Application of preparation for knocking out porcine METTL3 gene expression in preparation of antiviral infection drugs and cell model

Abstract

The invention discloses application of a preparation for knocking out porcine METTL3 gene expression in preparation of an antiviral infection drug, and belongs to the technical field of gene engineering and biological medicine, and the METTL3 gene is the METTL3 gene with the NCBI login number of XM003128580.5 in a pig; the virus is a porcine epidemic diarrhea virus PEDV and / or a porcine reproductive and respiratory syndrome virus PRRSV. The invention also provides an antiviral infection cell model prepared by knocking out the METTL3 gene. It is found for the first time that knockout of the METTL3 gene can inhibit PEDV and PRRSV replication and further interfere PEDV and PRRSV infection, and therefore the METTL3 gene can be used as a novel target for development of anti-PRRSV and PEDV drugs and disease-resistant breeding research.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and biomedicine, and specifically relates to the application of a preparation for knocking out pig METTL3 gene expression in the preparation of drugs against PEDV and PRRSV infection and a cell model. Background Art

[0002] Porcine epidemic diarrhea virus (PEDV) infection causes acute diarrhea, vomiting, dehydration and even death in pigs. There are many variant strains of PEDV, which poses a great challenge to biosafety prevention and control, causing serious economic losses and the healthy development of the pig industry. Porcine reproductive and respiratory syndrome virus (PRRSV) infection causes reproductive decline in pregnant sows, breathing difficulties in piglets and growing pigs, and a high mortality rate. PRRS is a global epidemic, causing huge economic losses to the pig industry. Due to the diversity of viruses, traditional methods based on vaccines or drugs are challenging to control PRRSV. Nowadays, co-infection of multiple viruses is a common phenomenon in clinical practice and a key driver of viral evolution.

[0003] Therefore, it is urgent to identify host genes related to PEDV and PRRSV infection and study their interactions to provide a theoretical basis and target genes for the breeding of pig breeds resistant to PEDV and PRRSV and the development of vaccine drugs. Summary of the invention

[0004] In response to one or more of the above defects or improvement needs in the prior art, the present invention provides a preparation for knocking out the expression of the porcine METTL3 gene for use in the preparation of drugs against PEDV and PRRSV infections and a cell model, providing a new target for new vaccine drugs against epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus.

[0005] To achieve the above object, according to one aspect of the present invention, a preparation for knocking out the expression of porcine METTL3 gene is provided for use in the preparation of an antiviral infection drug.

[0006] The METTL3 gene is the METTL3 gene in pigs with NCBI accession number XM_003128580.5; the virus is PEDV and / or PRRSV.

[0007] As a further improvement of the present invention, the preparation for knocking out the expression of the pig METTL3 gene is an sgRNA or an expression vector thereof for targeted knockout of the METTL3 gene.

[0008] As a further improvement of the present invention, the sequence of the sgRNA includes:

[0009] gRNA1: ATGCTGATCATTCCAAGCTC

[0010] gRNA2:CTGAACCAACAATCTACTA.

[0011] As a further improvement of the present invention, the knockout method is a CRISPR / Cas9 knockout method for the pig METTL3 gene.

[0012] According to another aspect of the present invention, a cell model for resisting viral infection prepared by knocking out the METTL3 gene is provided.

[0013] The virus is PEDV and / or PRRSV;

[0014] The METTL3 gene is the METTL3 gene in pigs with NCBI accession number XM_003128580.5.

[0015] As a further improvement of the present invention, the preparation for knocking out the METTL3 gene is an sgRNA or an expression vector thereof for targeted knockout of the METTL3 gene.

[0016] As a further improvement of the present invention, the sequence of the sgRNA includes:

[0017] gRNA1: ATGCTGATCATTCCAAGCTC

[0018] gRNA2:CTGAACCAACAATCTACTA.

[0019] In general, the above technical solution conceived by the present invention has the following beneficial effects compared with the prior art:

[0020] The applicant used CRISPR / Cas9 gene knockout technology to target and knock out the METTL3 gene in PK-1 cells to inhibit its expression. It was discovered for the first time that knocking out the METTL3 gene can inhibit the replication of PEDV and PRRSV, thereby interfering with PEDV and PRRSV infection. This gene can be used as a new disease resistance target.

