP bispecific T cell engager-mediated and anti-CD3 / CD28 bead-mediated PBMC T cell activation. (A) PBMC T cells activated with anti-CD3 / CD28 magnetic beads. (B) PBMC T cells activated with control or FAP bispecific T cell engager in the presence of NHDF cells. NS: normal serum, A: peritoneal fluid.

[0725] Figure 75 FAP bispecific T cell engager expressing EnAd activates CD11b in patient ascites + Macrophage polarization toward a more inflammatory phenotype

[0726] (A) Unpurified total cells from ascites samples were incubated in 50% ascites fluid in the presence of free bispecific T cell engager or virally expressed bispecific T cell engager. Interferon gamma treatment was used as a positive control. After 3 days, total cell populations were harvested and CD3 expression was measured by flow cytometry.+ Induction of the activation marker CD25 on cells. (B) Interferon γ levels were measured in the culture supernatants from (A) by ELISA. (C) On day 3, the expression levels of CD68, CD86, CD206, and CD163 were measured by flow cytometry on CD11b+ cells from (A). Representative flow cytometry spectra from triplicates are shown along with the complete data set.

[0727] Figure 76 Characterization of the architecture and cellular composition of solid prostate tumors

[0728] (A) EpCAM staining, (B) CD8 staining, (C) FAP staining. (D) Representative immunohistochemistry images of CD25 induction in prostate tumor sections after treatment with a viral-expressing bispecific T cell engager. Tumor cores were sectioned at 300 μM thickness using a Leica vibratome, cultured and infected in inserts, and harvested 7 days after treatment. (E) IFNg levels in tissue slice culture medium measured by ELISA. Supernatants were collected from slice cultures of malignant and benign tissues at the indicated time points. (F) IL-2 levels in tissue culture medium of malignant and benign tissues measured by ELISA.

[0729] Figure 77 A to Figure 77 C shows a schematic diagram of the transgene cassette used in Example 33.

[0730] Figure 77 D shows a graph indicating the number of viral genomes detected per cell in NG-611, NG-612, and NG-617 treated tumor cells.

[0731] Figure 78 Shown are the percentages of T cells expressing CD69 (a), CD25 (b), HLA-DR (c), CD40L (d), or cell surface CD107a (e) after coculture with EpCam-expressing SKOV cells and supernatants collected from A549 cells 24 h, 48 h, or 72 h after treatment with NG-611 viral particles compared with NG-612, enadenotucirev, or untreated control supernatants.

[0732] Figure 79Shown are the percentages of T cells expressing CD69 (a), CD25 (b), HLA-DR (c), CD40L (d), or cell surface CD107a (e) after coculture with FAP expressing MRC-5 cells and supernatants collected from A549 cells 24 h, 48 h, or 72 h after treatment with NG-612 viral particles compared with NG-611, enadenotucirev, or untreated control supernatants.

[0733] Figure 80 The percentage of MRC-5 cells expressing EpCAM and FAP is shown

[0734] Figure 81 shows IFNγ expression in supernatants of T cell co-cultures with SKOV cells (A) or MRC-5 cells (B) 24 hours, 48 ​​hours, or 72 hours after treatment with NG-611, NG-612, or enadenotucirev viral particles or untreated control supernatant, which were incubated with supernatants collected from A549 cells.

[0735] Figure 82 Figure 2 shows the anti-tumor efficacy and immune activation of a bispecific T cell engager expressing a virus in vivo. (a) Tumor volume in mice treated with saline, enadenotucirev, or NG-611. (b) Ratio of CD8 to CD4 T cells in NG-611-treated tumors compared to enadenotucirev-treated or untreated controls.

[0736] Figure 83 Schematic diagrams of the transgenic cassettes are shown: (a) NG-615, (b) NG-640, (c) NG-641.

[0737] Figure 84 Shown are graphs indicating the number of viral genomes detected per cell in NG-612 and NG-615 treated tumor cells.

[0738] Figure 85 Shown are the expressions of IFNα, MIP1α, and Flt3 L in the cell supernatants of NG-615 and enadenotucirev versus untreated control tumor cells.

[0739] Figure 86Shown are the numbers of T cells expressing CD69 (a), CD25 (b), HLA-DR (c), CD40L (d), or cell surface CD107a (e) after coculture with FAP expressing MRC-5 cells and supernatants collected from A549 cells 24 h, 48 h, or 72 h after treatment with NG-615 viral particles compared with NG-612, enadenotucirev, or untreated control supernatants.

[0740] Figure 87 Shown is IFNγ expression in supernatants of T cell cocultures with MRC-5 cells 24, 48, or 72 hours after treatment with NG-612, NG-615, or enadenotucirev viral particles or untreated control supernatant, which were incubated with supernatants collected from A549 cells.

[0741] Figure 88 Schematic diagram showing the NG-618 transgenic cassette

[0742] Figure 89 Shown are the detection of surface FAP expression on MRC-5 cells (a) or EpCam expression on SKOV cells (b) after incubation with supernatants collected from A549 cells 72 hours after treatment with NG-611, NG-612, NG-615, or enadenotucirev viral particles.

[0743] Figure 90 Shown are the percentages of T cells expressing CD24 (a), CD40L (b), or cell surface CD107a (c) after coculture with FAP expressing MRC-5 cells and supernatant collected from A549 cells 72 hours after treatment with NG-618 viral particles compared to Enadenotucirev or untreated controls.

[0744] Figure 91 Shown are the percentages of T cells expressing CD24 (a), CD40L (b), or cell surface CD107a (c) after coculture with EpCam-expressing SKOV cells and supernatants collected from A549 cells 72 hours after treatment with NG-618 viral particles, compared with Enadenotucirev or untreated controls.

[0745] Figure 92 Shown are the percentages of dead MRC-5 (a) or SKOV (b) cells following coculture with T cells and supernatants collected from A549 cells 72 hours after treatment with NG-618 viral particles, compared to enadenotucirev or untreated controls.

[0746] sequence

[0747] SEQ ID NO: 1 Anti-EpCAM bispecific T cell engager DNA coding sequence with N-terminal signal sequence and C-terminal deca-His affinity tag

[0748] SEQ ID NO: 2 Anti-EpCAM bispecific T cell engager protein sequence with N-terminal signal sequence and C-terminal deca-His affinity tag

[0749] SEQ ID NO: 3 Anti-FAP bispecific T cell engager DNA coding sequence with N-terminal signal sequence and C-terminal deca-His affinity tag

[0750] SEQ ID NO: 4 Anti-FAP bispecific T cell engager amino acid sequence with N-terminal signal sequence and C-terminal deca-His affinity tag

[0751] SEQ ID NO: 5: Control (anti-FHA) bispecific T cell engager DNA coding sequence with N-terminal signal sequence and C-terminal deca-His affinity tag

[0752] SEQ ID NO: 6: Control (anti-FHA) bispecific T cell engager amino acid sequence with N-terminal signal sequence and C-terminal deca-His affinity tag

[0753] SEQ ID NO: 7: Anti-CD3 ScFv amino acid sequence

[0754] SEQ ID NO: 8: anti-CD3 VH

[0755] SEQ ID NO: 9: anti-CD3 VL

[0756] SEQ ID NO: 10: Anti-CD3 ScFv linker sequence

[0757] SEQ ID NO: 11: Anti-FAP ScFv

[0758] SEQ ID NO: 12: Anti-FAP VL domain

[0759] SEQ ID NO: 13: Anti-FAP VH domain

[0760] SEQ ID NO: 14: Anti-FAP and anti-EpCAM linker sequence

[0761] SEQ ID NO: 15: Bispecific T cell engager leader sequence

[0762] SEQ ID NO: 16: Anti-EpCAM ScFv

[0763] SEQ ID NO: 17: Anti-EpCAM VL

[0764] SEQ ID NO: 18: Anti-EpCAM VH

[0765] SEQ ID NO: 19: Control bispecific T cell engager (anti-FHA)

[0766] SEQ ID NO: 20: Control (anti-FHA) ScFv

[0767] SEQ ID NO: 21: Control (anti-FHA) VL

[0768] SEQ ID NO: 22: Control (anti-FHA) VH

[0769] SEQ ID NO: 23: Control (anti-FHA) ScFv linker sequence

[0770] SEQ ID NO: 24: Deca-His tag sequence

[0771] SEQ ID NO: 25: FAP Bispecific T Cell Engager-P2A-RFP (ITALICS=leader, BOLD=furin cleavage site, UNDERLINE =P2A sequence, lowercase =RFP)

[0772] SEQ ID NO: 26: Control (anti-FHA) bispecific T cell engager-P2A-RFP (ITALICS=leader, BOLD=furin cleavage site, UNDERLINE =P2A sequence, lowercase =RFP)

[0773] SEQ ID NO: 27: Human EpCAM DNA coding sequence

[0774] SEQ ID NO: 28: Human EpCAM amino acid sequence

[0775] SEQ ID NO: 29: Human FAP DNA coding sequence

[0776] SEQ ID NO: 30: Human FAP amino acid sequence

[0777] SEQ ID NO: 31: CMV promoter sequence

[0778] SEQ ID NO: 32: SV40 late polyadenylation sequence

[0779] SEQ ID NO: 33: Zero sequence

[0780] SEQ ID NO: 34: NG-601 (EnAd-CMV-EpCAM bispecific T cell engager)

[0781] SEQ ID NO: 35: NG-602 (EnAd-SA-EpCAM bispecific T cell engager)

[0782] SEQ ID NO: 36: NG-605 (EnAd-CMV-FAP bispecific T cell engager)

[0783] SEQ ID NO: 37: NG-606 (EnAd-SA-FAP bispecific T cell engager)

[0784] SEQ ID NO: 38 EnAd genome

[0785] SEQ ID NO: 39B X The DNA sequence corresponds to and includes bp 28166 to bp 28366 of the EnAd genome

[0786] SEQ ID NO: 40B Y The DNA sequence corresponds to and includes bp 29345 to bp 29379 of the EnAd genome

[0787] SEQ ID NO: 41 HIS-Tag

[0788] SEQ ID NO: 42 splice acceptor sequence.

