A snp molecular marker related to sheep chest circumference and application thereof

By detecting the SNP molecular marker at position 80934959 on chromosome 10 of the sheep genome, combined with KASP technology and a specific primer set, efficient identification and breeding of sheep chest girth traits were achieved, solving the problem of low breeding efficiency in existing technologies and improving breeding efficiency and economic benefits.

CN119592712BActive Publication Date: 2025-10-10INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411951900.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-27
Publication Date
2025-10-10
Estimated Expiration
2044-12-27

AI Technical Summary

Technical Problem

Existing technologies lack efficient SNP sites related to sheep chest circumference, which makes it difficult to accurately select sheep with excellent chest circumference traits during breeding, affecting breeding efficiency and cost.

Method used

A SNP molecular marker located at position 80934959 of chromosome 10 in the sheep genome is provided. The A/G polymorphism of the marker is detected by KASP technology. PCR amplification is performed using a specific primer set and the fluorescent group is analyzed to determine the genotype. Sheep with the AA genotype are selected for breeding.

Benefits of technology

This SNP molecular marker can explain 23.58% of the variance in chest circumference. Through molecular marker-assisted selection and artificial insemination, it can significantly improve breeding efficiency, shorten the generation interval, reduce breeding costs, and improve sheep meat production performance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119592712B_ABST
    Figure CN119592712B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of molecular marker breeding, in particular to a SNP molecular marker related to sheep chest circumference and application thereof. The SNP molecular marker provided by the present application is located at the base at 80934959bp of the chromosome 10 of the sheep genome sequence information ovis_aries_rambouillet_1.0, and A / G polymorphism exists. The SNP molecular marker related to sheep chest circumference discovered by the present application can explain 23.58% of the chest circumference variance variation. Although the chest circumference is controlled by multiple genes, the SNP molecular marker still has a large effect. In the breeding process, the sheep with AA genotype is selected for breed conservation, and the AA genotype is used as breeding, and the G allele needs to be excluded when crossing with other sheep. In particular, the artificial insemination using the semen of the AA genotype ram can greatly improve the breeding efficiency and obtain the sheep group with chest circumference advantage.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker breeding, in particular to a SNP molecular marker associated with sheep chest circumference and application thereof. Background Art

[0002] A sheep's chest girth is one of the most important indicators of its growth and development. This crucial metric is closely linked to its meat production. Generally speaking, sheep with larger chest girths are larger and more muscular, resulting in higher meat production. Measuring chest girth can be used to predict a sheep's meat production performance, providing an important reference for the chest girth trait in meat production and sheep breeding, and is widely used in genetic evaluation. Selecting sheep with excellent chest girth traits for breeding can improve the growth and production performance of offspring. The high genetic stability of the chest girth trait means that the chest girth and overall growth performance of sheep can be continuously improved through genetic improvement.

[0003] Currently, the cost of molecular marker testing has been significantly reduced through advanced molecular marker technologies. KASP (Kompetitive Allele-Specific PCR), a competitive allele-specific PCR, can accurately detect SNPs. It is a high-throughput, low-cost, and low-error-rate SNP typing technology that can be automated and platform-based.

[0004] SNP profiling technology can identify genetic markers associated with sheep chest girth. These markers can be used to assist in the selection of sheep with superior chest girth traits, thereby accelerating the breeding process and improving breeding efficiency. However, sheep chest girth is controlled by multiple genes, and currently, there are no SNP loci associated with sheep chest girth. Summary of the Invention

[0005] To address the above issues, the present invention provides a single-nucleotide polymorphism (SNP) molecular marker associated with sheep chest circumference and its application. The SNP molecular marker provided by the present invention is significantly correlated with sheep chest circumference, explaining 23.58% of the variance in chest circumference. This marker has a significant effect and can be used to identify or assist in identifying sheep chest circumference.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The invention provides a SNP molecular marker associated with sheep chest circumference. The SNP molecular marker is located at the 80934959 bp base on chromosome 10 with the sheep genome sequence information being ovis_aries_rambouillet_1.0, and has an A / G polymorphism.

[0008] Preferably, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, wherein R is A or G.

[0009] The application provides a primer set for detecting the SNP molecular marker, comprising: F1, F2 and R; the nucleotide sequence of the F1 is shown as SEQ ID NO. 2, the nucleotide sequence of the F2 is shown as SEQ ID NO. 3, and the nucleotide sequence of the R is shown as SEQ ID NO. 4; and the F1 and the F2 are labeled with different fluorescent groups.

