Use of p85 alpha truncated expression constructs in the prevention of uvb-induced skin photodamage

Abstract

The present application relates to the application of p85 alpha truncated expression construct in preventing UVB induced skin photodamage, and provides nucleic acid encoding the truncated expression construct, recombinant vector, recombinant host cell and primer set for amplifying nucleic acid. The present application discloses that the p85 alpha truncated expression construct can antagonize the UVB induced activation of PERK-p53-PERP pathway and pro-apoptotic effect, and the mutant and its derivatives have application value in preventing UVB induced skin photodamage reaction and preparing products for preventing UVB induced skin photodamage.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, in particular to the application of p85α truncated expression construct in preventing UVB-induced skin photodamage. BACKGROUND

[0002] Solar radiation is an important environmental risk factor for human skin damage, among which ultraviolet (UV) radiation is most closely related to photodamage. UV can be divided into long-wave ultraviolet (UVA, 320-400 nm), medium-wave ultraviolet (UVB, 280-320 nm) and short-wave ultraviolet (UVC, 100-280 nm), and their effects on inducing skin photodamage reactions are enhanced in turn. Because the wavelength of UVB is shorter and has a stronger biological effect, its radiation can stimulate the production of reactive oxygen species (ROS), thereby causing oxidative stress and inflammatory response of the skin, leading to tissue damage. Studies have shown that UVB can damage the structure and function of proteins, lipids and nucleic acids, thereby triggering pathological damage reactions such as skin burns, blistering, dermatitis and even skin cancer. Therefore, the prevention and control strategies, technologies and drug research of UVB-induced photodamage effect have always been concerned.

[0003] In order to prevent and control the skin photodamage reaction caused by UVB radiation, the interference of photochemical protective agents on skin photodamage has become a research hotspot. UVB can induce binding reactions with endoplasmic reticulum (ER) stress sensing protein PERK (Protein kinase R-like ER kinase) in the process of inducing p53 activation and promoting apoptosis, further activating the PERK-p53-PERP signaling pathway, and ultimately mediating the pro-apoptotic effect of skin keratinocytes and stromal cells (Lun Song et al., 2021). Therefore, it is of great significance to further study the mechanism of skin photodamage and develop more effective anti-photodamage products.

[0004] Therefore, the present application designs a truncated expression construct which can antagonize the UVB-induced activation of PERK-p53-PERP pathway and pro-apoptotic effect, thereby having potential application value in preventing UVB-induced skin photodamage reaction. SUMMARY

[0005] In order to make up for the shortcomings of the prior art, the present application provides the following technical solutions: the present application provides a truncated expression construct of p85α, and the amino acid sequence of the truncated expression construct is shown in SEQ ID NO: 1.

[0006] In the present application, p85a includes wild type, also known as PIK3R1, p85, AGM7, GRB1, IMD36. The term encompasses full-length, unprocessed p85a. The term encompasses, for example, the p85a gene, human p85a, and p85a from any other vertebrate source, including mammals such as primates and rodents (e.g., mice and rats). As a preferred embodiment, in the present application, p85a is the human gene, Gene ID 5295.

[0007] Truncated expression construct generally refers to a DNA, RNA, or protein molecule, manufactured by artificial means in molecular biology, which is a partial sequence of a complete gene or protein. Truncated expression construct can be used for various research purposes, including studying functional domains of a protein, producing soluble protein for ease of purification, removing unwanted signal peptides or transmembrane regions, and studying protein-protein interactions, etc.

[0008] The second aspect of the present application provides a biological material, which comprises any one of: (a) a nucleic acid encoding the truncated expression construct according to the first aspect of the present application; (b) a recombinant vector comprising the nucleic acid of (a); and (c) a recombinant host cell comprising the nucleic acid of (a) or the recombinant vector of (b).

[0009] In the present application, the term "nucleic acid" refers to a polymeric form of nucleotides of any length, containing deoxyribonucleotides, ribonucleotides, and / or their analogs, which includes DNA, RNA, and DNA / RNA hybrids, and also includes DNA or RNA analogs such as those containing modified backbones (e.g., peptide nucleic acids (PNAs) or phosphorothioates) or modified bases. Thus, the nucleic acids of the present application include DNA, cDNA, mRNA, recombinant nucleic acids, etc. Once the coding sequence of the truncated expression construct of the present application or a sequence having 80% or more identity thereto is obtained by isolation, the fusion protein can be obtained in large quantities using recombinant techniques.

