A dextranase fusion modified body SpyCatcher-padex, its encoding gene and application

Abstract

The present invention discloses a SpyCatcher-padex fusion modified dextranase with improved enzyme activity, its encoding gene and applications, belonging to the field of biotechnology. The SpyCatcher-padex fusion modified dextranase provided by the present invention is obtained by fusing the SpyCatcher gene fragment at the N-terminus of the dextranase padex gene (GenBank No. KF999646.1) from Penicillium aculeatum through homologous recombination. The fusion modified SpyCatcher-padex of the present invention can specifically hydrolyze α-1,6 glycosidic bonds, and the enzyme activity is 3.21 times that of the unmodified padex. The obtained SpyCatcher-padex fusion modified dextranase of the present invention can be used as a fusion modified material that can significantly improve the enzyme-catalyzed degradation activity of dextran. At the same time, the present invention can also provide a technical reference for further research on dextranase in biochemistry and molecular biology.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, relates to enzyme engineering technology, and specifically relates to a dextranase fusion transformant SpyCatcher-padex with improved enzyme activity, its coding gene and application. Background Art

[0002] Dextranase is a hydrolase that specifically cleaves the α-1,6 glycosidic bond of dextran. Through an enzymatic reaction, it decomposes long-chain dextran into dextran with a lower molecular weight and oligo-isomaltose. This enzyme is of great significance in the food industry for controlling the viscosity of sugars, in the pharmaceutical industry for regulating the release characteristics of drugs, and in the preparation of biomaterials for improving the properties of materials. According to its source, dextranase can be divided into different types, such as bacterial source, fungal source, etc., and the properties and activities of each type of enzyme may vary. In bioengineering and molecular biology research, dextranase, as a tool enzyme, can be used to construct and modify sugar chains to achieve specific functions or characteristics.

[0003] In traditional industries, the production of low-molecular-weight dextran usually adopts an acid hydrolysis process. The acid hydrolysis process needs to be carried out in an environment with high energy consumption, which does not meet the development requirements of green environmental protection. In addition, the acid hydrolysis process is random, which will cause the molecular weight of the product to be not concentrated and non-uniform, affecting product quality and yield.

[0004] The catalytic application of dextranase can effectively solve the above problems. This enzyme can specifically catalyze the degradation of high-molecular-weight dextran and is suitable for the application of biological polysaccharides in the pharmaceutical field. The patent with publication number CN116179386A realized the application of high-level extracellular expression of dextranase by systematically modifying the promoter, signal peptide and co-expressing molecular chaperones. The patent with publication number CN115786308B achieved the molecular modification of wild enzyme through gene mutation, and the catalytic efficiency and stability of the mutant enzyme S326V were significantly improved. Although certain achievements have been made in the research on microbial dextranase at home and abroad, it still cannot meet the industrial production requirements, and there is an urgent need for a dextranase with higher activity. Summary of the Invention

[0005] The purpose of the present invention is to provide a dextranase fusion transformant SpyCatcher-padex with higher enzyme activity, its coding gene and application. Specifically, the present invention is realized by adopting the following technical solutions:

[0006] The first object of the present invention is to provide a dextranase fusion modified body SpyCatcher-padex, which is obtained by fusing the SpyCatcher gene fragment at the N-terminus of the dextranase padex gene (GenBank No. KF999646.1) derived from Penicillium aculeatum by homologous recombination, and its nucleotide sequence is as shown in SEQ ID NO.7.

[0007] The second object of the present invention is to provide a gene encoding the above-mentioned fusion modified body SpyCatcher-padex.

[0008] The third object of the present invention is to provide a recombinant expression plasmid containing the gene encoding the fusion modified body SpyCatcher-padex.

[0009] Preferably, the expression plasmid is the expression vector pPICZα-A.

[0010] The fourth object of the present invention is to provide a host expression cell containing the above-mentioned recombinant expression plasmid. The host expression cell is Pichia pastoris.