[0010] Preferably, the fluorescent group comprises FAM, VIC or HEX.

[0011] Preferably, the F1 is labeled with the fluorescent group VIC, and the F2 is labeled with the fluorescent group FAM.

[0012] The application provides an application of the SNP molecular marker or the primer set in identifying or assisting in identifying the chest size of sheep.

[0013] The application provides an application of the SNP molecular marker or the primer set in sheep breeding, and the breeding comprises breeding sheep with a relatively large chest.

[0014] Preferably, the sheep is a Bamei mutton sheep.

[0015] Preferably, the sheep with the genotype AA of the SNP molecular marker is a sheep with a relatively large chest.

[0016] The application provides a method for identifying or assisting in identifying the chest size of sheep, comprising the following steps:

[0017] Taking the genomic DNA of the sheep to be detected as a template, performing PCR amplification on the primer set, and obtaining an amplification product; determining the genotype of the sheep to be detected according to the fluorescent group on the amplification product;

[0018] If the amplification product only contains the fluorescent group labeled by the F1, the genotype of the sheep to be detected is GG.

[0019] If the amplification product only contains the fluorescent group labeled by the F2, the genotype of the sheep to be detected is AA.

[0020] If the amplification product contains the fluorescent groups labeled by the F1 and the F2, the genotype of the sheep to be detected is GA.

[0021] According to the genotype of the sheep to be detected, the chest size of the sheep to be detected is determined: the sheep with the genotype AA is a sheep with a relatively large chest.

[0022] Beneficial effects:

[0023] The present invention provides a single-nucleotide polymorphism (SNP) molecular marker for identifying or assisting in the identification of chest girth in sheep. This SNP marker is located at base 80,934,959 on chromosome 10, as determined by the ovis_aries_rambouillet_1.0 genome sequence (https: / / uswest.ensembl.org / Ovis_aries_rambouillet / Info / Index), and exhibits an A / G polymorphism. Numerous SNP-phenotype association analyses have shown that SNPs significantly associated with complex traits are mostly located in non-coding regions and generally explain only 1-2% of the variance. However, the SNP marker associated with chest girth in sheep (chr10_80934959: G>A) discovered in this invention explains 23.58% of the variance in chest girth. Although chest girth is controlled by multiple genes, this SNP marker still has a significant effect. During breeding, the SNP molecular markers provided by this invention can be used to select sheep with the AA genotype for breed preservation. When breeding with the AA genotype, the G allele needs to be excluded when crossing with other sheep. In particular, artificial insemination using semen from AA genotype rams can greatly improve breeding efficiency and produce flocks with an advantage in chest girth. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0025] Figure 1 This is the KASP typing result diagram of chr10__80934959:G>A;

[0026] Figure 2 Box plot of the residual values ​​after correcting the fixed effects for chest circumference of sheep with different genotypes of chr10__80934959:G>A. DETAILED DESCRIPTION

[0027] The invention provides a SNP molecular marker for identifying or assisting in identifying the chest circumference size of sheep. The SNP molecular marker is located at the 80934959 bp position on chromosome 10 with the sheep genome sequence information being ovis_aries_rambouillet_1.0, and has an A / G polymorphism.

[0028] As an embodiment, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, which is as follows:

[0029] 5'-ACTTTGTTTTCTTCAACTACTGTGCATCAGTTAGCGGCAAAGTGGTG TAGAAGATAACAAGAAGTGACAGGTGCAGCCATTCCTGCTGTGGAGGAAAGAGGGCATCAAGTAAGAAGAGGCAGTGATTGTGAAAAGATGCTTGTGAAATGTTTTTTTAAGACATAGAAGCTTAACACAGTTTTCTTTTTAGAATGATGGCTTRGTAATAGT TAATGACAAGCCATGATGTGGTGTTGACACACACGAGGGGGAAGCAGAGGGTACAGGGCTTGCACTCAGAGTCTCTATCGTTGGTCTTGTGTTCCCAGCCCGTCCTGTGCCACCTGCTTCCTGACGGCCTGGGAAGGGCCTTCCTCTCTGT-3'; where R is A or G.