[0010] The term "identity" also referred to as "homology" refers to an amino acid sequence or a base sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to the sequence provided in the present application. To determine sequence identity, sequence alignment can be performed by various means known to those skilled in the art, for example, using BLAST, BLAST-2, ALIGN, NEEDLE, Megalign (DNASTAR), Snapgene or DNAMAN software, etc. Those skilled in the art are able to determine appropriate parameters for alignment, including any algorithm needed to achieve optimal alignment of the full length sequences being compared.

[0011] Further, the base sequence of the nucleic acid is shown in SEQ ID NO: 2 or has 80% or more identity to SEQ ID NO: 2.

[0012] The recombinant vector of the present application refers to an artificial construct that is capable of delivering and preferably expressing one or more genes or sequences of interest in a host cell. The recombinant vector of the present application is not limited and can be an expression vector, a cloning vector, etc. In certain embodiments, the recombinant vector comprises a target gene encoding the fusion protein of the present application, a promoter, a terminator, or optionally further comprises a marker gene. The recombinant vector can use a known vector or a self-constructed vector.

[0013] Further, the recombinant vector comprises an expression vector, a cloning vector.

[0014] The cloning vector is mostly a high copy vector, generally a prokaryotic bacterium, and the gene to be cloned is connected to the plasmid of the cloning vector, and then introduced into the prokaryotic bacterium, and the plasmid will be replicated in the prokaryotic bacterium to form a large number of gene clones. The expression vector is a vector that increases expression elements (such as promoters, RBS, terminators, etc.) on the basis of the basic skeleton of the cloning vector, so that the target gene can be expressed.

[0015] Further, the cloning vector comprises a plasmid vector, a bacteriophage vector, and a bacteriophage-plasmid hybrid vector.

[0016] The plasmid vector includes but is not limited to PET-GST, PET-HiS, PET-Trx, PET-CKS, PET-DsbA, Plp-OmpA, plp-STII, PMBP-P, PMBP-C, etc. The bacteriophage vector includes lambda phage and M13 phage. The bacteriophage-plasmid hybrid vector includes cosmid vector and phagemid vector.

[0017] Further, the expression vector comprises a plasmid expression vector, a viral expression vector, and a large fragment expression vector.

[0018] The plasmid expression vector includes prokaryotic expression vector, yeast expression vector, Ti plasmid expression vector. The viral expression vector includes but is not limited to baculovirus expression vector, SV40 virus type transformation vector, retrovirus vector, adenovirus vector. The large fragment expression vector includes TAC-transferrable artificial vector, MAC-mammal artificial chromosome and the like.

[0019] Further, the recombinant host cell includes eukaryotic cell, prokaryotic cell.

[0020] The host cell or the recombinant host cell in the present application refers to any cell type suitable for transformation, transfection, transduction and the like with an expression vector or nucleic acid construct comprising the nucleic acid provided by the present application. The host cell includes any progeny of the parent cell, which is different from the parent cell due to mutations occurring during replication. Preferably, the recombinant host cell includes prokaryotic cell, eukaryotic cell; more preferably, the prokaryotic cell includes bacteria, actinomycetes, cyanobacteria, mycoplasma, chlamydia, rickettsia; more preferably, the eukaryotic cell includes mammalian cell, insect cell, plant cell, yeast cell.

[0021] The third aspect of the present application provides a derivative of the truncated expression construct according to the first aspect of the present application or the biomaterial according to the second aspect of the present application, which is formed in a modified, encapsulated and / or covalently bound form with other substances.

[0022] In the present application, the term "derivative" refers to a substance formed in a modified, encapsulated and / or covalently bound form with other substances from the truncated expression construct or the nucleic acid encoding the truncated expression construct according to the present application, which maintains the desired activity or characteristics of the protein or nucleic acid. In some embodiments, the protein has one or more of co-translational and / or post-translational modifications, such as phosphorylation, acetylation, methylation, ubiquitination, glycosylation, hydroxylation, sulfation, fatty acylation. These modifications can be obtained by production in mammalian cells or by in vitro site-directed modification of synthetic peptides. When the truncated expression construct of the present application has amino acid substitutions relative to the relevant reference sequence, the substitutions are preferably conservative amino acid substitutions. The truncated expression construct of the present application can also include modified amino acids. The amino acid modification can include, for example, phosphorylation, acetylation, methylation, amidation or any other amino acid modification known in the art, as long as the protein maintains the desired characteristics.

