SiRNA group for inhibiting KRAS gene expression, and delivery system and application thereof

Abstract

The invention provides an siRNA (small interfering Ribonucleic Acid) group for inhibiting the expression of a KRAS gene, wherein the siRNA group is selected from at least one of siR-1178, siR-468, siR-662 and siR-601; the sequences of the primers are respectively as shown in SEQ ID NO.1 to SEQ ID NO.8; meanwhile, the invention further provides an in-vivo self-assembly delivery system containing the siRNA group and application of the in-vivo self-assembly delivery system in preparation of drugs for treating pancreatic cancer. The siRNA group provided by the invention can effectively inhibit KRAS gene expression and improve the knock-down efficiency of KRAS protein in a pancreatic cancer cell line. And a targeting tag in the nucleic acid delivery system can promote the siRNA group to quickly reach a target organ and a target tissue, so that the action effect of targeting pancreatic cancer cells is further promoted. The detection result of the pancreatic cancer in-situ tumor shows that the treatment effect is accurate and efficient, and the influence of immunoreaction is smaller.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an siRNA group for inhibiting KRAS gene expression, a delivery system thereof, and an application thereof in preparing a drug for treating pancreatic cancer. Technical Background

[0002] Pancreatic cancer (PC) is a malignant tumor that occurs in the pancreas. Since the normal pancreas is mainly composed of exocrine acinar cells that secrete digestive enzymes, endocrine acinar cells that secrete hormones such as insulin and glucagon, ductal cells with the ability to secrete bicarbonate, and a small number of stellate cells, primary pancreatic cancer usually occurs from the above cell types, mainly including pancreatic ductal adenocarcinoma (PDAC), neuroendocrine tumors (PNET), pancreatic acinar cell carcinoma (ACC), etc. Among them, because pancreatic ductal adenocarcinoma (PDAC) accounts for about 90% of all pancreatic cancer types, pancreatic ductal adenocarcinoma is usually used to refer to pancreatic cancer in most studies.

[0003] Pancreatic cancer is a highly lethal cancer. Worldwide, there were 496,000 new cases of pancreatic cancer in 2020, ranking 14th after bladder cancer and non-Hodgkin's lymphoma. The number of new deaths from pancreatic cancer was 466,000, ranking seventh among all cancers. Due to the lack of early diagnosis methods, most pancreatic cancer patients have already developed distant metastasis when they are diagnosed and cannot undergo surgery. At the same time, pancreatic cancer is not sensitive to various treatment methods such as radiotherapy, chemotherapy, and immunotherapy. Its 5-year survival rate is less than 10%, which is much lower than other cancers.

[0004] The KRAS gene is a tumor-driving gene, and its overexpression and mutation usually cause tumors and other related diseases to varying degrees. The KRAS gene plays a very important role in the development of pancreatic cancer. Most pancreatic cancer patients carry KRAS gene mutations, and G12D mutations account for the vast majority, about 70-85% or more.

[0005] siRNA is a type of small RNA sequence, usually a double-stranded RNA of 20-25 nt. siRNA can bind to the coding region (CDS) of the target gene, causing degradation of the mRNA level and blocking protein translation. A large number of studies have shown that siRNA can act on a variety of target genes, thereby treating various diseases caused by the gene. Summary of the invention

[0006] In view of the above-mentioned technical limitations, the present invention proposes a siRNA group for inhibiting KRAS gene expression, a delivery system thereof and use thereof in the preparation of a drug for treating pancreatic cancer; which overcomes the deficiencies and defects mentioned in the background technology.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] The inventive point of the present invention is to provide a siRNA group for inhibiting KRAS gene expression, wherein the siRNA group is selected from at least one of siR-1178, siR-468, siR-662 and siR-601; the forward sequence of the siR-1178 is the sequence shown in SEQ ID NO.1, and the reverse sequence of the siR-1178 is the sequence shown in SEQ ID NO.2; the forward sequence of the siR-468 is the sequence shown in SEQ ID NO.3, and the reverse sequence of the siR-468 is the sequence shown in SEQ ID NO.4; the forward sequence of the siR-662 is the sequence shown in SEQ ID NO.5, and the reverse sequence of the siR-662 is the sequence shown in SEQ ID NO.6; the forward sequence of the siR-601 is the sequence shown in SEQ ID NO.7, and the reverse sequence of the siR-601 is the sequence shown in SEQ ID NO.8.