[0021] The present invention provides a new target for developing effective and safe new vaccine drugs against epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus, and also provides a new candidate gene for breeding research against PEDV and PRRSV, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1Screening and identification of METTL3 gene knockout cells in Example 1 of the present invention (A: METTL3 gene structure and gRNA targeting site; B: PCR identification results (M: DL100 DNA Marker; WT: Cas9-PK1; 7, 8, 10: Cas9-PK1-METTL3-KO); C: Cas9-PK1-METTL3-KO cell METTL3 gene deletion sequencing results);

[0023] Figure 2 Western blot was used to detect the expression level of METTL3 protein in METTL3 gene knockout cells in Example 1 of the present invention (A: expression changes of METTL3 protein; B: grayscale quantitative analysis of METTL3 / GAPDH);

[0024] Figure 3 This is a graph showing the results of PEDV infection of PK-1-METTL3-KO cells for 12 hours in Example 2 of the present invention (WT: Cas9-PK1 cells; METTL3-KO: METTL3 gene knockout cells;);

[0025] Figure 4 The expression amount of N protein in PK-1-METTL3-KO cells infected with PEDV in Example 2 of the present invention (A: expression change of N protein; B: grayscale quantitative analysis of PEDV-N / GAPDH);

[0026] Figure 5 This is a graph showing the results of PRRSV infection of PK-1-METTL3-KO cells for 48 hours in Example 3 of the present invention (WT: Cas9-PK1 cells; METTL3-KO: METTL3 gene knockout cells;) DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0028] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0029] In an embodiment of the present invention, a preparation for knocking out the expression of the porcine METTL3 gene is provided for use in preparing an antiviral infection drug, wherein the METTL3 gene is the METTL3 gene in the pig with the NCBI accession number of XM_003128580.5; and the virus is PEDV and / or PRRSV. That is, the preparation for knocking out the expression of the porcine METTL3 gene in an embodiment of the present invention can be used to prepare a drug for resisting porcine epidemic diarrhea virus (PEDV) infection, or for preparing a drug for resisting porcine reproductive and respiratory syndrome virus (PRRSV) infection, or for preparing a drug for resisting co-infection of two viruses.

[0030] Furthermore, the preparation for knocking out the expression of the porcine METTL3 gene is an sgRNA or its expression vector for targeted knockout of the METTL3 gene. In a preferred embodiment, the sequence of the sgRNA includes:

[0031] gRNA1:ATGCTGATCATTCCAAGCTC

[0032] gRNA2:CTGAACCAACAATCTACTA.

[0033] Furthermore, the knockout method is a CRISPR / Cas9 knockout method for the pig METTL3 gene.

[0034] The embodiment of the present invention also provides a cell model for resisting viral infection prepared by knocking out the METTL3 gene, wherein the virus is PEDV and / or PRRSV; and the METTL3 gene is the METTL3 gene in pigs with NCBI accession number XM_003128580.5.

[0035] The present invention downloads the nucleotide sequence of the porcine METTL3 gene from the NCBI database, analyzes the porcine METTL3 gene sequence, and screens the target site of the porcine METTL3 gene and designs and screens sgRNA for the target site according to the design principle of CRISPR / Cas9 recognition of target sites. Finally, the sgRNA with the highest knockout efficiency is obtained through screening, and a CRISPR / Cas9 knockout vector containing the sgRNA is constructed to achieve the knockout of the porcine METTL3 gene.

[0036] The present invention further uses a fluorescent inverted microscope and Western blot to detect the inhibitory effect of METTL3 gene knockout on PEDV, and uses a fluorescent inverted microscope to observe the inhibitory effect of METTL3 gene knockout on PRRSV. The results show that after the METTL3 gene is knocked out in PK-1 cells (pig kidney cells), the proliferation of PRRSV and PEDV can be inhibited. Therefore, the METTL3 gene can be used as a new target for the development of vaccine drugs that inhibit the replication of PRRSV and PEDV and for disease-resistant breeding research.

[0037] The technical solution provided by the present invention is described in detail below in conjunction with embodiments.

[0038] Example 1

[0039] Construction and validation of PK-1METTL3 cells

[0040] 1.1 Construction of METTL3-sgRNA expression vector

[0041] (1) Go to NCBI (http: / / www.ncbi.nlm.nih.gov / ) and download the porcine METTL3 gene (XM_003128580.5). As shown in Table 1, design multiple pairs of sgRNAs for exon 3 of the METTL3 gene and select two pairs of sgRNAs with relatively high scores;

[0042] gRNA1: ATGCTGATCATTCCAAGCTC

[0043] gRNA2:CTGAACCAACAATCTACTA.