[0030] The results of a large number of SNP and phenotype association analyses show that SNP sites that are significantly associated with complex traits are mostly located in non-coding regions and can generally only explain 1-2% of the variation. However, the SNP molecular marker (chr10__80934959:G>A) associated with sheep chest circumference discovered by the present invention can explain 23.58% of the variance in chest circumference, which has a large effect. Using the SNP molecular markers provided by the present invention, marker-assisted selection of chest circumference traits can be performed through molecular marker-assisted selection, which can make ultra-early estimates of sheep meat production traits, effectively shorten the generation interval and increase the selection intensity, thereby reducing breeding costs and improving breeding efficiency. Molecular marker-assisted selection combined with artificial insemination can be used to carry out large-scale selection of sheep populations, which can save feed and breeding costs and improve the economic benefits of mutton production. The specific operation includes: selecting sheep with SNP molecular markers with AA genotype for seed preservation during breeding, using AA genotype as breeding sheep during breeding, and excluding sheep with G alleles when hybridizing with other sheep. In particular, artificial insemination using AA genotype ram semen can greatly improve breeding efficiency and obtain a flock with an advantage in chest circumference.

[0031] Based on the above advantages, the present invention provides a primer set for detecting the SNP molecular marker described in the above technical solution, comprising: F1, F2, and R; the nucleotide sequence of F1 is shown in SEQ ID NO. 2, the nucleotide sequence of F2 is shown in SEQ ID NO. 3, and the nucleotide sequence of R is shown in SEQ ID NO. 4; F1 and F2 are labeled with different fluorescent groups. In one embodiment, the fluorescent group includes FAM, VIC, or HEX. In another embodiment, F1 is labeled with the fluorescent group VIC, and F2 is labeled with the fluorescent group FAM.

[0032] The primer set provided by the present invention can use the competitive allele-specific polymerase chain reaction (KASP) technology to detect the SNP molecular markers described in the above technical solution and determine the genotype of the SNP molecular marker, thereby selecting sheep with a homozygous AA genotype to enter the core group, thereby improving the chest girth trait of the sheep and helping to increase economic benefits.

[0033] Based on the above advantages, the present invention provides the use of the SNP molecular marker described in the above technical solution or the primer set described in the above technical solution in identifying or assisting in identifying the chest circumference size of sheep.

[0034] Based on the above advantages, the present invention provides the use of the SNP molecular marker described in the above technical solution or the primer set described in the above technical solution in sheep breeding, wherein the breeding includes breeding sheep with relatively large chest circumference.

[0035] As an embodiment, the sheep are Bamian sheep.

[0036] As an embodiment, the sheep whose genotype of the SNP molecular marker is AA have a relatively larger chest circumference, that is, the chest circumference of the sheep with the genotype of AA is larger than that of the sheep with the genotype of GA or GG.

[0037] Based on the above advantages, the present invention provides a method for identifying or assisting in identifying the chest girth of a sheep, comprising the following steps:

[0038] Using the genomic DNA of the sheep to be tested as a template, PCR amplification is performed using the primer set described in the above technical solution to obtain an amplified product; the genotype of the sheep to be tested is determined based on the fluorescent group on the amplified product;

[0039] If the amplified product contains only the F1-labeled fluorescent group, the genotype of the sheep to be tested is GG;

[0040] If the amplified product contains only the F2-labeled fluorescent group, the genotype of the sheep to be tested is AA;

[0041] If the amplified product contains fluorescent groups labeled F1 and F2, the genotype of the sheep to be tested is GA;

[0042] determining the chest size of the sheep to be tested according to the genotype of the sheep to be tested: the sheep with genotype AA are sheep with relatively large chest size.

[0043] As an embodiment, the method for determining the genotype of the sheep to be tested further comprises: sequencing the amplification product, and determining the genotype of the sheep to be tested according to the sequencing result.

[0044] In order to further illustrate the present application, a SNP molecular marker related to the chest size of sheep and its application provided by the present application are described in detail below in combination with the accompanying drawings and examples, but they should not be understood as limiting the scope of protection of the present application.

[0045] Example 1

[0046] 1. Experimental materials

[0047] 179 Bamei mutton sheep were selected as the detection objects.

[0048] 2. Reagents and instruments

[0049] Reagents: 2x Taq DNA Polymerase Mix;

[0050] PCR amplification: ABI 9700 196 Dual;

[0051] Fluorescence value reading: FLUOstar Omega;

[0052] Fluorescence value analysis: Kluster Caller genotyping software;

[0053] All reagents and instruments were purchased from Beijing Yinnuo Zhongda Biotechnology Co., Ltd.