[0009] The sequence shown in SEQ ID NO.1 is:

[0010] ccaattagaaggtctcaactg;

[0011] The sequence shown in SEQ ID NO.2 is:

[0012] cagttgagcttctaattgg;

[0013] The sequence shown in SEQ ID NO.3 is:

[0014] atatcttcaaatgatttagta;

[0015] The sequence shown in SEQ ID NO.4 is:

[0016] tactaaattttgaagatat;

[0017] The sequence shown in SEQ ID NO.5 is:

[0018] tatagaaggcatcatcaacac;

[0019] The sequence shown in SEQ ID NO.6 is:

[0020] gtgttgattgccttctata;

[0021] The sequence shown in SEQ ID NO.7 is:

[0022] ataacttcttgctaagtcctg;

[0023] The sequence shown in SEQ ID NO.8 is:

[0024] caggacttcaagaagttat.

[0025] Optionally, the above-mentioned siRNA group for inhibiting KRAS gene expression is siR-662 and / or siR-601.

[0026] Optionally, the above-mentioned siRNA group for inhibiting KRAS gene expression is a directly tandem siR-662 and siR-601 sequence or a tandem siR-662 and siR-601 sequence via a Linker sequence.

[0027] The siRNA group used to inhibit KRAS gene expression has a sequence as shown in SEQ ID NO.9:

[0028] ctggaggcttgctgaaggctgtatgctgtatagaaggcatcatcaacacgttttggccactgactgacgtgttgattgcctctctatacagga cacaaggcctgttactagcactcacatggaacaaatggcccagatcctggaggcttgctgaaggctgtatgctgataacttcttgctaagtcctg gttttggccactgactgaccaggacttcaagaagttatcaggacacaaggcctgttactagcactcacatggaacaaatggcc.

[0029] In the above siRNA sequence:

[0030] The base sequences from 1 to 27 and 139 to 165 are 5'-miR-155flank sequences;

[0031] The base sequences at positions 29-49 and 167-187 are 662-siRNA sequence and 601-siRNA sequence;

[0032] The base sequences from positions 50 to 68 and 188 to 206 are loop sequences;

[0033] The base sequences at positions 69-87 and 207-225 are the 662-siRNA reverse sequence and the 601-siRNA reverse sequence;

[0034] The base sequences at positions 88-132 and 226-270 are 3'-miR-155flank sequences.

[0035] The second inventive point of the present invention is to provide a nucleic acid delivery system, which includes a delivery vector; the delivery vector carries the above-mentioned siRNA group and / or at least one targeting tag with targeting function, and the delivery vector can be enriched in the host's organ tissue and spontaneously form a composite structure containing the siRNA group endogenously in the host's organ tissue.

[0036] Optionally, in the above-mentioned nucleic acid delivery system, the targeting tag is selected from a targeting peptide component or a targeting protein component with a targeting function; the targeting peptide includes RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, and MSP targeting peptide; the targeting protein includes RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.

[0037] The preferred targeting tag is the PTP targeting peptide, and the more preferred one is the pancreatic cancer targeting peptide PTP (specific sequence is KTLLPTP). During use, the KTLLPTP sequence is fused with the LAMP2 protein to jointly exert a targeting effect.

[0038] Optionally, in the above-mentioned nucleic acid delivery system, the organ tissue is liver, kidney and / or lung, and the composite structure is exosome.

[0039] Optionally, in the above-mentioned nucleic acid delivery system, the delivery vector is a viral vector or a non-viral vector; the viral vector includes adeno-associated viral vector, adenoviral vector, retroviral vector, and the non-viral vector includes plasmid vector, liposome vector, cationic polymer vector, nanoparticle vector, and multifunctional envelope nanocarrier.