[0011] The fifth object of the present invention is to provide a genetically engineered bacterium SpyCatcher-padex, which is obtained by culturing the above-mentioned host expression cell and screening through bleomycin resistance. The genetically engineered bacterium SpyCatcher-padex is classified and named as Pichia pastoris, and the preservation number is CGMCC No. 32605. It is preserved in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms, and the preservation address is No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing. The preservation date is November 13, 2024.

[0012] The sixth object of the present invention is to provide a method for obtaining the coding gene of the fusion modified body SpyCatcher-padex, which includes the following steps:

[0013] (1) Synthesize the SpyCatcher gene (PDB ID: 4MLI) according to the gene sequence provided by NCBI, and synthesize it through Suzhou Anshengda Biotechnology Co., Ltd. The nucleotide sequence of the gene is as shown in SEQ ID NO.1;

[0014] (2) Using the SpyCatcher gene as a template, the nucleotide sequence of the gene is as shown in SEQ ID NO.1, and using the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 as primers for PCR to obtain the first PCR product;

[0015] (3) Using the dextranase padex gene of Penicillium aculeatum as a template and the sequences shown in SEQ ID NO.4 and SEQ ID NO.5 as primers for PCR to obtain a second PCR product. The nucleotide sequence of the dextranase padex gene of Penicillium aculeatum is as shown in SEQ ID NO.6;

[0016] (4) Digest the first and second PCR products with DMT enzyme, then recover and purify them by gel electrophoresis again. Perform homologous recombination in a ratio of the first PCR product: the second PCR product = 2:1, transform, and select single colonies to obtain the coding gene of the fusion modified SpyCatcher-padex, and the nucleotide sequence is as shown in SEQ ID NO.7.

[0017] The present invention does not specifically limit the system of the PCR, and the conventional PCR system in the art can be used. For example, the PCR procedures in steps (2) and (3) can be: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 5 s, annealing at 60°C for 15 s, extension at 72°C for 2 min, 35 cycles; extension at 72°C for 5 min.

[0018] The seventh object of the present invention is that the fusion modified SpyCatcher-padex can be applied in the catalysis of dextran degradation. The fusion modified SpyCatcher-padex can specifically hydrolyze α-1,6 glycosidic bonds. Under the condition of 35°C, using dextran T70 as the enzymatic hydrolysis substrate and reacting for 3 h, the molecular weight of the hydrolysis product is 6000 Da, and the molecular weight distribution is concentrated. The enzyme activity is 3-4 times that of the unmodified padex. Incubated at 40°C for 1 h, the enzyme activity is 98.04% of the initial activity.

[0019] The nucleotide sequences involved in the present invention are as follows:

[0020] SEQ ID NO.1

[0021] ATGGCGATGGTGGATACCCTGAGCGGCCTGAGCAGCGAACAAGGTCAGAGCGGCGATATGACCATTGAAGAGGATGATGAAACCCATATTAAATTTAGCAAACGCGATGAAGATGATGAAGAACTGGCGGGCGCGACCATGGAACTGCGCGATAGCAGCGGCGAAACCATTAGCACCTGGATTAGCGATGGCGAAGTGAAAGATTTTTATCTGTATCCGGGCAAATATACCTTTGTGGAAACCGCGGCGCCGGATGGCTATGAAGTGGCGACCGCGATTACCTTTACCGTGAACGAAGAAGGCGAAGTGACCGTGGATGGCAAAGCGACCAAAGGCGATGCGCATATT

[0022] SEQ ID NO.2

[0023] 5’--TCGAGAAAAGAGAGGCTGAAGCTGAATTCTTCGAAACGATGGCGATGGTGGATACCCTGAGC--3’

[0024] SEQ ID NO.3

[0025] 5’--GAGCCAAAGTCAACAACTTCAACATAGTAGCGCCGCTGCCGCCGCTGCCAATATGCGCATCG--3’

[0026] SEQ ID NO.4

[0027] 5’--GAATTCAGCTTCAGCCTCTCTTTTCTCGA--3’