[0789] SEQ ID NO: 43 SV40 polyadenylation sequence

[0790] SEQ ID NO: 44 EpCam bispecific T cell engager nucleic acid sequence (OKT3)

[0791] SEQ ID NO: 45 FAP bispecific T cell engager nucleic acid sequence (OKT3)

[0792] SEQ ID NO: 46 FAP bispecific T cell engager nucleic acid sequence (aCD3)

[0793] SEQ ID NO: 47 NG-611 transgene cassette

[0794] SEQ ID NO: 48 NG-612 transgene cassette

[0795] SEQ ID NO: 49 NG-613 transgene cassette

[0796] SEQ ID NO: 50 Restriction site insertion (B X )

[0797] SEQ ID NO: 51 Restriction site insertion (B Y )

[0798] SEQ ID NO: 52 CMV promoter sequence

[0799] SEQ ID NO: 53 PGK promoter sequence

[0800] SEQ ID NO: 54 CBA promoter sequence

[0801] SEQ ID NO: 55 Short splice acceptor (SSA) DNA sequence

[0802] SEQ ID NO: 56 Splice acceptor (SA) DNA sequence

[0803] SEQ ID NO: 57 Branched splice acceptor (bSA) DNA sequence

[0804] SEQ ID NO: 58 Kozak sequence (null sequence)

[0805] SEQ ID NO: 59 Example of a start codon

[0806] SEQ ID NO: 60 Internal ribosome entry sequence (IRES)

[0807] SEQ ID NO: 61 P2A peptide

[0808] SEQ ID NO: 62 F2A peptide

[0809] SEQ ID NO: 63 E2A peptide

[0810] SEQ ID NO: 64 T2A peptide

[0811] SEQ ID NO: 65 polyadenylation (polyA) sequence

[0812] SEQ ID NO: 66 leader sequence

[0813] SEQ ID NO: 67 leader sequence

[0814] SEQ ID NO: 68 IFNγ amino acid sequence

[0815] SEQ ID NO: 69 IFNα amino acid sequence

[0816] SEQ ID NO: 70 TNFα amino acid sequence

[0817] SEQ ID NO: 71 DNA sequence corresponding to the E2B region of the EnAd genome (bp 10355 to bp 5068)

[0818] SEQ ID NO: 72: Anti-EpCAM bispecific T cell engager DNA coding sequence with N-terminal signal sequence and C-terminal deca-His affinity tag

[0819] SEQ ID NO: 73: Anti-EpCAM bispecific T cell engager protein sequence with N-terminal signal sequence and without C-terminal deca-His affinity tag

[0820] SEQ ID NO: 74: Anti-FAP bispecific T cell engager DNA coding sequence with N-terminal signal sequence and without C-terminal deca-His affinity tag

[0821] SEQ ID NO: 75: Anti-FAP bispecific T cell engager amino acid sequence with N-terminal signal sequence and without C-terminal deca-His affinity tag

[0822] SEQ ID NO: 76: Control (anti-FHA) bispecific T cell engager DNA coding sequence with N-terminal signal sequence and without C-terminal deca-His affinity tag

[0823] SEQ ID NO: 77: Control (anti-FHA) bispecific T cell engager amino acid sequence with N-terminal signal sequence and without C-terminal deca-His affinity tag

[0824] SEQ ID NO: 78: Control bispecific T cell engager (anti-FHA) without C-terminal deca-His affinity tag

[0825] SEQ ID NO: 79: NG-601 (EnAd-CMV-EpCAM bispecific T cell engager) without deca-His affinity tag

[0826] SEQ ID NO: 80: NG-602 (EnAd-SA-EpCAM bispecific T cell engager) without deca-His affinity tag

[0827] SEQ ID NO:81:NG-605 (EnAd-CMV-FAP bispecific T cell engager) without deca-His affinity tag

[0828] SEQ ID NO: 82: NG-606 (EnAd-SA-FAP bispecific T cell engager) without deca-His affinity tag

[0829] SEQ ID NO: 83: EpCam bispecific T cell engager nucleic acid sequence (OKT3)

[0830] SEQ ID NO: 84: Zero sequence

[0831] SEQ ID NO: 85: FAP bispecific T cell engager nucleic acid sequence (OKT3)

[0832] SEQ ID NO: 86: Zero sequence

[0833] SEQ ID NO: 87: FAP bispecific T cell engager nucleic acid sequence (aCD3)

[0834] SEQ ID NO: 88: NG-611 transgene cassette

[0835] SEQ ID NO: 89: NG-612 transgene cassette

[0836] SEQ ID NO: 90: NG-613 transgene cassette

[0837] SEQ ID NO:91: NG-614 transgene cassette

[0838] SEQ ID NO: 92: NG-617 transgene cassette

[0839] SEQ ID NO: 93: EpCam bispecific T cell engager amino acid sequence (OKT3)

[0840] SEQ ID NO: 94: FAP bispecific T cell engager amino acid sequence (OKT3)

[0841] SEQ ID NO: 95: FAP bispecific T cell engager amino acid sequence (aCD3)

[0842] SEQ ID NO: 96: NG-611 genome

[0843] SEQ ID NO: 97: NG-612 genome

[0844] SEQ ID NO: 98: NG-613 genome

[0845] SEQ ID NO: 99: NG-614 genome

[0846] SEQ ID NO: 100: NG-617 genome

[0847] SEQ ID NO: 101: NG-615 genome

[0848] SEQ ID NO: 102: NG-640 genome

[0849] SEQ ID NO: 103: NG-641 genome

[0850] SEQ ID NO: 104: Zero sequence

[0851] SEQ ID NO: 105: Flt3L nucleic acid sequence

[0852] SEQ ID NO: 106: Zero sequence

[0853] SEQ ID NO: 107: MIP1α nucleic acid sequence

[0854] SEQ ID NO: 108: Flexible linker sequence

[0855] SEQ ID NO: 109: IFNα nucleic acid sequence

[0856] SEQ ID NO: 110: CXCL10 nucleic acid sequence

[0857] SEQ ID NO: 111: CXCL9 nucleic acid sequence

[0858] SEQ ID NO: 112: NG-615 transgene cassette

[0859] SEQ ID NO: 113: NG-640 transgene cassette

[0860] SEQ ID NO: 114: NG-641 transgene cassette

[0861] SEQ ID NO: 115: FLT3L amino acid sequence

[0862] SEQ ID NO: 116: MIP1α amino acid sequence

[0863] SEQ ID NO: 117: IFNα amino acid sequence

[0864] SEQ ID NO: 118: CXCL9 amino acid sequence

[0865] SEQ ID NO: 119: CXCL10 amino acid sequence

[0866] SEQ ID NO: 120: NG-618 genome

[0867] SEQ ID NO: 121: NG-618 EpCam bispecific T cell engager nucleic acid sequence

[0868] SEQ ID NO: 122: NG-618FAP bispecific T cell engager nucleic acid sequence

[0869] SEQ ID NO: 123: NG-618 transgene cassette

[0870] SEQ ID No: 124 to 297 are linker sequences

[0871] SEQ ID NO: 298 NG-616 genome

[0872] Examples

[0873] Example 1

[0874] Recombinant bispecific T cell engagers were designed and the proteins prepared as described in this Example.

[0875] Bispecific T cell engager engineering

[0876] Bispecific T cell engagers are generated by linking two single-chain antibody fragments (ScFv) with different specificities to a flexible Gly4Ser linker. ScFv is derived from a parental monoclonal antibody linked to a V H and V LThe bispecific T cell adapter is created by combining a bispecific T cell adapter with a domain. Each bispecific T cell adapter is designed with an N-terminal signal sequence for mammalian secretion and a C-terminal 18-histidine affinity tag for detection and purification. The bispecific T cell adapter is engineered by standard DNA cloning technology and inserted into a protein expression vector (Figure 1). The anti-EpCAM bispecific T cell adapter is an anti-EpCAM bispecific T cell adapter from patent WO2005040220 (SEQ ID NO: 63 therein), to which a signal sequence and an affinity tag are added. The anti-FAP bispecific T cell adapter is created from scratch using the anti-FAP ScFv from patent WO2010037835A2 and the anti-CD3 ScFv from patent WO 2005040220 (SEQ ID 63 therein), to which a signal sequence and an affinity tag are added. Control bispecific T cell engagers used anti-FHA (filamentous hemagglutinin from Bordetella pertussis) ScFv from Hussein et al., 2007 (Hussein AH et al. (2007) "Construction and characterization of single-chain variable fragment antibodies against the Bordetella pertussis surface adhesins filamentous hemagglutinin and pertussis." Infect Immunology 75, 5476-5482), and anti-CD3 ScFv from patent WO 2005040220 (SEQ ID NO: 63), to which a signal sequence and affinity tag were added. The DNA encoding and amino acid sequences of these bispecific T cell engagers are SEQ ID NOs: 1 to 6.