[0040] The third inventive aspect of the present invention is to provide a KRAS gene silencing kit, wherein the kit contains the above-mentioned siRNA group or the above-mentioned nucleic acid delivery system.

[0041] The fourth inventive aspect of the present invention is to provide a KRAS gene silencing preparation, wherein the preparation contains the above-mentioned siRNA group or the above-mentioned nucleic acid delivery system.

[0042] The fifth inventive aspect of the present invention is to provide the use of the above-mentioned siRNA group, the above-mentioned nucleic acid delivery system, the above-mentioned kit or the above-mentioned preparation in the preparation of a drug for treating pancreatic cancer.

[0043] Compared with the prior art, the present invention has the following advantages:

[0044] The present invention provides an siRNA group for inhibiting KRAS gene expression, a delivery system thereof, and use thereof in the preparation of a drug for treating pancreatic cancer. The siRNA group has a certain knockdown efficiency, especially the siR-662 sequence, the siR-601 sequence, and the use of the two in series, which further improves the knockdown efficiency in pancreatic cancer cell lines.

[0045] The nucleic acid delivery system contains not only the siRNA group that plays a role, but also a targeting tag (targeting peptide element), which can enable the siRNA group to quickly reach the target organ and target tissue, further improving the effect of targeting pancreatic cancer cells. The delivery carrier in this nucleic acid delivery system can be enriched in the organ tissues of the host such as the liver, and can be assembled to form complex structures such as exosomes. The test results for pancreatic cancer tumor in situ show that its precision treatment effect is more superior, and it also effectively reduces the impact of immune response on drugs / preparations. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 Schematic diagram of the design positions of KRAS mRNA and siRNA.

[0047] Figure 2 Schematic diagram of the construction of the core components of the gene circuit containing siRNA.

[0048] Figure 3 Schematic diagram of the knockdown effect of KRAS by a single siRNA in the siRNA group, showing the comparison of KRAS protein expression levels detected by Western Blot after transfection of human pancreatic cancer cell lines PANC-1 and MIAPaCa-2 with plasmid elements constructed with siRNA.

[0049] Figure 4 Schematic diagram of the construction of the core components of the double siRNA (siR662+siR601) tandem gene loop.

[0050] Figure 5Schematic diagram of the knockdown effect of KRAS by tandem siRNA, showing the comparison of KRAS protein expression levels detected by Western Blot after transfection of human pancreatic cancer cell lines PANC-1 and MIA PaCa-2 with plasmid elements constructed by two siRNAs, siR662 and siR601, alone or in tandem (the inhibitory effect is better after tandem).

[0051] Figure 6 The results of qPCR analysis of the inhibitory effects of siR662 and siR601 alone and in tandem on KRAS mRNA in PANC-1 and MIA PaCa-2.

[0052] Figure 7 Comparison of the expression levels of siR601 and siR662 detected by qRT-PCR when used alone and in tandem.

[0053] Figure 8 Schematic diagram of the composition of targeting peptide gene elements and experimental design.

[0054] Fig. 9 Characterization of exosomes secreted by HEK 293T cells after transfection of gene components; Fig. 9 A is the particle size and purity of exosomes detected by NTA, Fig. 9 B is the morphology of exosomes detected by transmission electron microscopy, Scale bar: 100nm, Fig. 9 C is immunoblotting analysis of exosome protein markers.

[0055] Fig.10 These are the results of the exosome co-culture experiment detecting the targeting effect of PTP-exo on human pancreatic cancer cell lines (PANC-1, MIA PaCa-2 and AsPC-1) (pKH26 staining).

[0056] Fig.11 These are the results of the exosome co-culture experiment detecting the targeting effect of PTP-exo on human pancreatic cancer organoids (three types: PDACO67, PDACO84 and PDACO02) (pKH26 staining).