[0054] 3. Extraction of genomic DNA

[0055] Sheep jugular vein blood was taken, and DNA extraction kit was used for DNA extraction. Genomic DNA of the sheep to be tested was extracted; the DNA was uniformly diluted to 20 ng / μl.

[0056] 4. The sequences of the primers used for PCR amplification are as follows:

[0057] F1 (SEQ ID NO. 2): 5'-GAAGGTCGGAGTCAACGGATTATCATGGCT TGTCATTAACTATTACC-3';

[0058] ​F2 (SEQ ID NO.3): 5'-GAAGGTGACCAAGTTCATGCTCATCATGGC TTGTCATTAACTATTACT-3';

[0059] R (SEQ ID NO.4): 5'-GCTTAACACAGTTTTCTTTTTAGAATG-3';

[0060] Among them, 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO. 5) in F1 is a universal fluorescent linker sequence, labeled with a VIC fluorescent group at the 5' end, and the reverse complement sequence of 5'-ATCATGGCTTGTCATTAACTATTACC-3' (SEQ ID NO. 6) is nucleotides 201 to 226 of the sequence shown in SEQ ID NO. 1. 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO. 7) in F2 is a universal fluorescent linker sequence, labeled with a FAM fluorescent group at the 5' end, and the reverse complement sequence of 5'-CATCATGGCTTGTCATTAACTATTACT-3' (SEQ ID NO. 8) is nucleotides 201 to 227 of SEQ ID NO. 1.

[0061] The above primers were synthesized by Beijing Yinuo Zhongda Biotechnology Co., Ltd. After synthesis, the primer powder was diluted to 100 μl / ml, and then the three sequences were diluted in a volume ratio of F1:F2:R:water = 24:24:48:100 to obtain a diluted primer mixture.

[0062] 5. The PCR reaction system is as follows: 2 μl of 2× Taq DNA Polymerase Mix, 1 μl of diluted primer mixture, and 2 μl of genomic DNA;

[0063] The mixed PCR reaction system was prepared using ABI 9700196Dual was amplified.

[0064] Table 1 PCR thermal cycling conditions

[0065]

[0066] 6. Fluorescence value reading

[0067] After PCR amplification cycles, fluorescence was read using a FLUOstaroemga instrument from LGC Genomics Ltd. at temperatures below 40°C. SNP detection utilizes the fluorophores VIC and FAM to distinguish between isogenic loci G and A. A passive reference dye, ROX, was used to correct for signal variations between wells due to reaction volume variations. The relevant excitation and emission wavelengths are shown in Table 2.

[0068] Table 2 Excitation and emission wavelengths of the fluorescent groups used

[0069] Fluorophore Excitation light (nm) Emission light (nm) FAM 485 520 VIC 535 556 ROX 575 610

[0070] Note: If the HEX fluorophore is selected as the detection signal for the fluorescence scanning instrument, no modification is required to the settings because the excitation and emission wavelengths of VIC and HEX are very similar.

[0071] 7. Determination of chr10_80934959:G>A genotype

[0072] The fluorescence values ​​were analyzed using the KlusterCaller genotyping software that comes with the FLUOstar OEM device from LGC Genomics Ltd. In this software, VIC and FAM data are plotted on the x-axis and y-axis, respectively. The fluorescence values ​​of VIC and FAM in each reaction well are corrected and normalized by the fluorescence value of ROX to obtain the relative fluorescence values ​​corresponding to VIC and FAM in each PCR reaction well. Based on the relative fluorescence values, the samples were clustered, and the genotypes were further determined based on the sample clusters and fluorescence types. The specific results are shown in Figure 2. Figure 1 As shown, red represents GG type, blue represents AA type, and green represents GA type. The genotype frequencies are shown in Table 3 below. The gene frequency of GG type is 0.19, the gene frequency of GA type is 0.17, and the gene frequency of AA type is 0.66.