[0877] Recombinant bispecific T cell engager production

[0878] Recombinant bispecific T cell adapter proteins (Figure 1) were produced by cloning each sequence into the pSF-CMV vector using the CMV promoter (SEQ ID NO: 31) to drive protein expression. The plasmid DNA concentrations of the plasmids, pSF-CMV-EpCAM bispecific T cell adapter, pSF-CMV-FAP bispecific T cell adapter, and pSF-CMV-control bispecific T cell adapter (Table 2) were measured by NanoDrop. An empty pSF-CMV vector was included as a negative control. Each 54.7 μg was diluted with 4 mL of OptiMEM. 109.2 ug PEI (linear, MW 25000, Polysciences, USA) was diluted in 4 mL of OptiMEM medium and mixed with 4 ml of diluted DNA to generate a DNA-PEI complex (DNA: PEI ratio of 1: 2 (w / w)). After incubation at room temperature for 20 minutes, the complex mixture was made up to 18 mL with OptiMEM, and this transfection mixture was added to a T175 flask containing 90% confluent Ad293 cells. After incubation of the cells and the transfection mixture at 37°C, 5% CO for 4 hours, 30 mL of cell culture medium (DMEM high glucose supplemented with glutamine, without phenol red) was added to the cells, and the flask was incubated at 37°C, 5% CO for 48 hours. Another cell flask was transfected in parallel with pSF-CMV-GFP to ensure effective transfection efficiency. In order to collect secreted protein, the supernatant of the transfected cells was collected and centrifuged at 350 g for 5 minutes at 4°C to remove cellular components (Allegra X-15R, Beckman Coulter). The supernatant was transferred to a 10k MWCO Amicon Ultra-15 centrifugal filter device (Millipore). After spinning at 4750 rpm and 4°C, the volume of the retentate was adjusted with the flow-through to obtain a 50-fold higher concentration. Aliquots of the concentrated protein were stored at -80°C.

[0879] Table 2

[0880] "p" used as a prefix in the named construct indicates that the construct is a plasmid.

[0881]

[0882] Recombinant bispecific T cell engager detection

[0883] In order to detect bispecific T cell adapters, western blotting can be used to detect the 18 histidine affinity tag at the C-terminus with anti-His antibody. Protein samples are adjusted to a final volume of 15 μL with dissolution buffer, comprising 2.5 μL 6x Laemmli SDS sample buffers containing β-mercaptoethanol and SDS. Samples are incubated at 95°C for 5 minutes to denature the protein and loaded onto 15-hole 10% precast polyacrylamide gels (Mini-PROTEAN TGX precast gels, British Life Sciences (BioRad)). In the 1x running buffer in the Mini-PROTEAN Tetra system (British Life Sciences), the gel was run at 180V for 45 minutes. Protein from the SDS gel is transferred to a nitrocellulose membrane by wet electroblotting in the 1x transfer buffer in a miniature trans-blot cell (Mini Trans-Blot Cell) (British Life Sciences) at 300mA and 4°C for 90 minutes. Transfer is performed in the presence of an ice pack to limit heat. The nitrocellulose membrane was then blocked with 5% milk in PBS-T on a shaker at room temperature for 1 hour and probed with anti-His (C-terminal) antibody (mouse α-6xHis, clone 3D5, Invitrogen, UK, #46-0693), diluted 1:5000 in PBS / 5% milk. After incubation overnight at 4°C on a shaker, the membrane was washed and probed with HRP-labeled polyclonal secondary α-mouse immunoglobulin antibody (1:10.000 in PBS / 5% milk, Dako, #P0161) at room temperature for 1 hour. For visualization, SuperSignal West Dura extended duration substrate (Thermo Fisher Scientific, UK) was applied according to the manufacturer's instructions and exposed to X-ray film and developed in an automatic film processor. The results demonstrated the expression and secretion of bispecific T cell engager proteins in Ad293 cells transfected with the bispecific T cell engager expression plasmid, but not the parental vector.

[0884] Quantification of recombinant bispecific T cell engagers

[0885] To measure the amount of recombinant bispecific T cell engager protein, the bispecific T cell engager signal was compared to a His-tagged (C-terminal 10His) protein standard (10x His-tagged human cathepsin D, Biolegend, #556704) using a dot blot technique. Two-fold serial dilutions of the bispecific T cell engager sample and protein standard were prepared, and 1.5 μL of each was applied directly to a nitrocellulose membrane and air dried for 20 minutes. The blocking and staining protocol described above for protein blotting was then performed. The molar concentration of the protein standard was adjusted to represent a bispecific T cell engager concentration of 250 μg / mL. Results ( Figure 2 A) Demonstrates the expression and secretion of bispecific T cell engager proteins in Ad293 cells transfected with a bispecific T cell engager expression plasmid.

[0886] FAP binding ELISA

[0887] The FAP binding activity of the FAP bispecific T cell engager and control (anti-FHA) bispecific T cell engager (SEQ ID NOs: 4 and 6) secreted from cells transfected with the pSF-CMV-FAP bispecific T cell engager or the pSF-CMV-control bispecific T cell engager was assessed by enzyme-linked immunosorbent assay (ELISA). Empty pSF-CMV vector supernatant was included as a negative control. ELISA plates (NuncImmuno MaxiSorp 96-well microplates) were prepared by coating with human FAP / seprase protein (100 ng / well, Sino Biological Inc., 10464-H07H-10) in PBS buffer overnight at 4°C. Plates were washed with PBS 0.05% Tween 20 between all subsequent binding steps. Plates were blocked with 5% BSA in PBS 0.05% Tween 20 for 1 hour at room temperature. The bispecific T cell adaptor protein or the protein collected from the wells transfected with the empty pSF-CMV vector was diluted 10 times into PBS / 5% BSA / 0.05% Tween 20. All samples were added to the FAP coated plate and incubated at room temperature for 2 hours. The detection antibody, anti-His (C-terminal) antibody (mouse anti-6xHis, clone 3D5, Invitrogen, UK, #46-0693) was diluted to 1:1000 and applied at room temperature for 1 hour. HRP-conjugated anti-mouse Fc (1:1000 in PBS / 5% milk, Dako) was then applied at room temperature for 1 hour, followed by HRP detection with HRP substrate solution 3.3.5.5'-tetramethylethylenediamine (TMB, Thermo Fisher Scientific). The reaction was stopped using stop solution and color development was measured at 450nm on a plate reader. The absorbance at 450 nm was plotted for the FAP bispecific T cell engager, control bispecific T cell engager, and empty vector supernatant to demonstrate the specific binding of the FAP bispecific T cell engager to the FAP protein. Figure 2 B) shows specific binding of the FAP bispecific T cell engager, but not the control bispecific T cell engager, to recombinant FAP protein.

[0888] EpCAM binding ELISA

[0889] EpCAM binding activity of the EpCAM bispecific T cell engager and control bispecific T cell engager (SEQ ID NOs: 2 and 6) secreted from cells transfected with the pSF-CMV-EpCAM bispecific T cell engager or the pSF-CMV-control bispecific T cell engager was assessed by enzyme-linked immunosorbent assay (ELISA). Empty pSF-CMV vector supernatant was included as a negative control. ELISA plates (NuncImmuno MaxiSorp 96-well microplates) were prepared by coating with human EpCAM / TROP-1 protein (50 ng / well, Sino Biological Inc., #10694-H02H-50) in PBS buffer overnight at 4°C. Plates were washed with PBS 0.05% Tween 20 between all subsequent binding steps. Plates were blocked with 5% BSA in PBS 0.05% Tween 20 for 1 hour at room temperature. Bispecific T cell adaptor proteins or proteins collected from wells transfected with empty pSF-CMV vectors were diluted 10-fold into PBS / 5% BSA / 0.05% Tween 20. All samples were added to EpCAM-coated plates and incubated for 2 hours at room temperature. The detection antibody, anti-His (C-terminal) antibody (mouse anti-6xHis, clone 3D5, Invitrogen, UK, #46-0693) was diluted 1:5000 and applied for 1 hour at room temperature. HRP-conjugated anti-mouse Fc (1:1000 in PBS / 5% milk, Dako) was then applied for 1 hour at room temperature, followed by HRP detection using HRP substrate solution 3.3.5.5'-tetramethylethylenediamine (TMB, Thermo Fisher Scientific). The reaction was stopped using stop solution and color development was measured at 450nm on a plate reader. The absorbance at 450 nm was plotted against the EpCAM bispecific T cell engager, control bispecific T cell engager, and empty vector supernatant to demonstrate the specific binding of the EpCAM bispecific T cell engager to recombinant EpCAM. Figure 2C ) shows the specific binding of the EpCAM bispecific T cell engager, but not the control bispecific T cell engager, to the recombinant EpCAM protein.

[0890] Example 2

[0891] Prior to constructing EnAd viruses carrying the bispecific T cell engager transgene, the functional activity of the recombinant bispecific T cell engager protein was assessed in a number of different assays.

[0892] Isolation of human peripheral blood mononuclear cells (PBMCs)

[0893] Human PBMCs were isolated by density gradient centrifugation from fresh human blood samples from healthy donors or whole blood leukocyte cones obtained from the National Health Service Blood and Transplant UK in Oxford. In either case, the sample was diluted 1:2 with PBS, and 25 mL of this mixture was layered onto 13 mL of Ficoll (1.079 g / mL, lymphocyte separation fluid (Ficoll-Paque Plus), GE Healthcare) in a 50 mL centrifuge tube. The sample was centrifuged at 1600 rpm for 30 minutes (Allegra X-15R, Beckman Coulter) at 22°C, using the lowest deceleration setting to maintain phase separation. After centrifugation, four layers were observed, including a plasma layer at the top, an interface containing PBMCs below, and a Ficoll layer and a layer of red blood cells and granulocytes at the bottom. PBMCs were collected using a Pasteur pipette and washed twice with PBS (1200 rpm, 10 minutes at room temperature) and resuspended in RPMI culture medium supplemented with 10% FBS.

[0894] Isolation of CD3-positive T cells

[0895] CD3 positive (CD3 T cell) cells were extracted from PBMCs by depletion of non-CD3 T cells using the Pan T cell isolation kit (Miltenyi Biotec, #130-096-535) according to the manufacturer's protocol. + )T cells.

[0896] Processing of primary ascites samples

[0897] Primary human ascites samples from patients with various indications were received from the oncology ward of Churchill Hospital (Oxford University Hospital), including but not limited to ovarian cancer, pancreatic cancer, breast cancer and gastric cancer. After receiving the sample, the cells and fluid were partially separated, and the fluid of the aliquot was frozen at -20 ° C for storage and future analysis. According to the manufacturer's instructions, the cell fraction was processed with red blood cell lysis buffer (Roche (Roche), #11814389001) to remove red blood cells. The cell type present in each sample was determined by staining of EpCAM, EGFR, FAP, CD45, CD11b, CD56, CD3, CD4, CD8, PD1 and CTLA4, and analyzed by flow cytometry. Fresh cells were then used for in vitro T cell activation and target cell lysis experiments. In some cases, cells were passaged in DMEM supplemented with 10% FBS for subsequent experiments.