[0057] Fig.11 This is the result of in vivo imaging to detect the targeting of PTP-exo after tail vein injection of tumor-bearing mice.

[0058] Fig.12 Imaging detection of various organs in living tumor-bearing mice after exosome injection.

[0059] Fig.13 In vivo imaging was used to detect tumor distribution in tumor-bearing mice after exosome injection.

[0060] Fig.14 Characterization of serum exosomes in mice after injection of gene components; Fig.14 A is the particle size and purity of exosomes detected by NTA, Fig.14 B is the morphology of exosomes detected by transmission electron microscopy, Scale bar: 100nm, Fig.14 C is immunoblotting analysis of exosome protein markers.

[0061] Fig.15 The exosome co-culture experiment was used to detect the targeting effect of serum-derived PTP-exo on human pancreatic cells.

[0062] Fig.16 The figure shows the changes of GFP fluorescence expression in cells after transfection with GPF-siRNA.

[0063] Fig.17 The changes in GFP fluorescence expression in various tissues after tail vein injection of GPF-siRNA.

[0064] Fig.18 The changes of GFP fluorescence expression in tumor tissue after tail vein injection of GPF-siRNA. Fig.18 A is in vivo imaging, Fig.18 B is the slice image.

[0065] Fig.19 The CCK8 experiment detects the effect of gene circuits on the proliferation of pancreatic cancer cells.

[0066] Fig. 20 Cell-derived and serum-derived siRNA-exosomes inhibit the expression of KRAS in pancreatic cancer.

[0067] Fig.21 Cell-derived and serum-derived siRNA-exosomes inhibit the proliferation of pancreatic cancer cells.

[0068] Fig. 22 Schematic diagram of the experimental operation for the treatment of pancreatic tumor in situ (i.e., the in vivo experimental design of this gene circuit).

[0069] Fig.23 The results of tumor volume in the pancreatic tumor in situ treatment experiment are shown.

[0070] Fig.24 This is the statistical comparison result of pancreatic tumor in situ tumor weight data.

[0071] Fig.25 Results of testing the metabolic rates of gene components in mice.

[0072] Fig.26 Summary of the main distribution of self-assembled siRNA in different tissues after the gene assembly was injected into mice.

[0073] Fig. 27 The pharmacokinetic test results of the plasmid backbone metabolism in mice are used to clarify the metabolic (degradation) rate of the plasmid in the liver.

[0074] Fig.28 These are the safety test results of the plasmid containing tandem siR601 and siR662 in various organs in vivo (histological examination of liver, heart, lung, spleen, kidney, and pancreatic tissues).

[0075] Fig.29 This is the structural diagram of plasmid A, namely PTP-si-1.

[0076] Fig.30 This is the structural diagram of plasmid B, namely PTP-si-6.

[0077] Fig.31 This is a structural diagram of the siRNA tandem plasmid. DETAILED DESCRIPTION

[0078] In order to make the purpose, technical solution and advantages of the present invention more clear, the present invention is further described in detail below. However, it should be understood that the description herein is only used to explain the present invention and is not used to limit the scope of the present invention.

[0079] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention, and the terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The reagents and instruments used herein are all commercially available, and the characterization means involved can refer to the relevant descriptions in the prior art, which will not be repeated herein.

[0080] In order to further understand the present invention, the present invention is further described in detail below in conjunction with the best embodiment.

[0081] Example 1

[0082] The siRNA group for inhibiting KRAS gene expression is selected from at least one of siR-1178, siR-468, siR-662 and siR-601; the forward sequence of siR-1178 is the sequence shown in SEQ ID NO.1, and the reverse sequence of siR-1178 is the sequence shown in SEQ ID NO.2; the forward sequence of siR-468 is the sequence shown in SEQ ID NO.3, and the reverse sequence of siR-468 is the sequence shown in SEQ ID NO.4; the forward sequence of siR-662 is the sequence shown in SEQ ID NO.5, and the reverse sequence of siR-662 is the sequence shown in SEQ ID NO.6; the forward sequence of siR-601 is the sequence shown in SEQ ID NO.7, and the reverse sequence of siR-601 is the sequence shown in SEQ ID NO.8.