[0028] SEQ ID NO.5

[0029] 5’--GCTACTATGTTGAAGTTGTTGACTTTGGCT--3’

[0030] SEQ ID NO.6

[0031]

[0032] SEQ ID NO.7

[0033]

[0034] At present, there is no relevant report on the research of improving the enzymatic catalytic activity of dextranase through fusion modification. In the present invention, a dextranase fusion modified body SpyCatcher-padex is obtained by fusing the SpyCatcher gene at the N-terminus. The dextranase and its fusion modified body SpyCatcher-padex protein are obtained through eukaryotic expression. Through enzyme activity detection, it is found that the enzyme activity of the fusion modified body SpyCatcher-padex is significantly improved. The dextranase fusion modified body SpyCatcher-padex obtained in the present invention can be used as a fusion modified body material that can significantly improve the enzymatic catalytic degradation activity of dextran. At the same time, the present invention can also provide a technical reference for the further research on dextranase in the fields of biochemistry and molecular biology. Description of the Drawings

[0035] Figure 1 is the plasmid construction diagram of SpyCatcher-padex in the embodiment of the present invention;

[0036] Figure 2 is the PCR diagram of the fusion modified body SpyCatcher-padex in the embodiment of the present invention;

[0037] Figure 3 is the SDS-PAGE diagram of the fusion modified body SpyCatcher-padex protein in the embodiment of the present invention;

[0038] Figure 4 is the enzyme activity comparison diagram measured in the embodiment of the present invention;

[0039] Figure 5 is the temperature stability comparison diagram at 40°C in the embodiment of the present invention;

[0040] Figure 6 is the HPLC diagram of the catalytic hydrolysis of dextran in the embodiment of the present invention, which is a high performance liquid chromatography diagram. In the figure, the ordinate represents the peak height, that is, the content, and the abscissa represents the peak time and also represents the molecular weight size, and the molecular weight size is indicated. Detailed Embodiments

[0041] The following embodiments are further descriptions of the content of the present invention to explain the technical content of the present invention. However, the substantial content of the present invention is not limited to the following embodiments. Those of ordinary skill in the art can and should know that any simple changes or substitutions based on the substantial spirit of the present invention should fall within the scope of protection required by the present invention.

[0042] The fusion modified dextranase SpyCatcher-padex of the present invention has a nucleotide sequence as shown in SEQ ID NO.7. The fusion modified SpyCatcher-padex of the present invention fuses the SpyCatcher gene sequence at the N-terminus of the padex nucleotide sequence; the nucleotide sequence of the padex is as shown in SEQ ID NO.6. The present invention does not specifically limit the method of the fusion, and homologous recombination is preferably used. The padex gene of the present invention is derived from Penicillium aculeatum. The method for constructing the fusion modified dextranase SpyCatcher-padex of the present invention, the enzyme activity detection and application are described in detail below.

[0043] Example 1

[0044] (1) Construct the plasmid pPICZα-A-SpyCatcher-padex, as Figure 1 shown. The SpyCatcher-padex dextranase gene SpyCatcher-padex is obtained by gene PCR and homologous recombination. Using the SpyCatcher gene as a template, the SpyCatcher gene (PDB ID: 4MLI) is synthesized according to the gene sequence provided by NCBI and synthesized by Suzhou Anshengda Biotechnology Co., Ltd. The nucleotide sequence of the gene is as shown in SEQ ID NO.1. Using the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 as primers for PCR, the first PCR product is obtained, and the nucleic acid electrophoresis pattern is as Figure 2 a;

[0045] (2) Using the Penicillium aculeatum dextranase padex gene (GenBank No. KF999646.1) as a template and the sequences shown in SEQ ID NO.4 and SEQ ID NO.5 as primers for PCR, the purpose is to linearize the padex gene to obtain the second PCR product. The nucleotide sequence of the Penicillium aculeatum dextranase padex gene is as shown in SEQ ID NO.6, and the nucleic acid electrophoresis pattern is as Figure 2 b;

[0046] The PCR conditions are: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 5 s, annealing at 60 °C for 15 s, extension at 72 °C for 2 min, for 35 cycles; extension at 72 °C for 5 min. After the PCR reaction is completed, it is detected by agarose gel electrophoresis.