[0898] Cell line maintenance

[0899] All cell lines were maintained in DMEM (Sigma-Aldrich, UK) or RPMI medium (Sigma-Aldrich, UK) as specified in Table 3, supplemented with 10% (v / v) fetal bovine serum (FBS, Gibco) in a humidified incubator (MCO-17AIC, Sanyo) at 37°C and 5% CO2. TM ) and 1% (v / v) penicillin / streptomycin (10 mg / mL, Sigma-Aldrich, UK) unless otherwise stated. Cells were separated every 2 to 3 days by enzymatic dissociation with trypsin / EDTA (0.05% trypsin 0.02% EDTA, Sigma-Aldrich, UK) and then reached confluence. During this process, the culture medium was aspirated and the cells were washed with 15 ml PBS and then treated with 2 mL trypsin / EDTA at 37 ° C for 2 to 10 minutes. Trypsin was neutralized with 10 mL of DMEM containing 10% FBS, and a portion of the cells were transferred to a new flask containing fresh culture medium. For routine cell culture, the culture medium was supplemented with 10% FBS for infection and viral plasmid transfection with 2% FBS and for recombinant bispecific T cell adaptor plasmid transfection without FBS supplementation.

[0900] Table 3

[0901]

[0902]

[0903] statistics

[0904] In the case of comparison of two conditions, statistical analysis was performed using t-test. In all other cases, statistical analysis was performed by using one-way ANOVA.

[0905] Characterizing human T cell activation by recombinant FAP bispecific T cell engagers

[0906] The ability of FAP bispecific T cell engagers to induce T cell activation in the presence or absence of normal human dermal fibroblast (NHDF) cells was compared. Human CD3 + T cells (70,000 cells per well in a 96-well U-bottom plate) were cultured alone or co-cultured with NHDF cells (10:1 T:NHDF). Cells were co-cultured at 37°C for 24 hours and then harvested with enzyme-free cell dissociation buffer (Thermo Fisher Scientific, #13151014). CD45 expression was then analyzed by antibody staining and flow cytometry. + CD69 on T cells ( Figure 3A ) and CD25( Figure 3B ) expression levels and expressed as geometric mean fluorescence (gMFI) values. Plate-fixed anti-CD3 antibody (7.5 μg / mL) was used as a positive control for T cell activation. The FAP bispecific T cell engager selectively induced the expression of activation markers CD69 and CD25 on T cells, indicating that it was able to activate T cells.

[0907] In a second similar experiment, NHDF cells (200,000 CD3 + After 6 hours of co-culture of cells with 40,000 NHDFs in a well of a 96-well plate and 300 ng / mL FAP or control bispecific T cell engagers, T cells were assessed by intracellular cytokine staining. + T cells were intracellularly stained for IFNγ expression, and Brefeldin A was added to the culture medium 5 hours before harvest. As a positive control, T cells were stimulated with soluble PMA (10 ng / mL) and ionomycin (1 μg / mL). Figure 4A The results shown in indicate that the FAP bispecific T cell engager in the presence of NHDF resulted in significantly higher numbers of IFNγ-expressing T cells compared to the control bispecific T cell engager.

[0908] Example 3

[0909] A similar set of experiments as in Example 2 was performed to characterize the recombinant EpCAM bispecific T cell engager protein.

[0910] Characterization of human T cell activation by recombinant EpCAM bispecific T cell engagers

[0911] The ability of EpCAM bispecific T cell engagers to induce T cell activation was compared in the presence or absence of the EpCAM-positive DLD cell line. Human CD3 + T cells (70,000 cells per well in a 96-well U-bottom plate) were cultured alone or co-cultured with DLD cells (10:1 T:DLD). Cells were co-cultured at 37°C for 24 hours and then harvested with enzyme-free cell dissociation buffer. CD45 expression was then analyzed by antibody staining and flow cytometry. + The expression levels of CD69 and CD25 on T cells were measured, and the data were expressed as geometric mean fluorescence (gMFI) values. Plate-immobilized anti-CD3 antibody (7.5 μg / mL) was used as a positive control for T cell activation. The EpCAM bispecific T cell engager selectively induced the expression of activation markers CD69 and CD25 on T cells, indicating that it was able to activate T cells ( Figure 4B and Figure C).

[0912] In similar experiments, in the presence of DLD cells (200,000 CD3 + After 6 hours of co-culture of T cells with 40,000 DLD cells per well of a 96-well plate and 300 ng / mL EpCAM or control bispecific T cell engagers, T cells were assessed by intracellular cytokine staining. + T cells were intracellularly stained for IFNγ expression and Brefeldin A was added to the culture medium 5 hours before collection. As a positive control, T cells were stimulated with soluble PMA (10 ng / mL) and ionomycin (1 μg / mL). The results show that the EpCAM bispecific T cell engager in the presence of DLD resulted in a significantly higher number of T cells expressing IFNγ than the control bispecific T cell engager ( Figure 5A ).

[0913] In another similar experiment, PBMCs from 8 different blood donors were used to evaluate donor-dependent variation in T cell activation mediated by bispecific T cell engagers. DLD (7,000 cells) were co-cultured with 100,000 PBMCs in U-bottom 96-well plates in the presence of culture medium alone or 300 ng / mL control or EpCAM bispecific T cell engagers. The cells were co-cultured at 37°C for 24 hours and then harvested. CD45 expression was then analyzed by antibody staining and flow cytometry. + The expression levels of CD69 and CD25 on T cells were measured and the data were expressed as geometric mean fluorescence (gMFI) values. The results show that the EpCAM bispecific T cell engager induced CD3 + Expression of activation markers CD69 and CD25 in T cells (Fig. 5B and C).

[0914] Example 4

[0915] In this example, the ability of T cells activated by the recombinant FAP bispecific T cell engager to induce cell death in fibroblast targets was assessed.

[0916] FAP bispecific T cell engager induces T cell-mediated lysis of FAP-positive cell lines and primary cells

[0917] NHDF (7,000 cells) were co-cultured with 70,000 T cells in the wells of a U-bottom 96-well plate in the presence of culture medium alone or 300 ng / mL control or FAP bispecific T cell engager. After 24 hours of co-culture, supernatants were collected and cytotoxicity was determined by LDH assay according to the manufacturer's instructions. Figure 6The results in A show that the FAP bispecific T cell engager significantly increased lysis of NHDF cells.

[0918] In similar experiments, 7,000 primary lung fibroblasts (BTC100) were incubated with 70,000 CD3 + After 24 hours of co-culture, supernatants were collected and cytotoxicity was determined by LDH assay. Figure 6 The results in panels B and C show that the FAP bispecific T cell engager significantly increased lysis of primary human cancer-associated fibroblast (CAF) cells. FAP expression in these and other patient-derived cell lines is shown in FIG7 .

[0919] 8,000 NHDF cells were co-cultured with 40,000 T cells and the bispecific T cell engager concentration ranged from 2 × 10 3 to 2×10 -2 ng / mL was used to evaluate the dose-response relationship of FAP bispecific T cell engager-mediated cell lysis. After 24 hours of co-culture at 37°C, LDH assay was performed on the supernatant to determine target cell cytotoxicity. The dose-response curve was fitted using a four-parameter nonlinear fitting model integrated into GraphPad Prism, resulting in an EC50 value of 3.2 ng / mL for the FAP bispecific T cell engager. Results ( Figure 8A ) shows the dose-dependent relationship between FAP bispecific T cell engager concentration and cytotoxicity measured by LDH assay (shown as Abs 490 ).

[0920] Example 5

[0921] Similar studies as in Example 4 were used to demonstrate the ability of T cells activated by the recombinant EpCAM bispecific T cell engager to induce target tumor cell death.

[0922] EpCAM bispecific T cell engager induces T cell-mediated lysis of EpCAM-positive cell lines

[0923] DLD tumor cells (7,000 cells) were co-cultured with 70,000 T cells in the wells of a U-bottom 96-well plate in the presence of culture medium alone or 300 ng / mL control or EpCAM bispecific T cell engager. After 24 hours of co-culture, supernatants were harvested and cytotoxicity was determined by LDH assay. Figure 8B The results in Figure 2 show that the EpCAM bispecific T cell engager significantly increased the lysis of DLD cells (in Figure 8CEpCAM expression on DLD cells is shown in FIG).

[0924] In similar experiments, 4,000 SKOV cells were co-cultured with 40,000 CD3 T cells in the presence or absence of 300 ng / mL control or EpCAM bispecific T cell engagers. + After 24 hours of co-culture, supernatants were collected and cytotoxicity was determined by LDH assay. Figure 9A The results in show that the EpCAM bispecific T cell engager significantly increased lysis of SKOV cells.

[0925] In another similar experiment, 5,000 MCF7 cells were co-cultured with 50,000 CD3 T cells in the presence or absence of 300 ng / mL control or EpCAM bispecific T cell engagers. + After 24 hours of co-culture, supernatants were collected and cytotoxicity was determined by LDH assay. Figure 9B The results in show that the EpCAM bispecific T cell engager also significantly increased lysis of MCF7 cells.

[0926] 8,000 DLDs were co-cultured with 40,000 T cells and the concentration of EpCAM or control bispecific T cell engager ranged from 2 × 10 3 to 2×10 -2 The dose-response relationship for EpCAM bispecific T cell engager-mediated cytolysis was assessed at 100 ng / mL. After 24 hours of co-culture at 37°C, LDH assays were performed on the supernatants to determine target cell cytotoxicity. The dose-response curves were fitted using a four-parameter nonlinear fitting model integrated into GraphPad Prism, resulting in an EC50 value of 7.4 ng / mL for the EpCAM bispecific T cell engager. Figure 10 The results in show a dose-dependent relationship between EpCAM bispecific T cell engager concentration and cytotoxicity.