[0083] The four siRNAs in the siRNA group can be used alone to inhibit the expression of the KRAS gene, or they can be used together, among which siR-662 and siR-601 have relatively better inhibitory effects.

[0084] The sequence shown in SEQ ID NO.1 is:

[0085] ccaattagaaggtctcaactg;

[0086] The sequence shown in SEQ ID NO.2 is:

[0087] cagttgagcttctaattgg;

[0088] The sequence shown in SEQ ID NO.3 is:

[0089] atatcttcaaatgatttagta;

[0090] The sequence shown in SEQ ID NO.4 is:

[0091] tactaaattttgaagatat;

[0092] The sequence shown in SEQ ID NO.5 is:

[0093] tatagaaggcatcatcaacac;

[0094] The sequence shown in SEQ ID NO.6 is:

[0095] gtgttgattgccttctata;

[0096] The sequence shown in SEQ ID NO.7 is:

[0097] ataacttcttgctaagtcctg;

[0098] The sequence shown in SEQ ID NO.8 is:

[0099] caggacttcaagaagttat.

[0100] The siRNA group is preferably siR-662 and / or siR-601. When siR-662 and siR-601 are selected, the two are connected in series directly or in series through a linker sequence and act together.

[0101] The siRNA group used to inhibit KRAS gene expression has a sequence as shown in SEQ ID NO.9:

[0102] ctggaggcttgctgaaggctgtatgctgtatagaaggcatcatcaacacgttttggccactgactgacgtgttgattgcctctctatacagga cacaaggcctgttactagcactcacatggaacaaatggcccagatcctggaggcttgctgaaggctgtatgctgataacttcttgctaagtcctg gttttggccactgactgaccaggacttcaagaagttatcaggacacaaggcctgttactagcactcacatggaacaaatggcc.

[0103] In the above siRNA sequence:

[0104] The base sequences from 1 to 27 and 139 to 165 are 5'-miR-155flank sequences;

[0105] The base sequences at positions 29-49 and 167-187 are 662-siRNA sequence and 601-siRNA sequence;

[0106] The base sequences from positions 50 to 68 and 188 to 206 are loop sequences;

[0107] The base sequences at positions 69-87 and 207-225 are the 662-siRNA reverse sequence and the 601-siRNA reverse sequence;

[0108] The base sequences at positions 88-132 and 226-270 are 3'-miR-155flank sequences.

[0109] A nucleic acid delivery system containing the above siRNA group, wherein the delivery system comprises a delivery vector; the delivery vector carries the siRNA group and / or at least one targeting tag with a targeting function, and the delivery vector can be enriched in the host's organ tissue and spontaneously form a composite structure containing the siRNA group endogenously in the host's organ tissue.

[0110] The targeting tag is selected from a targeting peptide component or a targeting protein component with a targeting function; the targeting peptides include RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, and MSP targeting peptide; the targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.

[0111] The preferred targeting tag is the PTP targeting peptide, and the more preferred one is the pancreatic cancer targeting peptide PTP (specific sequence is KTLLPTP). During use, the KTLLPTP sequence is fused with the LAMP2 protein to jointly exert a targeting effect.

[0112] The organ tissue is liver, kidney and / or lung, and the composite structure is exosome.

[0113] The delivery vector is a viral vector or a non-viral vector; the viral vector includes adeno-associated viral vector, adenoviral vector, and retroviral vector; the non-viral vector includes plasmid vector, liposome vector, cationic polymer vector, nanoparticle vector, and multifunctional envelope nanocarrier.

[0114] The above-mentioned siRNA group or the above-mentioned nucleic acid delivery system can also be integrated into specific products, such as a KRAS gene silencing kit, a KRAS gene silencing preparation, and the like.

[0115] The use of such siRNA group, nucleic acid delivery system, kit or preparation in the preparation of a drug for treating pancreatic cancer can be used for the treatment of pancreatic cancer.