[0047] (3) Digest the first and second PCR products with DMT enzyme respectively, then recover the first and second PCR amplification products by gel extraction, perform homologous recombination to construct a recombinant plasmid. The reaction system selected for the ligation in the present invention is a homologous recombination system. Preferably: purified first PCR product: 2 μL; purified second PCR product: 1 μL; 2×Basic Assembly PremixMix 5 μL, and make up the reaction system to 10 μL with ultrapure water.

[0048] The procedure for the ligation in the present invention: Gently mix the above reaction system and place it at 50 °C for incubation for 30 min, then place it on ice to obtain the ligation product. Transform the ligation product into Escherichia coli DH5α competent cells, add 500 μL of LLB liquid medium, culture at 37 °C and 220 rpm for 1 h, take 50 μL of the bacterial solution and spread it on a solid LLB plate containing 100 μg / mL bleomycin antibiotic, culture overnight at 37 °C, pick positive colonies for PCR identification, and send the positive bacterial solution to General Biosystems for sequencing. Linearize the plasmid with correct sequencing using SacⅠ endonuclease, and then transform it into Pichia pastoris X33 competent cells.

[0049] (4) Preparation of Pichia pastoris X33 competent cells

[0050] Activate the Pichia pastoris X33 strain (purchased from Invitrogen) on a YPD plate to obtain a single and dispersed colony. Pick a single colony and inoculate it into 5 mL of YPD medium, culture at 30 °C and 250 rpm for 24 h, then take 1 mL and inoculate it into 50 mL of YPD medium, continue to culture under the same conditions for 4 to 6 h until the OD600 of the cells reaches 1.1 - 1.3. Transfer the bacterial solution to a 50 mL centrifuge tube, centrifuge at 1500×g at 4 °C for 5 min, and discard the supernatant. Resuspend the cells with 40 mL of ice-precooled sterile water, centrifuge at 1500×g at 4 °C for 5 min, and discard the supernatant. Repeat this step once. Resuspend the cells with 10 mL of ice-precooled 1 M sorbitol solution, centrifuge at 1500×g at 4 °C for 5 min, and discard the supernatant. The prepared yeast competent cells are stored at -80 °C in a refrigerator at low temperature, and use them immediately after preparation to avoid repeated freezing and thawing.

[0051] (5) Electroporation

[0052] Competent cells preserved by thawing at ultra-low temperature on ice. Let it stand for 5 - 6 min until the competent cells are completely melted. Immediately add 10 μL of the linearized recombinant plasmid obtained in step (3), and let it stand on ice for about 2 min. Preheat the electroporator 30 min in advance. Add the competent cells into the electroporation cuvette and perform electroporation: voltage 2500 V, time 4.5 ms. Take out the electroporation cuvette, immediately add 1 mL of ice-precooled 1 M sorbitol solution to rinse the yeast cells in the electroporation cuvette, and transfer them to a centrifuge tube. Incubate at 30 °C and 250 rpm on a shaker for 1 h. Centrifuge the cultured cells at 4000 x g for 2 min, aspirate 900 μL of the supernatant with a pipette tip, resuspend the cells with the remaining medium, spread all the cells on a YPD plate containing 100 μg / mL zeocin resistance, and incubate it upside down at 30 °C for 3 - 5 d. Observe the growth of the cells on the medium to obtain the genetically engineered bacterium SpyCatcher-padex of the fusion transformant, which is classified and named as Pichia pastoris, and the preservation number is CGMCC No. 32605. Pick a single colony and culture it in YPD medium at 30 °C and 220 rpm for 24 h.