[0927] In summary, the results of this example demonstrate that the EpCAM bispecific T cell engager is capable of inducing T cell-mediated lysis of multiple EpCAM-positive tumor cell lines.

[0928] Example 6

[0929] Stable FAP-expressing CHO and Ad293 cell lines were generated as a means to demonstrate the FAP antigen specificity of the FAP bispecific T cell engager by comparison with parental untransfected cells.

[0930] Generation of stably transfected cell lines expressing FAP

[0931] The protein sequence of the FAP gene was obtained from the NCBI database (SEQ ID 30) and reverse transcribed to generate a DNA coding sequence synthesized by Oxford Genetics Ltd (Oxford, UK). The FAP gene was cloned into the pSF-Lenti vector using standard cloning techniques to generate the pSF-Lenti-FAP vector. HEK293T cells were transfected with the lentiviral FAP expression vector along with pSF-CMV-HIV-Gag-Pol, pSF-CMV-VSV-G, and pSF-CMV-HIV-Rev. Lipofectamine 2000 was used as a transfection reagent and added to the vector DNA at a DNA:lipofectamine ratio of 1:2 and incubated with the cells at 37°C. After 48 hours, the supernatant containing the lentivirus was collected and mixed with polybrene (final concentration, 8 μg / mL). The lentivirus / polybrene mixture was added to the inoculated Ad293 or CHO cells and incubated at 37°C. On day 4, the supernatant was replaced with medium containing puromycin (2 μg / mL for Ad293 and 7.5 μg / mL for CHO). Stable variants were then cloned and FAP expression was determined by staining with FAP or isotope control antibodies on the parental cell line or stably transfected variants and analyzed by flow cytometry ( Figure 11A ).

[0932] Target cell lysis mediated by the FAP bispecific T cell engager is specific for cells expressing FAP

[0933] CHO or CHO-FAP cells (7,000 cells) were cultured alone or co-cultured with human T cells (70,000 cells) in the wells of a U-bottom 96-well plate in the presence of culture medium alone or 2 μg / mL of control or FAP bispecific T cell engagers. After 24 hours of incubation, supernatants were harvested and target cell cytotoxicity was measured by LDH cytotoxicity assay as described in Example 4 ( Figure 11B T cell activation was also determined by flow cytometry analysis of CD69 and CD25 expression levels ( Figure 12 Cytotoxicity was only observed when CHO-FAP cells were cultured with T cells and the FAP bispecific T cell engager. This indicates that T cell activation and target cell lysis mediated by the FAP bispecific T cell engager are highly specific and limited to FAP-expressing cells, rather than the FAP-negative parental cell line.

[0934] Example 7

[0935] Stable EpCAM-expressing CHO and Ad293 cell lines were generated as a means to demonstrate the EpCAM antigen specificity of the EpCAM bispecific T cell engager by comparison with parental untransfected cells.

[0936] Generation of stably transfected cell lines expressing EpCAM

[0937] The protein sequence of the EpCAM gene was obtained from the NCBI database (SEQ ID 28) and reverse transcribed to generate a DNA coding sequence synthesized by Oxford Genetics Ltd (Oxford, UK). The EpCAM gene was cloned into the pSF-Lenti vector by standard cloning techniques to generate the pSF-Lenti-EpCAM vector. HEK293T cells were transfected with the lentiviral EpCAM expression vector together with pSF-CMV-HIV-Gag-Pol, pSF-CMV-VSV-G, and pSF-CMV-HIV-Rev. Lipofectamine 2000 was used as a transfection reagent and added to the vector DNA at a DNA:liposome ratio of 1:2 and incubated with the cells at 37°C. After 48 hours, the supernatant containing the lentivirus was collected and mixed with polybrene (final concentration, 8 μg / mL). The lentivirus / polybrene mixture was added to the inoculated Ad293 or CHO cells and incubated at 37°C. On day 4, the supernatant was replaced with medium containing puromycin (2 μg / mL for Ad293 and 7.5 μg / mL for CHO). Stable variants were then cloned and EpCAM expression was determined by staining with EpCAM or isotope control antibodies on the parental cell line or stably transfected variants and analyzed by flow cytometry ( Figure 13A ).

[0938] Target cell lysis mediated by the EpCAM bispecific T cell engager is specific for cells expressing EpCAM

[0939] CHO or CHO-EpCAM cells (7,000 cells) were cultured alone or co-cultured with human T cells (70,000 cells) in the presence of culture medium alone or 2 μg / mL of control or EpCAM bispecific T cell engagers in wells of a U-bottom 96-well plate. After 24 hours of incubation, supernatants were harvested and target cell cytotoxicity was measured by LDH cytotoxicity assay ( Figure 13B T cell activation was also determined by flow cytometry analysis of CD69 and CD25 expression levels ( Figure 14 Cytotoxicity was only observed when CHO-EpCAM cells were cultured with T cells and the EpCAM bispecific T cell engager. This indicates that EpCAM bispecific T cell engager-mediated T cell activation and target cell lysis are highly specific and limited to EpCAM-expressing cells, rather than the EpCAM-negative parental cell line.

[0940] Example 8

[0941] In further experiments, the ability of recombinant FAP bispecific T cell engager proteins to activate CD4 or CD8 T cells and the ability of each of these T cell subsets to lyse NHDF cells were assessed. CD3 T cells were cultured in the presence of 300 ng / mL of control or FAP bispecific T cell engager in wells of U-bottom 96-well plates. + T cells (35,000) were co-cultured with 7,000 NHDF cells and incubated at 37°C for 24 hours. Cells were harvested and stained with antibodies against CD4 or CD8 and CD69 and CD25 and analyzed by flow cytometry. Results ( Figure 15 A) Demonstration of FAP bispecific T cell engager inducing CD4 + and CD8 + Increase in activation markers CD69 and CD25 in T cells.

[0942] In similar experiments, the ability of each T cell subset (CD4 and CD8) to kill target cells was assessed. CD4 T cells were extracted from CD3 purified cells by positive selection using a CD4 T cell isolation kit (Miltenyi Biotec, #130-045-101) according to the manufacturer's protocol. + T cells, including CD8 T cells in the non-separated flow-through. In a well of a U-bottom 96-well plate, 7,000 NHDF were mixed with 35,000 CD4 + or CD8 + T cells were co-cultured with 300 ng / mL control or FAP bispecific T cell engagers and incubated at 37°C. After 24 hours, supernatants were collected and target cell cytotoxicity was measured by LDH cytotoxicity assay. Results ( Figure 15 B) shows that FAP bispecific T cell engager induces CD4 + and CD8 + T cells to kill NHDF cells.

[0943] Example 9

[0944] Evaluation of EpCAM bispecific T cell engager activated CD4 + or CD8 + The capacity of T cells and the ability of each subset to lyse DLD tumor cells were analyzed. CD3 T cells were expressed in the presence of 300 ng / mL control or EpCAM bispecific T cell engager in wells of a U-bottom 96-well plate. + T cells (35,000) were co-cultured with 7,000 DLD cells and incubated at 37°C for 24 hours. Cells were harvested and stained with antibodies against CD4 or CD8 and CD69 and CD25 and analyzed by flow cytometry. Results ( Figure 16A) Demonstration of EpCAM bispecific T cell engager inducing CD4 + and CD8 + Increase in activation markers CD69 and CD25 in T cells.

[0945] In similar experiments, the ability of each T cell subset (CD4 and CD8) to kill target cells was assessed. CD4 T cells were extracted from CD3 purified cells by positive selection using a CD4 T cell isolation kit according to the manufacturer's protocol. + T cells, including CD8 T cells in the unselected flow-through. 7,000 DLDs were mixed with 35,000 CD4 + or CD8 + T cells were co-cultured with 300 ng / mL control or EpCAM bispecific T cell engagers and incubated at 37° C. After 24 hours, supernatants were collected and target cell cytotoxicity was measured by LDH cytotoxicity assay ( Figure 16 B) Results show that EpCAM bispecific T cell engager induces CD4 + and CD8 + T cells to kill DLD cells.

[0946] Example 10

[0947] Characterization of FAP bispecific T cell engager-mediated activation of autologous tumor-associated lymphocytes in primary malignant ascites

[0948] To evaluate the activity of bispecific T cell engager proteins using cancer patient-derived cells, CD3 + T cells and FAP + Primary malignant ascites fluid samples of cells were used for testing. Unpurified ascites cells (thus unchanged from the time of receipt) were seeded at 250,000 cells per well in U-bottom 96-well plates in 100% ascites fluid or culture medium supplemented with 1% human serum in the presence of 500 ng / mL control or FAP bispecific T cell engager. Untreated wells served as negative controls. After incubation at 37°C for 5 days, the total cell population was harvested and CD3 + The number of T cells ( Figure 17 A) and CD3 + The expression level of CD25 on T cells ( Figure 17 B). The total cell number per well was determined using precision counting beads. The results demonstrated that the FAP bispecific T cell engager resulted in a significant increase in T cell activation of tumor-associated T cells from cancer patients.

[0949] As an extension of the above experiments, duplicate wells were harvested and FAP was determined by flow cytometry. + The number of cells ( Figure 17 C). The total cell number per well was determined using precision counting beads. The results show that the FAP bispecific T cell engager resulted in a significant reduction in the number of autologous FAP-expressing cells in ascites samples.

[0950] Example 11

[0951] EnAd viruses expressing recombinant bispecific T cell engagers were engineered, produced, and purified using the methods described below.

[0952] Generation of Enadenotucirev Expressing a Bispecific T Cell Engager

[0953] EnAd is a replication-competent chimeric group B adenovirus containing frequent nonhomologous nucleotide substitutions of Ad3 in the E2B region of Ad11p, a nearly complete E3 deletion, and a smaller E4 deletion located at E4 or f4 (Kuhn et al., Directed evolution generates novel oncolytic viruses for the treatment of colon cancer. PLoS One, 2008 Jun 18;3(6):e2409). A schematic diagram of the adenoviral genome used in this study is shown in Figure 18 A.