[0073] Table 3 Statistics of chest circumference and chr10__80934959:G>A genotype frequency of tested sheep

[0074]

[0075] 8. Calculate the relationship between chr10__80934959:G>A genotype and sheep chest circumference

[0076] First, the general linear model (GLM) was used to correct the effects of age and sheep farm in the chest circumference data, and the residuals were derived as phenotypic values ​​( Figure 2) Then, principal component analysis was performed, and the first three principal components obtained from the principal component analysis were used as covariates. The BLINK function in the BLINK software package (https: / / github.com / YaoZhou89 / BLINK) was then used to calculate the effect of single-point SNPs on the chest circumference phenotype based on the measured chr10__80934959:G>A genotype using a mixed linear model (MLM). The mixed linear model is shown in Equation I:

[0077] y=Q+K+S+e Formula I;

[0078] Where y represents phenotypic data; Q represents the first three principal components obtained by principal component analysis of the residuals derived from the general linear model after correcting for the effects of age and sheep farm in the chest circumference data; K represents the kinship matrix between individuals; S represents the coefficient matrix composed of the chr10__80934959:G>A genotype (0 represents homozygous AA, 1 represents heterozygous GA, and 2 represents homozygous GG); and e represents the random residual effect.

[0079] The results are shown in Table 4.

[0080] Table 4 Association analysis between the tested sheep chr10__80934959:G>A genotype and chest circumference of Bamei sheep

[0081] SNP Total P value Effect of mutation Phenotypic variance explained by SNP chr10_80934959:G>A 179 <![CDATA[1.99×10 -16 ]]> 6.01922 23.58%

[0082] The results showed that the molecular marker chr10__80934959:G>A was significantly associated with the chest circumference of Bamei sheep. The chest circumference of sheep carrying the GA genotype was lower than that of sheep carrying the AA genotype (P=1.99×10 -16 The A allele increases chest circumference in sheep, with an effect size of 6.01922. This SNP site can explain 23.58% of the phenotypic variance. Although chest circumference is controlled by multiple genes, this SNP site still has a large effect. Therefore, it can be seen that when breeding, the AA genotype should be selected for seed preservation, and when breeding, the AA genotype should be used as breeding sheep. When crossing with other sheep, the G allele needs to be excluded. In particular, using semen from AA genotype rams for artificial insemination can greatly improve breeding efficiency and obtain a flock with an advantage in chest circumference.

[0083] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with sheep chest circumference, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein R is A or G.

2. A primer set for detecting the SNP molecular marker according to claim 1, characterized in that: include: F1, F2 and R; the nucleotide sequence of F1 is shown in SEQ ID NO.2, the nucleotide sequence of F2 is shown in SEQ ID NO.3, and the nucleotide sequence of R is shown in SEQ ID NO.4; F1 and F2 are labeled with different fluorescent groups.

3. The primer set according to claim 2, characterized in that The fluorescent group includes FAM, VIC or HEX.

4. The primer set according to claim 3, characterized in that The F1 is labeled with a fluorescent group VIC, and the F2 is labeled with a fluorescent group FAM.

5. Use of the primer set according to any one of claims 2 to 4 in identifying the chest girth of sheep; the sheep are Bamer sheep; sheep with a SNP molecular marker genotype of AA are sheep with relatively large chest girth; the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, wherein R is A or G.

6. Use of the primer set according to any one of claims 2 to 4 in sheep breeding, wherein the breeding is for selecting sheep with relatively large chest circumference; the sheep are Bamer sheep; sheep with a SNP molecular marker genotype of AA are sheep with relatively large chest circumference; the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, wherein R is A or G.

7. A method for determining the chest girth of a sheep, characterized in that: The following steps are involved: Using the genomic DNA of the sheep to be tested as a template, PCR amplification is performed using the primer set according to any one of claims 2 to 4 to obtain an amplified product; the genotype of the sheep to be tested is determined based on the fluorescent group on the amplified product; the sheep to be tested is a Bamer sheep; If the amplified product contains only the F1-labeled fluorescent group, the genotype of the sheep to be tested is GG; If the amplified product contains only the F2-labeled fluorescent group, the genotype of the sheep to be tested is AA; If the amplified product contains fluorescent groups labeled F1 and F2, the genotype of the sheep to be tested is GA; The chest circumference of the sheep to be tested is determined according to the genotype of the sheep to be tested: the sheep with the genotype of AA are sheep with relatively large chest circumference.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker related to sheep growth traits and application of SNP molecular marker

    CN118374609A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to chest circumference character of sheep, primer group, kit and application of SNP molecular marker

    CN118726613A