[0116] Example 2

[0117] 1. Design and construction of siRNA and construction and effect verification of plasmid:

[0118] The siRNA group was designed for the CDS region and 3'-UTR region of human KRAS mRNA, with a total of four siRNAs, namely siR-468, siR-601, siR-662, siR-1178 ( Figure 1 ) and inserted it together with the control scrR sequence into the core plasmid element carrying eGFP ( Figure 2), and the KRAS protein expression was detected by WB after transfection of human pancreatic cancer cell lines PANC-1 and MIA PaCa-2. Both siRNAs siR662 and siR601 showed high knockdown efficiency in both cell lines ( Figure 3 ).

[0119] The specific process of the above-mentioned Western blot detection method is as follows:

[0120] 1) Calculate the sample loading amount according to the measured protein concentration, load the sample carefully, and add protein markers on both sides; use the constant voltage mode when running the gel; when concentrating the protein, the voltage is constant at 80V; when the sample runs into the separation gel and the marker begins to separate, adjust the voltage to 120V; determine the running time according to the protein size;

[0121] 2) Transfer: Use PVDF membrane for transfer; pre-cool the Trans buffer in a -20 degree refrigerator before transfer; activate the PVDF membrane in methanol for 1 minute, and then transfer the membrane in the order of "sponge-filter paper-gel-PVDF membrane-filter paper-sponge"; try to avoid the generation of bubbles during transfer, use the constant current mode during transfer, and set the current to a constant 300mA; to prevent protein degradation, put a pre-cooled ice box in the transfer tank, cover the outside of the transfer tank with ice, and determine the transfer time according to the size of the protein;

[0122] 3) Blocking: Use 5% skim milk (dissolved in TBST) as the blocking solution. After transfer, immerse the membrane in the blocking solution and shake it gently at room temperature for 1 hour. When doing phosphorylated proteins, use 5% BSA for blocking.

[0123] 4) Primary antibody incubation: Prepare the primary antibody (KRAS, GAPDH, etc.) with blocking solution, and then incubate the target protein and internal reference bands separately at 4 degrees overnight;

[0124] 5) Wash the membrane: Recover the primary antibody and wash the strips with TBST solution (1×TBS solution with Tween 20 added) on a shaker for 10 minutes each time, 3 times;

[0125] 6) Secondary antibody incubation: Prepare secondary antibody with blocking solution, then incubate the target protein and internal reference bands separately, shaking gently at room temperature for 1 hour;

[0126] 7) Washing the membrane: Recover the secondary antibody and wash the strips with TBST solution on a shaker for 10 minutes each time, three times;

[0127] 8) Exposure: Use Thermo's Supersignal West Pico chemiluminescent substrate and develop using an exposure machine or film.

[0128] 2. Detection of knockdown effect of simultaneous use of siR662 and siR601:

[0129] The two siRNAs, siR662 and siR601, and their core expression elements were constructed in tandem into the same vector ( Figure 4 ), and similarly transfected PANC-1 and MIA PaCa-2 to test whether si-tandem could increase the knockdown effect of siRNA. The results showed that in both cell lines, siRNA tandem could increase the protein knockdown effect of KRAS compared with the backbone of a single siRNA ( Figure 5 ) and RNA inhibition effects ( Figure 6 At the same time, the expression of siRNA was further detected, and the results of qPCR showed that the tandem connection of two siRNAs would not affect the expression effect of a single siRNA ( Figure 7 ).

[0130] siRNA tandem plasmid construction process:

[0131] Plasmid A: PTP-si-1, containing siR662, the structure of which is as follows Fig.29 Plasmid B: PTP-si-6, containing siR601, its structure is as shown Fig.30 As shown. The siRNA tandem plasmid has a structure as shown Fig.31 shown.