[0954] Plasmid pEnAd2.4 was used to generate plasmids pEnAd2.4-CMV-EpCAM bispecific T cell engager, pEnAd2.4-SA-EpCAM bispecific T cell engager, pEnAd2.4-CMV-FAP bispecific T cell engager, pEnAd2.4-SA-FAP bispecific T cell engager, pEnAd2.4-CMV-control bispecific T cell engager, and pEnAd2.4-SA-control bispecific T cell engager (Table 4) by directly inserting a cassette encoding an EpCAM bispecific T cell engager (SEQ ID NO: 1), a FAP bispecific T cell engager (SEQ ID NO: 3), or a control bispecific T cell engager (SEQ ID NO: 5). The transgene cassette contained a 5' short-splicing acceptor sequence (SEQ ID NO: 33) or an exogenous CMV promoter (SEQ ID NO: 31), an EpCAM, FAP, or control bispecific T cell engager cDNA sequence, and a 3' polyadenylation sequence (SEQ ID NO: 32). The construction of the plasmid was confirmed by DNA sequencing. The exogenous CMV promoter is constitutively active and therefore results in early expression of the transgene. The splice acceptor sequence drives expression under the control of the viral major late promoter and results in later transgene expression after viral genome replication has begun. The kinetics of expression driven by this promoter can be seen in Figure 18 Observed in B, where GFP was used as a transgene.

[0955] Table 4

[0956]

[0957]

[0958] Virus production and characterization

[0959] Plasmids EnAd2.4-CMV-EpCAM bispecific T cell adapter, pEnAd2.4-SA-EpCAM bispecific T cell adapter, pEnAd2.4-CMV-FAP bispecific T cell adapter, pEnAd2.4-SA-FAP bispecific T cell adapter, pEnAd2.4-CMV-control bispecific T cell adapter, and pEnAd2.4-SA-control bispecific T cell adapter were linearized by restriction digestion with the enzyme AscI to produce linear viral genomes. The digested DNA was purified by isopropanol extraction and precipitated in 300 μl>95% molecular biology grade ethanol and 10 μl 3M sodium acetate at -20°C for 16 hours. The precipitated DNA was precipitated by centrifugation at 14000 rpm for 5 minutes and washed in 500 μl 70% ethanol, then centrifuged again at 14000 rpm for 5 minutes. The clean DNA pellet was air dried and resuspended in 100 μL water. 6.25 μg DNA was mixed with 15.6 μL liposome transfection reagent in OptiMEM and incubated at room temperature for 20 minutes. The transfection mixture was then added to a T-25 flask containing Ad293 cells grown to 80% confluence. After the cells were incubated with the transfection mixture at 37°C for 4 hours, 5% CO2 4ml of cell culture medium (DMEM high glucose and glutamine supplemented with 10% FBS) was added to the cells and the flasks were incubated at 37°C, 5% CO2. The transfected Ad293 cells were monitored every 24 hours and additional culture medium was added every 48 to 72 hours. Viral production was monitored by observing significant cytopathic effect (CPE) in the cell monolayer. Once extensive CPE was observed, virus was collected from the Ad293 cells by three freeze-thaw cycles. The collected lysate was serially diluted and reinfected with Ad293 cells, and single virus clones were selected by collecting wells containing single plaques. Once the infection reached complete CPE, serial infection of Ad293 cells was performed to amplify the viral stock. The production of viable virus during amplification was confirmed by observing significant CPE in the cell monolayer.

[0960] Virus purification

[0961] Once amplified, the effective viral stock was purified by double cesium chloride density gradient centrifugation (banding) to produce NG-601, NG-602, NG-603, NG-604, NG-605 and NG-606 viral stocks. These stocks were titrated by micoBCA assay (Life Technologies) according to the manufacturer's instructions (Table 5).

[0962] Table 5

[0963]

[0964] Example 12

[0965] The activity of NG-601, NG-602, NG-603, NG-604, NG-605, and NG-606 viruses was characterized using the methods described below.

[0966] Characterization of bispecific T cell engagers encoding EnAd activity compared to EnAd in cancer cell lines

[0967] The ability of NG-601, NG-602, NG-603, NG-604, NG-605, NG-606, or EnAd to replicate was analyzed by infecting A549 lung cancer cells and evaluated by qPCR. 5 The cells were seeded in the wells of a 24-well plate at a cell density of 10 cells / well. The plates were incubated at 37°C, 5% CO2 for 18 hours, and the cells were then infected with 100 virus particles (ppc) per cell or kept uninfected. Wells were collected 24 hours, 48 ​​hours, or 72 hours after infection, and DNA was purified using the PureLink genomic DNA micro kit (Invitrogen) according to the manufacturer's protocol. The total viral genome was quantified by qPCR for each extracted sample or standard using the EnAd hexon gene-specific primer-probe set in the reaction mixture detailed in Table 6. qPCR was performed according to the procedure in Table 7.

[0968] Table 6

[0969]

[0970]

[0971] Table 7

[0972]

[0973] Quantification of the number of viral genomes detected per cell demonstrated that NG-601, NG-602, NG-603, NG-604, NG-605, NG-606, and EnAd viral replication was comparable in the A549 cell line ( Figure 19 A).

[0974] The oncolytic activity of NG-601, NG-602, NG-603, NG-604, NG-605, NG-606, or EnAd was evaluated by infecting A549 cells ( Figure 19 B) A549 cells were cultured at 1.5×10 4 Cells were seeded at a density of 10 cells / well in 96-well plates. The plates were incubated at 37°C, 5% CO2 for 18 hours and then incubated with increasing amounts of ppc virus (5-fold serial dilutions, 4.1×10 -7 Cells were infected with up to 5000 virus ppc) or kept uninfected. AQueous One-Solution Cell Proliferation Assay Kit (CellTiter A549 cytotoxicity was measured using the AQueous One Solution Cell Proliferation Assay (MTS) (Promega, #G3582). Dose-response curves were fitted using a four-parameter nonlinear fitting model integrated into GraphPad Prism. The IC50 values ​​generated for each virus demonstrated that the oncolytic activity of NG-601, NG-602, NG-603, NG-604, NG-605, NG-606, and EnAd was comparable for each virus.

[0975] Confirmation of functional bispecific T cell engager transgene expression from NG-601, NG-602, NG-603, NG-604, NG-605, and NG-606

[0976] To determine whether the viruses NG-601, NG-602, NG-605, and NG-606 generate functional bispecific T cell engagers, T cell activation assays were performed using CHO, CHO-EpCAM, and CHO-FAP cell lines as target cells. 10,000 target cells were co-cultured with 50,000 CD3 + T cells were co-cultured in wells of a U-bottom 96-well plate, in which Ad293 viral supernatant was diluted 100-fold in culture medium and incubated for 24 hours at 37°C, 5% CO2. T cells were harvested and stained with antibodies specific for CD25 and CD69 and analyzed by flow cytometry. Results ( Figure 20A and Figure 20B) indicator viruses NG-601 and NG-602 express a functional bispecific T cell engager transgene that activates T cells when co-cultured with CHO-EpCAM cells, and NG-605 and NG-606 express a functional bispecific T cell engager transgene that activates T cells when co-cultured with CHO-FAP cells but not with CHO cells.

[0977] Quantification of bispecific T cell engager expression in colon cancer cell lines

[0978] The expression of bispecific T cell engagers was evaluated in human colon cancer cell line DLD infected with NG-601, NG-602, NG-605, and NG-606. DLD cells were plated at 1.2 × 10 6 DLD cells were seeded at a density of 100 cells / mL in 6-well culture plates. 18 hours after seeding, DLD cells were infected with 100 ppc of EnAd, NG-601, NG-602, NG-603, NG-604, NG-605, and NG-606. The cells were cultured for 72 hours, after which the supernatant was collected from the wells and centrifuged at 1200 rpm for 5 minutes to remove cell debris. The clarified supernatant was then used in a killing assay and compared to a standard curve generated with known concentrations of recombinant bispecific T cell engagers for cytotoxicity, thereby enabling the determination of the amount of bispecific T cell engager in the viral supernatant.

[0979] To determine the amount of FAP bispecific T cell engagers generated from NG-605 and NG-606, a cytotoxicity assay was performed in which 8,000 NHDFs were incubated with 40,000 CD3 + T cells were co-cultured and DLD virus supernatant was diluted to 1 / 10 3 , 1 / 10 4 and 1 / 10 5 By diluting NHDF and CD3 + T cells were co-cultured with FAP or control bispecific T cell engagers in 10-fold serial dilutions from 3333 to 3.33 x 10 -4 ng / μL were incubated to generate a standard curve. Supernatants were collected 24 hours after treatment and cytotoxicity was measured by LDH assay. The amount of bispecific T cell engager expressed was determined by comparing the cytotoxicity of the viral supernatant with the cytotoxicity of the recombinant bispecific T cell engager standard curve. Results ( Figure 21 ) The indicator viruses NG-605 and NG-606 produced 9.8 μg and 49.2 μg of FAP bispecific T cell engager per million DLD cells, respectively.

[0980] To determine the amount of EpCAM bispecific T cell engagers produced from NG-601 and NG-602, a cytotoxicity assay was performed in which 8,000 DLD cells were incubated with 40,000 CD3 + T cells were cultured in a co-chamber and DLD virus supernatant was diluted to 1 / 10 3 , 1 / 10 4 and 1 / 10 5 By diluting DLD and CD3 + T cells were co-cultured with EpCAM or control bispecific T cell engagers in 10-fold serial dilutions from 3333 to 3.33 x 10 -4 ng / μL were incubated to generate a standard curve. Supernatants were collected 24 hours after treatment and cytotoxicity was measured by LDH assay ( Figure 22 The amount of bispecific T cell engager expressed was determined by comparing the cytotoxicity of the viral supernatant with the cytotoxicity of a recombinant bispecific T cell engager standard curve. The results indicated that the viruses NG-601 and NG-602 produced 165 μg and 50.3 μg of EpCAM bispecific T cell engager per million DLD cells, respectively.