[0023] Further, the modification includes one or more of phosphorylation, acetylation, methylation, ubiquitination, glycosylation, hydroxylation, sulfation, fatty acylation.

[0024] Further, the encapsulation includes liposome encapsulation, exosome encapsulation, metal nanoparticle encapsulation, silica encapsulation, polysaccharide nanocarrier encapsulation, synthetic polymer nanocarrier encapsulation, cell-penetrating peptide encapsulation, protein cage encapsulation, virus-like particle encapsulation.

[0025] Further, the other substances include one or more components in the group consisting of detectable labels, free adjuvants, stabilizers, buffers, surfactants, salts, and preservatives.

[0026] The detectable labels include at least one of radioisotopes, metal nanomaterials, fluoresceins, biotin, avidin, biotin / avidin protein complex, biotin / avidin protein complex, chromophores, electron-dense substances, and enzymes.

[0027] The fourth aspect of the present application provides a set of primers that can amplify the nucleic acid described in the second aspect of the present application, the primers including the base sequence as shown in SEQ ID NO: 3-4.

[0028] The fifth aspect of the present application provides a product for preventing UVB-induced skin photodamage, which includes the truncated expression construct described in the first aspect of the present application, the biomaterial described in the second aspect of the present application, the derivative described in the third aspect of the present application, and / or the primers described in the fourth aspect of the present application.

[0029] Further, the product is selected from the group consisting of pharmaceutical compositions, probe sets, primer sets, kits, chips, test papers, high-throughput sequencing, systems, devices, apparatuses.

[0030] The pharmaceutical composition of the present application can be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, or via an implanted reservoir. The pharmaceutical composition of the present application can contain any conventional non-toxic pharmaceutically-acceptable carriers, adjuvants or vehicles. In certain cases, pharmaceutical acids, bases, or buffers can be used to adjust the pH of the formulation to improve the stability of the formulated compound or its administration form. The term parenteral as used herein includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. The pharmaceutical composition of the present application can be administered to a subject by any route that will deliver the active compound to the desired tissue.

[0031] Further, the pharmaceutical composition further includes a pharmaceutical adjuvant.

[0032] In the context of this invention, pharmaceutical excipients or pharmaceutically acceptable carriers or excipients refer to non-toxic solid, semi-solid, or liquid fillers, diluents, encapsulation materials, or any type of formulation aid. The pharmaceutical excipients may also be binders, wetting agents, disintegrants, emulsifiers, solubilizers, osmotic pressure regulators, surfactants, colorants, pH adjusters, antioxidants, or antibacterial agents.

[0033] The sixth aspect of this invention provides the use of the truncated expression constructs of the first aspect of this invention, the biomaterials of the second aspect of this invention, the derivatives of the third aspect of this invention, and / or the primers of the fourth aspect of this invention in the preparation of products for preventing UVB-induced photodamage to the skin.

[0034] The seventh aspect of the present invention provides a method for preparing the truncated expression construct described in the first aspect of the present invention, the method comprising genetic engineering techniques and artificial synthesis.

[0035] Furthermore, the steps of the genetic engineering technology include: culturing the recombinant host cells described in the second aspect of the present invention to express the truncated expression construct described in the first aspect of the present invention; or, transfecting the host cells with the recombinant vector described in the second aspect of the present invention to express the truncated expression construct described in the first aspect of the present invention; or, transforming the host cells with the nucleic acid described in the second aspect of the present invention to express the truncated expression construct described in the first aspect of the present invention.

[0036] Advantages and beneficial effects of the present invention: The present invention provides a truncated expression construct of p85α, which can antagonize UVB-induced activation of the PERK-p53-PERP pathway and its apoptosis-promoting effect. Moreover, the molecule is smaller and has better drug-like properties than p85α, and has potential application value in preventing UVB-induced skin photodamage. Attached Figure Description

[0037] Figure 1 This is a schematic diagram of the construction scheme for wild-type p85α and its truncated expression construct.

[0038] Figure 2 Figure showing the difference in binding ability between wild-type p85α and its truncated expression constructs and PERK.

[0039] Figure 3 A graph showing the ability of p85α-M4 to regulate the activation of the PERK-p53-PERP pathway.