[0132] The specific operation process is as follows:

[0133] Enzyme digestion system 1: react at 37℃ for 30min, then inactivate at 80℃ for 5min (depending on the enzyme instructions);

[0134]

[0135] Enzyme digestion system 2: react at 37℃ for 30min, then inactivate at 80℃ for 5min (depending on the enzyme instructions);

[0136]

[0137] Identification and purification were performed on agarose gel.

[0138] System 1: retain the large fragment of about 6000 bp.

[0139] System 2: Keep a small fragment of about 150 bp.

[0140] After purification and recovery, enzyme-linked reaction was performed according to the instructions of the ligase, and the transformed plate was sequenced.

[0141] 3. Construction and functional verification of pancreatic cancer targeting peptide elements:

[0142] Studies have shown that pancreatic cancer cells overexpress plectin protein (a biomarker for tumor stem cells). Researchers have screened out a Plectin-targeted peptide (PTP) polypeptide sequence with an amino acid sequence of KTLLPTP, which can effectively target pancreatic cancer cells in vitro and in vivo. The sequence was fused to lamp2 and constructed into a targeting peptide component, and the pancreatic cancer targeting effect of the gene component was verified in vitro and in vivo. Figure 8 ).

[0143] The genome was transfected into 293T cells and exosomes were collected ( Fig. 9 ). After PKH26 staining, the exosomes were co-cultured with pancreatic cancer cells or organoids from clinical pancreatic cancer patients. The results showed that the addition of PTP gene elements caused the exosomes to produce eight effects on pancreatic cancer cells ( Fig.10 , 11 ).

[0144] Furthermore, exosomes were injected into mice bearing PANC-1 orthotopic tumors, and fluorescence in tissues was detected by in vivo imaging. The results showed that exosomes injected through the tail vein were mainly enriched in the liver, kidneys, and lungs, and the distribution of exosomes produced by ncPTP and PTP gene components in various organs was basically the same ( Fig.12 ), but PTP-exo is clearly enriched in tumors ( Fig.13 ).

[0145] The gene assembly was injected into the tail vein of mice, and the mouse serum exosomes were collected ( Fig.14 ), and then co-cultured with pancreatic cancer cells after PKH26 staining. The results also showed that the addition of PTP gene elements caused the exosomes to produce a pancreatic cancer cell targeting effect ( Fig.15 ).

[0146] Furthermore, in order to visualize the gene silencing effect of siRNA and the role of PTP, a siRNA gene component targeting GFP (CMV-PTP-siRGFP) and a control gene component (CMV-Flag-siRGFP) were constructed and transfected into GFP-expressing pancreatic cancer cells PANC-1. The expression of GFP fluorescence indicated the gene silencing effect of siRNA ( Fig.16 ). When the siRNA gene assembly was injected into the tail vein of mice expressing GFP throughout the body, the GFP fluorescence expression in all tissues of the mice decreased ( Fig.17 ). The siRNA gene assembly was injected into the tail vein of pancreatic cancer mice once every two days for two weeks. It was found that the gene assembly with the targeting peptide PTP had a better effect on GFP knockdown in the tumor ( Fig.18 ).

[0147] 4. Effect of KRASsi gene assembly on pancreatic cancer cell proliferation:

[0148] Different gene components were transfected into pancreatic cancer cell lines PANC-1, MIAPaCa-2, and SW1990, and the CCK8 assay was used to detect changes in cell proliferation after transfection of gene components. The results showed that ( Fig.19 ), transfection with KRAS siRNA gene loop can significantly inhibit the proliferation ability of pancreatic cancer tumor cells.

[0149] 5. KRASsi-exosomes target and inhibit pancreatic cancer KRAS expression and pancreatic cancer cell proliferation / migration:

[0150] The gene assembly was transfected into 293T cells and exosomes were collected and co-cultured with pancreatic cancer cells; the gene assembly was injected into mice through the tail vein, and mouse serum exosomes were collected and co-cultured with pancreatic cancer cells. The results showed that exosomes inhibited the expression of KRAS and its downstream signaling pathway pERK ( Fig. 20 ) and inhibit cell proliferation ( Fig.21 ).