[0044] Table 1 sgRNA oligonucleotide sequences

[0045] name Primer sequence (5'-3') METTL3-sgRNA1-F CACCGCTGAACCAACAATCTACTAGT METTL3-sgRNA1-R TAAAACTAGTAGATTGTTGGTTCAGC METTL3-sgRNA2-F CACCGAGCTTGGAATGATCAGCATGT METTL3-sgRNA2-R TAAAACATGCTGATCATTCCAAGCTC

[0046] (2) Use pb-U6-puro-BFP as the original vector plasmid to construct an sgRNA expression vector. Dilute the upstream and downstream primers of sgRNA to 10 μM respectively, take 5 μL of each and mix in equal volumes, add 5 μL Mgcl2 and 1 μL Tris HCL. Add ddH2O to make the volume up to 50 μL, mix by pipetting, centrifuge, incubate at 95°C for 5 minutes, cool to room temperature, and obtain double-stranded sgRNA. Use the restriction endonuclease BbsI from NEB to linearize pb-U6-puro-BFP. The reaction system is shown in Table 2. After mixing and centrifuging, incubate at 37°C for 15 minutes and at 65°C for 20 minutes. Use a DNA purification and recovery kit to recover the linear vector DNA and measure the concentration.

[0047] Table 2 BbsI single enzyme digestion system

[0048]

[0049] (3) Using the “T4 DNA ligase” of Trans Company, the double-stranded sgRNA of the METTL3 gene was connected to the linearized pb-U6-puro-BFP vector at room temperature or 16°C overnight. The reaction system is shown in Table 3.

[0050] Table 3 sgRNA ligation reaction system

[0051]

[0052] (4) Transformation and positive clone identification were performed according to the instructions of chemically competent cells of Trans Company. After the positive colonies were sequenced and identified correctly, the bacterial culture was expanded and plasmids were extracted according to the "Endotoxin-free Plasmid Mini-Prep Kit" of TIANGEN Company.

[0053] 1.2 Construction of PK-1METTL3 cells

[0054] (1) Use PolyPlus' transfection reagent" reagent operating instructions use auxiliary plasmid pb-base and sgRNA plasmid for plasmid transfection.

[0055] (2) PK-1 cells (pig kidney cells) were inoculated into two wells of a 6-well cell culture plate, one well as an experimental group and the other well as a control group, and cultured in DMEM high-glucose medium containing 10% FBS.

[0056] (3) When the cell confluence reaches 60% to 70%, transfection is performed.

[0057] (4) One day after infection, cells were subcultured to 10 cm cell culture dishes and cultured further.

[0058] (5) After culturing for 2 days, culture medium containing puromycin (DMEM high-glucose medium with 10% FBS) was added, and the final concentration of puromycin was 1.5 μg / mL.

[0059] (6) Replace the culture medium with fresh one every day. When all cells in the control group have died and there are cells in the experimental group surviving, inoculate the cells in the experimental group into a 10 cm cell culture dish to form single cells and add the culture medium.

[0060] (7) Continue culturing for about 14 days until the single cells grow into monoclonal cell clusters. Scrape them with a glass needle and place them in a 96-well culture plate. Add culture medium to obtain the PK-1METTL3 monoclonal cell line.

[0061] 1.3 Validation of PK-1METTL3 monoclonal cell line

[0062] 1.3.1 Detection of METTL3 gene expression in monoclonal PK-1METTL3 cells using PCR

[0063] (1) DNA from wild-type PK-1 cells and monoclonal PK-1METTL3 cells was extracted according to the instructions of the DNA extraction kit of CWBIO.

[0064] (2) After the DNA concentration was measured, the expression of METTL3 gene in the monoclonal cell PK-1-METTL3 was detected using the PCR amplification kit of Vazyme Company. The reaction conditions were: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 sec; 60°C annealing for 15 sec; 72°C extension for 1 min; annealing to extension stage for 40 cycles; 72°C final extension for 5 min; and then storage at 4°C. The primers used are shown in Table 4.

[0065] Table 4 PCR primers

[0066] name Primer sequence (5'-3') METTL3-PCR-F CTCAGGATGGAGTGGAAAGC METTL3-PCR-R GGATCTCCATCTACCCCTACC

[0067] (3) Sanger sequencing was performed on samples showing successful gene knockout by PCR amplification bands. The sequencing results were as follows: Figure 1 As shown, METTL3 gene knockout event was demonstrated.

[0068] (4) Proteins were extracted from METTL3 gene knockout cell samples and Western blot protein expression was performed to further prove METTL3 gene knockout. The experimental results are as follows Figure 2 As shown, it indicates that the PK-1METTL3 monoclonal cell line has been successfully established.

[0069] Example 2

[0070] Fluorescence inverted microscopy and Western blot were used to detect the inhibitory effect of METTL3 gene knockout on PEDV.