[0040] Figure 4 This is a diagram illustrating the ability of p85α-M4 to regulate UVB-induced apoptosis-promoting responses. Detailed Implementation

[0041] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation of the application. The experimental methods in the following examples are conventional methods, and the materials and reagents used in the following examples are obtained from commercial sources unless otherwise specified.

[0042] Example 1, research method

[0043] 1. Establishing a UVB-induced skin photodamage model: Human skin keratinocytes (HaCaT) were used as a model, and the cells were irradiated with a UVB dose (0.5 kJ / m2) that had been confirmed in previous studies to induce apoptosis in HaCaT cells. The expression levels of related proteins and apoptosis were analyzed at specified time points after irradiation.

[0044] 2. Construction of p85α mutants and analysis of their differences in PERK binding ability: A series of p85α truncated expression constructs were constructed according to the structural and functional domain characteristics of p85α. Among them, full-length p85α (WT-p85α) is 1-724 amino acids; p85α M1 is a truncated expression construct of 1-617 amino acids; p85α M2 is a truncated expression construct with 322-430 amino acids knocked out; p85α M3 is a truncated expression construct of (1-322) + (430-617) amino acids; and p85α M4 is a truncated expression construct with 430-617 amino acids knocked out.

[0045] For example, p85α M4, the method for constructing the truncated expression construct is as follows: The 430-617 amino acids in the wild-type p85α (1-724 aa) amino acid sequence are truncated, and the 1-429 and 618-724 amino acid sequences are directly connected. The full-length and p85α mutant construction primers are used for amplification, and the amplified products are inserted into the pcDNA3.1-FLAG vector for ligation. The ligation products are then transformed into Trans5α competent cells, and E. coli is added for amplification and plating. After 12-16 hours, single colonies are picked and subjected to bacterial liquid PCR verification. After successful sequencing, a large amount of amplification is performed and the plasmid is extracted. The expression of the plasmid is verified in HaCaT cells. The full-length and p85α mutant construction primers are shown in Table 1.

[0046] Table 1. Primer table for truncated expression construct

[0047] Name Upstream primer Downstream primer Flag-WT-p85α (1-724aa) GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATATAC (SEQ ID NO: 3) GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATA (SEQ ID NO: 4) Flag-p85α-M1 (1-617aa) GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATATAC (SEQ ID NO: 3) GACACTATAGAATAGGGCCCTCTAGACCATGTCTTCTCATCATGATGGGGCA (SEQ ID NO: 5) Flag-p85α-M2 (Δ322-430aa) GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATATAC (SEQ ID NO: 3) GACACTATAGAATAGGGCCCTCTAGACAGTGGGAGTGGCACCTTCCAGG (SEQ ID NO: 6) Flag-p85α-M3 (1-322)+(430-617)aa GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATATAC (SEQ ID NO: 3) GACACTATAGAATAGGGCCCTCTAGAAGAACCTGATCAAGGTGATCGA (SEQ ID NO: 7) Flag-p85α-M4 (Δ430-617aa) GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATATAC (SEQ ID NO: 3) GACACTATAGAATAGGGCCCTCTAGATCATCGCCTCTGCTGTGCATA (SEQ ID NO: 4)

[0048] The cDNA of p85a and its truncated expression constructs amplified by using each primer shown in Table 1 was inserted into pcDNA3.1-FLAG empty vector to construct each expression plasmid.

[0049] The wild-type p85a and its truncated expression construct plasmids were transfected into HaCaT cells, and whole cell lysates were obtained and subjected to immunoprecipitation using an anti-FLAG antibody, and the immunoprecipitates were subjected to recognition using an anti-PERK antibody; and the p85a truncated expression construct that lost the PERK binding ability was screened.

[0050] 3. Analysis of the p85a mutant-mediated activation of the PERK-p53-PERP pathway and mediation of the apoptosis response: the full-length p85a and the p85a mutant that lost the PERK binding ability were complemented in the HaCaT cells in which the expression level of p85a was knocked down, the ability of the wild-type and mutant p85a to mediate the activation of the PERK-p53-PERP pathway induced by UVB was detected by Western-blot, and the ability of the wild-type and mutant p85a to mediate the apoptosis response induced by UVB was detected by thionine exclusion test.

[0051] II. Research results 1. By constructing p85a truncated expression construct expression plasmid and analyzing the structural basis of the binding reaction between p85a and PERK (Table 2) Figure 1 ), it was found that the 430-617 amino acids of p85a mediated the binding reaction with PERK, and thus the mutant (p85a-M4) that lacked this domain completely lost the PERK binding reactivity Figure 2 ).