[0151] 6. The therapeutic effect of PTP-KRASsi gene assembly on pancreatic cancer tumor in situ:

[0152] The mouse pancreatic orthotopic tumor model was established by injecting PANC-1 into the pancreatic tail. Gene components were injected 2 weeks after tumor implantation, once every two days, and the injection lasted for two weeks. Fig. 22 ). The statistical results of pancreatic cancer tumor in situ tumor volume and weight showed that the PTP-S gene component had the best effect ( Fig.23 , 24 ).

[0153] In addition, the metabolic rate of the gene components in the body was tested, and the results showed that Fig.25 show.

[0154] The results of the detection of the distribution of gene components in different tissues are as follows Fig.26 The metabolic kinetics of self-assembled siRNA in serum are shown in Fig. 27 shown.

[0155] In order to verify the safety of the plasmid containing tandem siR601 and siR662 after entering various organs in the body, the gene loop and PBS were injected into mice respectively, and the tissue sections of different injection methods were observed by H&E staining. The results are as follows Fig.28 As shown, none of them caused significant impact on organs.

[0156] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modification, equivalent substitution or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A siRNA group for inhibiting KRAS gene expression, characterized in that: The siRNA group is selected from at least one of siR-1178, siR-468, siR-662 and siR-601; the forward sequence of the siR-1178 is the sequence shown in SEQ ID NO.1, and the reverse sequence of the siR-1178 is the sequence shown in SEQ ID NO.2; the forward sequence of the siR-468 is the sequence shown in SEQ ID NO.3, and the reverse sequence of the siR-468 is the sequence shown in SEQ ID NO.4; the forward sequence of the siR-662 is the sequence shown in SEQ ID NO.5, and the reverse sequence of the siR-662 is the sequence shown in SEQ ID NO.6; the forward sequence of the siR-601 is the sequence shown in SEQ ID NO.7, and the reverse sequence of the siR-601 is the sequence shown in SEQ ID NO.

8.

2. The siRNA group for inhibiting KRAS gene expression according to claim 1, characterized in that: The siRNA group is siR-662 and / or siR-601.

3. The siRNA group for inhibiting KRAS gene expression according to claim 1, characterized in that: The siRNA group is a directly serially connected siR-662 and siR-601 sequence or a serially connected siR-662 and siR-601 sequence via a Linker sequence.

4. A nucleic acid delivery system, characterized in that The delivery system comprises a delivery vector; the delivery vector carries the siRNA group described in any one of claims 1-3 and / or at least one targeting tag with a targeting function, and the delivery vector can be enriched in the organ tissue of the host and spontaneously form a composite structure containing the siRNA group endogenously in the organ tissue of the host.

5. The nucleic acid delivery system according to claim 4, characterized in that The targeting tag is selected from a targeting peptide component or a targeting protein component with a targeting function; the targeting peptide includes RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide, and MSP targeting peptide; the targeting protein includes RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.

6. The nucleic acid delivery system according to claim 4, characterized in that The organ tissue is liver, kidney and / or lung, and the composite structure is exosome.

7. The nucleic acid delivery system according to claim 4, characterized in that The delivery vector is a viral vector or a non-viral vector; the viral vector includes an adeno-associated viral vector, an adenoviral vector, and a retroviral vector; the non-viral vector includes a plasmid vector, a liposome vector, a cationic polymer vector, a nanoparticle vector, and a multifunctional envelope nanocarrier.

8. A KRAS gene silencing kit, characterized in that: The kit contains the siRNA set described in any one of claims 1 to 3 or the nucleic acid delivery system described in any one of claims 4 to 7.

9. A KRAS gene silencing agent, characterized in that: The preparation contains the siRNA group described in any one of claims 1-3 or the nucleic acid delivery system described in any one of claims 4-6.

10. Use of the siRNA set according to any one of claims 1 to 3, the nucleic acid delivery system according to any one of claims 4 to 7, the kit according to claim 8 or the preparation according to claim 9 in the preparation of a drug for treating pancreatic cancer.

Images