[0071] The same number and appropriate amount of PK-1-METTL3 experimental group cells (METTL3-KO in the figure) and control group cells (WT in the figure) were inoculated into 6-well plates and cultured in a 5% CO2, 37°C incubator. After 24 hours, the culture medium was discarded and washed twice with PBS, PEDV (MOI = 1) was added, and after incubation at 37°C for 1 hour, 1mL DMEM (containing 3μg / mL of trypsin) serum-free medium was added to continue culture. Then observations were made at time points. The results showed that at 12 hours, the cell pathology caused by PEDV in the METTL3-KO group was significantly reduced compared with the WT group ( Figure 3 ).

[0072] Then Western blot protein expression was used to detect the expression of PEDV-N in the PK-1-METTL3 experimental group and the control group.

[0073] (1) The total protein of wild-type PK-1 cells and monoclonal PK-1-METTL3 cells was extracted according to the instructions of the total protein lysis reagent of CWBIO.

[0074] (2) The protein concentration was determined using the BCA method, and the samples were balanced to the same concentration of 2 μg / μL using lysis buffer.

[0075] (3) Add 5× SDS-PAGE Loading Buffer in proportion to the protein volume, heat at 100°C for 10 min, cool to room temperature, centrifuge, and store in a -20°C refrigerator.

[0076] (4) Prepare SDS-PAGE gel and perform protein detection according to the instructions of Bio-Rad.

[0077] (5) Incubate the primary antibody and secondary antibody (PEDV-N antibody was provided by Wuhan University of Technology) according to the antibody instructions, then take photos using a chemiluminescence imaging system and adjust the exposure intensity and exposure time until the target protein band appears.

[0078] The results showed that at 12h, PEDV was significantly reduced in the experimental group ( Figure 4 ), indicating that knocking out the METTL3 gene in PK-1 cells significantly inhibited the proliferation of PEDV.

[0079] Embodiment 3:

[0080] The inhibitory effect of METTL3 gene knockout on PRRSV was observed using a fluorescence inverted microscope.

[0081] The same number and appropriate amount of PK-1-METTL3 experimental group cells (METTL3-KO in the figure) and control group cells (WT in the figure) were inoculated into 6-well plates and cultured in a 5% CO2, 37°C incubator. After 24 hours, the culture medium was discarded and washed twice with PBS, PRRSV (MOI = 1) was added, and after incubation at 37°C for 1 hour, 1mL of DMEM (containing 2% FBS) culture medium was added to continue culture. Then observations were made according to time nodes. The results showed that at 48 hours, the cell pathology caused by PRRSV in the METTL3-KO group was significantly reduced compared with the WT group ( Figure 5 ).

[0082] It will be easily understood by those skilled in the art that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Use of a preparation for knocking out the expression of the porcine METTL3 gene in the preparation of an antiviral infection drug, characterized in that: The METTL3 gene is the METTL3 gene in pigs with NCBI accession number XM_003128580.5; the virus is PEDV and / or PRRSV.

2. The use of the preparation for knocking out the pig METTL3 gene expression according to claim 1 in the preparation of antiviral infection drugs, characterized in that: The preparation for knocking out the expression of the pig METTL3 gene is an sgRNA or an expression vector thereof for targeted knockout of the METTL3 gene.

3. Use of the preparation for knocking out the expression of the porcine METTL3 gene according to claim 2 in the preparation of antiviral infection drugs, characterized in that: The sequence of the sgRNA includes: gRNA1: ATGCTGATCATTCCAAGCTC gRNA2:CTGAACCAACAATCTACTA.

4. Use of the preparation for knocking out the expression of the porcine METTL3 gene according to any one of claims 1 to 3 in the preparation of antiviral infection drugs, characterized in that: The knockout method is the CRISPR / Cas9 knockout method for the pig METTL3 gene.

5. A cell model for anti-viral infection prepared by knocking out the METTL3 gene, characterized in that: The virus is PEDV and / or PRRSV; The METTL3 gene is the METTL3 gene in pigs with NCBI accession number XM_003128580.

5.

6. The cell model for anti-viral infection prepared by knocking out the METTL3 gene according to claim 5, characterized in that: The preparation for knocking out the METTL3 gene is an sgRNA or an expression vector thereof for targeted knockout of the METTL3 gene.

7. The cell model for anti-viral infection prepared by knocking out the METTL3 gene according to claim 6, characterized in that: The sequence of the sgRNA includes: gRNA1: ATGCTGATCATTCCAAGCTC gRNA2:CTGAACCAACAATCTACTA.

Images