[0052] 2. By analyzing the function of the p85a mutant (p85a-M4) that could not bind to PERK in the UVB stimulation reaction, it was found that compared with the wild-type p85a, p85a-M4 lost the functions of activating PERK and p53 and inducing PERP expression Figure 3 ), and could also antagonize the UVB-induced pro-apoptotic response Figure 4 ).

[0053] Based on the above results, the truncated mutant p85a-M4 that lacks the 430-617 amino acids has the functions of targeting PERK and antagonizing the UVB-induced pro-apoptotic response of skin keratinocytes, which provides a new idea for preventing the UVB-induced photodamage effect, and indicates that p85a-M4 has potential application value in the research and development of anti-UV photodamage drugs.

[0054] Table 2. Sequence of p85a-M4

[0055] Name Sequence SEQ ID p85α-M4 amino acid sequence MSAEGYQYRALYDYKKEREEDIDLHLGDILTVNKGSLVALGFSDGQEARPEEIGWLNGYNETTGERGDFPGTYVEYIGRKKISPPTPKPRPPRPLPVAPGSSKTEADVEQQALTLPDLAEQFAPPDIAPPLLIKLVEAIEKKGLECSTLYRTQSSSNLAELRQLLDCDTPSVDLEMIDVHVLADAFKRYLLDLPNPVIPAAVYSEMISLAPEVQSSEEYIQLLKKLIRSPSIPHQYWLTLQYLLKHFFKLSQTSSKNLLNARVLSEIFSPMLFRFSAASSDNTENLIKVIEILISTEWNERQPAPALPPKPPKPTTVANNGMNNNMSLQDAEWYWGDISREEVNEKLRDTADGTFLVRDASTKMHGDYTLTLRKGGNNKLIKIFHRDGKYGFSDPLTFSSVVELINHYRNESLAQYNPKLDVKLLYPVSHHDEKTWNVGSSNRNKAENLLRGKRDGTFLVRESSKQGCYACSVVVDGEVKHCVINKTATGYGFAEPYNLYSSLKELVLHYQHTSLVQHNDSLNVTLAYPVYAQQRR 1 p85a-M4 base sequence MSAEGYQYRALYDYKKEREEDIDLHLGDILTVNKGSLVALGFSDGQEARPEEIGWLNGYNETTGERGDFPGTYVEYIGRKKISPPTPKPRPPRPLPVAPGSSKTEADVEQQALTLPDLAEQFAPPDIAPPLLIKLVEAIEKKGLECSTLYRTQSSSNLAELRQLLDCDTPSVDLEMIDVHVLADAFKRYLLDLPNPVIPAAVYSEMISLAPEVQSSEEYIQLLKKLIRSPSIPHQYWLTLQYLLKHFFKLSQTSSKNLLNARVLSEIFSPMLFRFSAASSDNTENLIKVIEILISTEWNERQPAPALPPKPPKPTTVANNGMNNNMSLQDAEWYWGDISREEVNEKLRDTADGTFLVRDASTKMHGDYTLTLRKGGNNKLIKIFHRDGKYGFSDPLTFSSVVELINHYRNESLAQYNPKLDVKLLYPVSHHDEKTWNVGSSNRNKAENLLRGKRDGTFLVRESSKQGCYACSVVVDGEVKHCVINKTATGYGFAEPYNLYSSLKELVLHYQHTSLVQHNDSLNVTLAYPVYAQQRR atgagcgcggaaggctatcagtatcgcgcgctgtatgattataaaaaagaacgcgaagaagatattgatctgcatctgggcgatattctgaccgtgaacaaaggcagcctggtggcgctgggctttagcgatggccaggaagcgcgcccggaagaaattggctggctgaacggctataacgaaaccaccggcgaacgcggcgattttccgggcacctatgtggaatatattggccgcaaaaaaattagcccgccgaccccgaaaccgcgcccgccgcgcccgctgccggtggcgccgggcagcagcaaaaccgaagcggatgtggaacagcaggcgctgaccctgccggatctggcggaacagtttgcgccgccggatattgcgccgccgctgctgattaaactggtggaagcgattgaaaaaaaaggcctggaatgcagcaccctgtatcgcacccagagcagcagcaacctggcggaactgcgccagctgctggattgcgataccccgagcgtggatctggaaatgattgatgtgcatgtgctggcggatgcgtttaaacgctatctgctggatctgccgaacccggtgattccggcggcggtgtatagcgaaatgattagcctggcgccggaagtgcagagcagcgaagaatatattcagctgctgaaaaaactgattcgcagcccgagcattccgcatcagtattggctgaccctgcagtatctgctgaaacatttttttaaactgagccagaccagcagcaaaaacctgctgaacgcgcgcgtgctgagcgaaatttttagcccgatgctgtttcgctttagcgcggcgagcagcgataacaccgaaaacctgattaaagtgattgaaattctgattagcaccgaatggaacgaacgccagccggcgccggcgctgccgccgaaaccgccgaaaccgaccaccgtggcgaacaacggcatgaacaacaacatgagcctgcaggatgcggaatggtattggggcgatattagccgcgaagaagtgaacgaaaaactgcgcgataccgcggatggcacctttctggtgcgcgatgcgagcaccaaaatgcatggcgattataccctgaccctgcgcaaaggcggcaacaacaaactgattaaaatttttcatcgcgatggcaaatatggctttagcgatccgctgacctttagcagcgtggtggaactgattaaccattatcgcaacgaaagcctggcgcagtataacccgaaactggatgtgaaactgctgtatccggtgagcatcatgatgaaaaaacctggaacgtgggcagcagcaaccgcaacaaagcggaaaacctgctgcgcggcaaacgcgatggcacctttctggtgcgcgaaagcagcaaacagggctgctatgcgtgcagcgtggtggtggatggcgaagtgaaacattgcgtgattaacaaaaccgcgaccggctatggctttgcggaaccgtataacctgtatagcagcctgaaagaactggtgctgcattatcagcataccagcctggtgcagcataacgatagcctgaacgtgaccctggcgtatccggtgtatgcgcagcagcgccgc 2