[0981] Example 13

[0982] In addition to encoding FAP or a control bispecific T cell engager, the NG-607, NG-608, NG-609, and NG-610 viruses also carry a red fluorescent protein (RFP) transgene for visualization of infected cells using fluorescence microscopy (SEQ ID NOs: 25 and 26, Table 4). The functional activity of these viruses was characterized using the methods described below.

[0983] Confirmation of transgene expression from NG-607, NG-608, NG-609, and NG-610

[0984] The ability of viruses NG-607, NG-608, NG-609, and NG-610 to produce their bispecific T cell engager transgenes was assessed by infecting Ad293 cells. Ad293 cells were plated at 1 × 10 6 Cells / well were seeded in 6-well plates. The plates were incubated at 37°C, 5% CO2 for 24 hours, and then the cells were infected with 100 ppc of virus or kept uninfected. 48 hours after infection, plaques were illuminated with a fluorescent mercury lamp and photographed ( Figure 23 The results showed that viruses NG-607, NG-608, NG-609 and NG-610 expressed the RFP transgene.

[0985] Example 14

[0986] In the next series of experiments, the ability of EnAd and FAP or control bispecific T cell engager viruses NG-603, NG-604, NG-605, NG-606, NG-607, NG-608, NG-609, and NG-610 to kill target cells, including tumor cells and fibroblasts, was evaluated.

[0987] In the first study, the ability of EnAd to kill DLD cells was evaluated using xCELLigence technology. DLD cells were cultured at 1.2 × 10 4 Cells / well were seeded in 48-well E-plates and incubated at 37°C, 5% CO2 for 18 hours. Cells were then infected with 100 EnAd ppc or left uninfected. XCELLigence was used to measure target cell cytotoxicity every 15 minutes during the 8-day incubation period. Results ( Figure 24 A) Demonstrates that EnAd can effectively kill DLD cells within the indicated time period.

[0988] In a similar experiment, the ability of EnAd to kill SKOV cells was evaluated using xCELLigence technology. SKOV cells were plated at 1×10 4 Cells / well were seeded in 48-well E-plates and incubated at 37°C, 5% CO2 for 18 hours, after which cells were infected with 100 EnAd ppc or left uninfected. xCELLigence was used to measure target cell cytotoxicity every 15 minutes over an 8-day period. Results ( Figure 24 B) Demonstrates that SKOV cells are resistant to EnAd-mediated cytotoxicity within this time frame.

[0989] In a similar experiment, the ability of EnAd to kill NHDF cells was also evaluated using xCELLigence technology. NHDF cells were plated at 4 × 10 3 Cells were seeded / well in a 48-well E-plate and incubated at 37°C, 5% CO2 for 18 hours. Cells were then infected with 100 EnAd ppc or left uninfected. xCELLigence was used to measure target cell cytotoxicity every 15 minutes over the same time period as for A549 and SKOV cells. Results ( Figure 24 C) Demonstrates that EnAd is unable to kill NHDF cells within the observed time period.

[0990] In similar experiments, xCELLigence was used to investigate the relationship between SKOV tumor cells and CD3 + The ability of NG-603, NG-604, NG-605, NG-606, and EnAd to kill NHDF cells was evaluated in co-culture with T cells. NHDF cells and SKOV cells were cultured at 4 × 103 and 1×10 3 Cells were seeded per well in a 48-well E-plate. The plates were incubated at 37°C, 5% CO2 for 18 hours, and then the cells were infected with 100 ppc of NG-603, NG-604, NG-605, or NG-606 EnAd or left uninfected. After a 2-hour incubation, 37,500 CD3 + T cells. xCELLigence was used to measure target cell cytotoxicity every 15 minutes. Results ( Figure 25A ) demonstrated that viruses NG-605 and NG606 expressing the FAP bispecific T cell engager, but not EnAd or viruses NG-603 and NG-604 expressing the control bispecific T cell engager, were able to induce lysis of NHDF cells, with the kinetics dependent on the promoter used for bispecific T cell engager expression (the CMV promoter was faster).

[0991] In similar experiments, LDH cytotoxicity assay was used in the presence of SKOV and CD3 + The ability of NG-603, NG-604, NG-605, NG-606, and EnAd to kill NHDF cells was evaluated in co-culture with T cells. NHDF cells and SKOV cells were cultured at 8 × 10 3 and 2×10 3 Cells were seeded per well in a 96-well U-bottom plate and infected with 100 ppc of NG-603, NG-604, NG-605, or NG-606 EnAd or remained uninfected. After 2 hours of incubation, 75,000 CD3 + T cells were plated and incubated at 37°C, 5% CO2. Supernatants were collected at 0, 24, 48, and 96 hours after treatment, and cytotoxicity was measured by LDH cytotoxicity assay. Results ( Figure 25B ) demonstrated that viruses NG-605 and NG606 expressing the FAP bispecific T cell engager, but not EnAd or viruses NG-603 and NG-604 expressing the control bispecific T cell engager, were able to induce lysis of NHDF cells, with the kinetics dependent on the promoter used for bispecific T cell engager expression.

[0992] As an extension of the above LDH experiments, cells were also harvested at 0, 24, 48, and 96 hours post-treatment, stained with antibodies to CD45, CD69, and CD25, and analyzed by flow cytometry. Figure 26) demonstrated that viruses NG-605 and NG-606 expressing the FAP bispecific T cell engager, but not EnAd or viruses NG-603 and NG-604 expressing the control bispecific T cell engager, were able to induce T cell activation, with the kinetics dependent on the promoter used for bispecific T cell engager expression.

[0993] In similar experiments, the dependence on FAP for induction of T cell activation mediated by the FAP bispecific T cell engager was assessed. SKOV cells were plated at 2 × 10 3 cells / well alone or in combination with NHDF cells at 8 × 10 3 Viral particles were added to each well at 100 ppc and the plate was incubated at 37°C, 5% CO2. Two hours later, 75,000 CD3 + T cells were added and the plates were further incubated. 96 hours after infection, cells were harvested and stained for CD45 and CD25 and analyzed by flow cytometry ( Figure 27 A) Results demonstrate that viruses expressing the FAP bispecific T cell engager, NG-605 and NG-606, induce T cell activation only in the presence of FAP-positive NHDF cells.

[0994] In similar experiments, the specificity of promoter-driven (CMV or viral MLP / SA) bispecific T cell engager expression in NG-605 and NG-606 was further investigated. 3 NHDF cells were inoculated at 100 cells / well. 100 virus particles were added to each well and the plates were incubated at 37°C, 5% CO2. Two hours later, 40,000 CD3 cells were added and the plates were further incubated. 72 hours after infection, supernatants were collected and cytotoxicity was measured by LDH cytotoxicity assay. Results ( Figure 27 B) Demonstration that the CMV-driven virus NG-605, but not the SA-driven NG-606, is able to mediate killing of NHDF cells when infected alone.

[0995] The results indicate that both NG-605 and NG-606 are able to induce T cell activation and target cell lysis, although the kinetics differ slightly depending on the promoter used.

[0996] Time-lapse videos were acquired to visualize virus- or T-cell-mediated target cell lysis by recombinant FAP bispecific T cell engagers, EnAd, NG-603, or NG-605. NHDF cells were stained with CellTracker Orange CMTMR Dye (Life Technologies, #C2927) and CD3 chromatin was stained with the CellTrace Violet Cell Proliferation Kit (Life Technologies, #C34557) according to the manufacturer's protocol. + T cells. NHDF was stained at 7.5×10 3 Cells were seeded in 24-well plates at a concentration of 1.35 × 10 4 DLD or SKOV tumor cells were co-cultured. Plates were incubated at 37°C, 5% CO2 for 18 hours. Cells were then treated with 300 ng / mL FAP bispecific T cell engager or infected with 100 ppc of EnAd, NG-603, and NG-605 or remained untreated. After two hours of incubation, 100,000 stained CD3 + T cells were added to the necessary wells. Videos were acquired on a Nikon TE 2000-E Eclipse inverted microscope, capturing images every 15 minutes for 96 hours. Figure 28 Frames from the video are shown in . The results show that recombinant FAP bispecific T cell engager and NG-605, but not EnAd or NG-603, are able to induce rapid lysis of NHDF cells.

[0997] In similar experiments, NHDF cells were stained with CellTracker Green CMFDA Dye (Life Technologies, #C2925) and CD3 chromatin was stained with CellTrace Violet Cell Proliferation Kit (Life Technologies, #C34557) according to the manufacturer's protocol. + T cells. NHDF was stained at 7.5×10 3 Cells were seeded in 24-well plates at a concentration of 1.35 × 10 4 DLD or SKOV tumor cells were co-cultured. The plates were incubated at 37°C, 5% CO2 for 18 hours. The cells were then infected with 100 ppc of NG-607, NG-608, NG-609, or NG-610 or left uninfected. After two hours of incubation, 100,000 stained CD3 +T cells were added to the necessary wells. Videos were acquired on a Nikon TE 2000-EEclipse inverted microscope, capturing images every 15 minutes for 96 hours. Figure 29 Frames from the video are shown in . The results show that all viruses resulted in tumor cell infection (RFP, red fluorescence, positive), but only NG-609 and NG-610 were able to induce rapid lysis of co-cultured NHDF cells.

[0998] Example 15

[0999] In this series of experiments, the ability of EnAd and EpCAM or control bispecific T cell engager viruses NG-601, NG-602, NG-603, and NG-604 to kill target cells, including tumor cells and fibroblasts, was evaluated.