[0056] The application has been described in detail. Those skilled in the art will understand that they can make modifications and alterations to this application without departing from the spirit and scope of the application. Although this application has been described with reference to particular embodiments, it is to be understood that modifications and alterations can be made to this application, and further improvements can occur to the skilled person that are intended to be encompassed within the spirit and scope of the application. In general, the application seeks to include any modification, use, or improvement of the application falling within the scope of the application as defined by the appended claims.

Claims

1. A truncated expression construct of p85α, characterized in that, The amino acid sequence of the truncated expression construct is shown as SEQ ID NO:

1.

2. Biomaterial, characterized in that, The biological material comprises any one of the following: (a) a nucleic acid encoding the truncated expression construct of claim 1; (b) a recombinant vector comprising the nucleic acid of (a); (c) a recombinant host cell comprising the nucleic acid of (a) or the recombinant vector of (b).

3. The biomaterial according to claim 2, characterized in that, The base sequence of the nucleic acid is shown as SEQ ID NO: 2 or has 80% and above identity with SEQ ID NO:

2.

4. The biomaterial of claim 2, wherein, The recombinant vector comprises an expression vector, a cloning vector.

5. The biomaterial of claim 4, wherein, The cloning vector comprises a plasmid vector, a phage vector, a phage-plasmid hybrid vector.

6. The biomaterial of claim 4, wherein, The expression vector comprises a plasmid expression vector, a viral expression vector, a large fragment expression vector.

7. The biomaterial of claim 2, wherein, The recombinant host cell comprises a eukaryotic cell, a prokaryotic cell.

8. A pharmaceutical composition for preventing UVB-induced skin photodamage, characterized by, It comprises the truncated expression construct of claim 1 and / or the biological material of any one of claims 2-7.

9. The pharmaceutical composition of claim 8, wherein, The pharmaceutical composition further comprises a pharmaceutical excipient.

10. Use of the truncated expression construct of claim 1 and / or the biological material of any one of claims 2-7 in the preparation of a pharmaceutical composition for preventing UVB-induced skin photodamage.

11. A method of preparing the truncated expression construct of claim 1, characterized in that, The method comprises genetic engineering techniques and artificial synthesis.

12. The method of claim 11, wherein, The steps of the genetic engineering techniques comprise: culturing the recombinant host cell of any one of claims 2-7 to express the truncated expression construct of claim 1; or, transfecting a host cell with the recombinant vector of any one of claims 2-7 to express the truncated expression construct of claim 1; or, transforming a host cell with the nucleic acid of any one of claims 2-7 to express the truncated expression construct of claim 1.

Images