[1000] Characterization of human T cell activation and lysis of EpCAM-positive target cells by EnAd, NG-601, NG-602, NG-603, and NG-604

[1001] Using xCELLigence technology, we evaluated the effects of EnAd and NG-601, NG-602, NG-603, and NG-604 on the expression of cytokines in the presence or absence of CD3 + The ability of T cells to kill DLD tumor cells. DLD cells were cultured at a rate of 1.2×10 4 Cells were seeded per well in a 48-well E-plate. The plates were incubated at 37°C, 5% CO2 for 18 hours, and then the cells were infected with 100 ppc of EnAd or remained uninfected. Two hours after infection, 75,000 CD3 + T cells were added to the necessary wells. XCELLigence was used to measure target cell cytotoxicity every 15 minutes. Results ( Figure 30 ) demonstrated that NG-601 and NG-602 caused significantly faster DLD cytotoxicity in a T cell-dependent manner.

[1002] In similar experiments, the LDH cytotoxicity assay was used to evaluate the cytotoxicity of EnAd and NG-601, NG-602, NG-603, and NG-604 in the presence or absence of CD3 + The ability of T cells to kill DLD tumor cells was tested. DLD cells were cultured at a rate of 2×10 4 Cells were seeded in 96-well U-bottom plates and infected with 100 ppc EnAd or left uninfected. Two hours after infection, 150,000 CD3 +T cells were added to the necessary wells. The plates were incubated at 37°C, 5% CO2 and supernatants were collected and analyzed by LDH cytotoxicity assay at 0, 24, 48 and 72 hours post infection. Results ( Figure 31 ) demonstrated that NG-601 and NG-602 led to faster DLD cytotoxicity in a T cell-dependent manner.

[1003] As an extension of the above LDH experiments, cells were also harvested at 0, 24, 48, and 96 hours post-treatment, stained with antibodies to CD45, CD69, and CD25, and analyzed by flow cytometry to determine CD3 + T cell activation status. Results ( Figure 32 ) demonstrated that viruses NG-601 and NG-602 expressing the EpCAM bispecific T cell engager, but not EnAd or viruses NG-603 and NG-604 expressing a control bispecific T cell engager, were able to induce T cell activation, with the kinetics dependent on the promoter used for bispecific T cell engager expression.

[1004] In another experiment, xCELLigence technology was used to evaluate the effect of NG-601 in the presence or absence of CD3 + The ability of T cells to kill DLD tumor cells at different multiplicity of infection (MOI) was investigated. DLD cells were infected at 2×10 4 Cells were seeded per well in 48-well E-plates. The plates were incubated at 37°C, 5% CO2 for 18 hours, and then infected with NG-601 at an MOI (ppc) ranging from 0.001 to 10 or left uninfected. Two hours after infection, 150,000 CD3 + T cells were added to the necessary wells. xCELLigence was used to measure target cell cytotoxicity every 15 minutes. Results ( Figure 33 ) demonstrated that at an MOI as low as 0.001, NG-601 led to faster DLD cytotoxicity in a T cell-dependent manner.

[1005] In similar experiments, xCELLigence technology was used to evaluate the expression of EnAd and NG-601, NG-602, NG-603, and NG-604 in the presence or absence of CD3 + The ability of T cells to kill SKOV tumor cells. SKOV cells were cultured at a rate of 1×10 4 Cells were seeded in 48-well E-plates. The plates were incubated at 37°C, 5% CO2 for 18 hours, and then infected with EnAd (100 ppc) or left uninfected. Two hours after infection, 50,000 CD3 +T cells were added to the necessary wells. xCELLigence was used to measure target cell cytotoxicity every 15 minutes. Results ( Figure 34 ) showed that SKOV cells were resistant to EnAd-mediated cytotoxicity within the time frame of this study, whereas NG-601 and NG-602 were able to + The presence of T cells induces rapid lysis of SKOV cells.

[1006] In similar experiments, the LDH cytotoxicity assay was used to evaluate the cytotoxicity of EnAd and NG-601, NG-602, NG-603, and NG-604 in the presence or absence of CD3 + The ability of T cells to kill SKOV cells was tested. SKOV cells were cultured at a rate of 2×10 4 Cells / well were seeded in 96-well U-bottom plates and infected with EnAd (100 ppc) or left uninfected. Two hours after infection, 150,000 CD3 + T cells were added to the necessary wells. The plates were incubated at 37°C, 5% CO2 and supernatants were collected and analyzed by LDH cytotoxicity assay at 0, 24, 48 and 72 hours post infection. Results ( Figure 35 ) is consistent with previous data and suggests that SKOV cells are resistant to EnAd-mediated cytotoxicity within this time frame, whereas NG-601 and NG-602 are able to + The presence of T cells induces rapid lysis of SKOV cells.

[1007] As an extension of the above LDH experiments, cells were also harvested at 0, 24, 48, and 96 hours post-treatment, stained with antibodies to CD45, CD69, and CD25, and analyzed by flow cytometry to determine CD3 + The activation state of T cells ( Figure 36 The results demonstrate that viruses NG-601 and NG-602 expressing the EpCAM bispecific T cell engager, but not EnAd or viruses NG-603 and NG-604 expressing the control bispecific T cell engager, are able to induce T cell activation, with the kinetics dependent on the promoter used for bispecific T cell engager expression.

[1008] In similar experiments, the expression of EnAd and NG-601, NG-602, NG-603, and NG-604 from CD3 + Activated CD3 from cancer patients in EpCAM-negative primary ascites samples + T cell capacity. EpCAM-positive DLD cells were plated at 1×10 4100,000 cells were seeded in 96-well U-bottom plates and co-cultured with 100,000 ascites cells (as received). Cells were infected with 100 ppc of viral particles or remained uninfected. After incubation at 37°C for 48 hours, the total cell population was harvested and CD3 expression was determined by flow cytometry. + The expression level of CD25 on T cells. Figure 37 ) demonstrated that viruses NG-601 and NG-602 expressing the EpCAM bispecific T cell engager, but not EnAd or control bispecific T cell engager viruses NG-603 and NG-604, were able to induce patient-derived CD3 + T cell activation of T cells.

[1009] The results indicate that both EpCAM bispecific T cell engager viruses NG-601 and NG-602 are able to induce T cell activation and target cell lysis, although the kinetics differ slightly depending on the promoter used.

[1010] Time-lapse videos were acquired to visualize virus- or T-cell-mediated target cell lysis by recombinant EpCAM bispecific T cell engagers, EnAd, NG-601, or NG-603. NHDF cells were stained with CellTracker Orange CMTMR Dye (Life Technologies, #C2927) and CD3 chromatin was stained with the CellTrace Violet Cell Proliferation Kit (Life Technologies, #C34557) according to the manufacturer's protocol. + T cells. NHDF was stained at 7.5×10 3 Cells were seeded in 24-well plates at a concentration of 1.35 × 10 4 DLD or SKOV tumor cells were co-cultured. Plates were incubated at 37°C, 5% CO2 for 18 hours. Cells were then treated with 300 ng / mL EpCAM bispecific T cell engager or infected with 100 ppc of EnAd, NG-601, or NG-603 or remained untreated. After two hours of incubation, 100,000 stained CD3 + T cells were added to the necessary wells. Videos were acquired on a Nikon TE 2000-E Eclipse inverted microscope, capturing images every 15 minutes for 96 hours. Figure 38 Frames from the video are shown in . The results show that recombinant EpCAM bispecific T cell engager and NG-605 resulted in rapid lysis of DLD and SKOV target cells, while NHDF remained unaffected.

[1011] Example 16

[1012] In this example, EnAd, NG-603, NG-604, NG-605, and NG-606 were evaluated for their effects on FAP from cancer patients. + Activation of autologous tumor-associated lymphocytes from primary malign...

Claims

1. An adenovirus comprising a sequence of formula (I): 5'ITR-B1-B A -B2-B X -B B -B Y -B3-3'ITR(I) in: B1 is a bond or includes: E1A, E1B or E1A-E1B; B A Includes -E2B-L1-L2-L3-E2A-L4; B2 is a key or includes: E3; B X A DNA sequence that is a bond or includes: a restriction site, one or more transgenes, or both; B B Including L5; B Y A DNA sequence that is a bond or includes: a restriction site, one or more transgenes, or both; B3 is a key or includes: E4; wherein the adenovirus encodes a bispecific T cell engager (BiTE) comprising at least two binding domains, wherein at least one of the domains is specific for a surface antigen on an immune cell of interest, such as a T cell of interest; and The adenovirus is EnAd or Ad11.

2. The adenovirus according to claim 1, wherein the adenovirus is EnAd.

3. The adenovirus according to claim 1 or 2, wherein the surface antigen is a component of the T cell receptor complex (TCR), such as selected from CD3, TCR-α and TCR-β.

4. The adenovirus according to claim 3, wherein the surface antigen is CD3, such as CD3ε, CD3γ and CD3δ, specifically CD3ε.

5. The adenovirus according to claim 1 or 2, wherein one of the binding domains in the BiTE is specific for a non-TCR activating protein such as CD31, CD2 and CD277.

6. Adenovirus according to any one of claims 1 to 5, wherein one of the binding domains is specific for a tumor antigen, such as CEA; MUC-1; EpCAM; HER receptors HER1, HER2, HER3, HER4; PEM; A33; G250; carbohydrate antigen Le y ,Le x ,Le b ; PSMA; TAG-72; STEAP1; CD166; CD24; CD44; E-cadherin; SPARC; ErbB2 and ErbB3.

7. The adenovirus according to claim 6, wherein one of the binding domains is specific for EpCAM.

8. The adenovirus according to any one of claims 1 to 7, wherein one of the binding domains is specific for a tumor stromal antigen, such as fibroblast activation protein (FAP), TREM1, IGFBP7, FSP-1, platelet-derived growth factor-alpha receptor (PDGFR-α), platelet-derived growth factor-beta receptor (PDGFR-β), and vimentin.

9. The adenovirus according to claim 8, wherein one of the binding domains is specific for FAP.

10. The adenovirus according to claim 8 or 9, wherein the matrix antigen is an antigen selected from the group consisting of myeloid-derived suppressor cell antigen, tumor-associated macrophage, and a combination thereof.

Images