[0053] (6) Enrichment culture and methanol induction

[0054] Inoculate the genetically engineered bacterium SpyCatcher-padex of the fusion transformant cultured in step (5) into the liquid YPD medium at an inoculation amount of 0.5%, and culture it at 30 °C and 250 r / min for 24 h. Then, inoculate it into the BMGY medium at a ratio of 1% and culture it under the same conditions for 12 - 24 h. Centrifuge to collect the cells, discard the supernatant of the culture solution, and then resuspend the cells in the BMMY medium. Finally, culture it on a shaker at 25 °C and 250 r / min for 5 days. Add 1% methanol every 24 h for induction. Centrifuge the induced fermentation broth at 10000 r / min for 15 min at 0 °C, and collect the supernatant as the dextranase fusion transformant SpyCatcher-padex, with an enzyme activity of 150 - 200 U / mL. Subsequently, perform protein electrophoresis, and the protein size is 78 KDa, that is, dextranase padex 65 KDa + SpyCatcher 13 KDa. The protein electrophoresis pattern is as Figure 3 shown.

[0055] Among them, each liter of the BMGY medium contains: 1% yeast extract powder, 2% peptone, 100 mM sodium phosphate pH 6.0, 1.34% YNB, 4x10 -5% Biotin, 1% glycerol. Preparation method: Weigh 20 g of peptone and 10 g of yeast extract powder, dissolve them in water, add 100 mL of 1 M potassium phosphate buffer at pH 6.0, make up the volume to 800 mL with water, sterilize by autoclaving at 121 °C for 20 min, add 100 mL of 10% glycerol, 100 mL of 10xYNB, and 2 mL of 500xB. After preparation, dispense into aliquots.

[0056] Each liter of the BMMY medium contains the following medium formula: 1% yeast extract, 2% peptone, 100 mM sodium phosphate at pH 6.0, 1.34% YNB, 4x10 -5 % Biotin (B), 1% methanol. Preparation method: Weigh 20 g of peptone and 10 g of yeast extract powder, dissolve them in water, add 100 mL of 1 M sodium phosphate buffer at pH 6.0, make up the volume to 800 mL with water, sterilize by autoclaving at 121 °C for 20 min, add 100 mL of 10% methanol, 100 mL of 10xYNB, and 2 mL of 500xB. After preparation, dispense into aliquots.

[0057] Preparation of 100 mg / mL Zeocin (bleomycin): Weigh 100 mg of bleomycin, add it to 1 mL of sterile water, filter and sterilize through a 0.22 μm microporous filter membrane, and store at -20 °C after aliquoting.

[0058] 10xYNB: Weigh 134 g of YNB (yeast nitrogen base), dissolve it in 1000 mL of water, filter and sterilize through a 0.22 μm sterile filter head, store at 4 °C, and the validity period is 1 year.

[0059] 500xB: Weigh 20 mg of biotin, dissolve it in 100 mL of water, filter and sterilize through a 0.22 μm sterile filter head, and can be stored at 4 °C for one year.

[0060] (7) The enzyme activity is detected by the DNS method.

[0061] Enzyme activity determination

[0062] 1. Preparation of reaction system: Take 400 μL of substrate solution containing 3% dextran T70, and add 100 μL of enzyme solution diluted to an appropriate multiple.

[0063] 2. Temperature-controlled reaction: Incubate in a 35 °C water bath for 1 hour.

[0064] 3. Termination of reaction: Add 375 μL of DNS to the reaction solution, and then heat in a boiling water bath for 5 minutes.

[0065] 4. Cooling and dilution: After cooling, add 5 mL of distilled water to the system and mix well.

[0066] 5. Photometric determination: Measure the photometric value at 540 nm, using the inactivated enzyme solution as a control group.

[0067] 6. Calculate the enzyme activity: Calculate the content of reducing sugar in the catalytic system according to the glucose standard curve, and finally calculate the enzyme activity of the sample solution. The definition of enzyme activity unit is: The amount of enzyme required to produce 1 μmol of reducing sugar (glucose equivalent) per minute is one enzyme activity unit (U).

[0068] (8) Incubate dextranase padex and the fusion modified dextranase SpyCatcher-padex at 35 °C under the condition of pH 5.5 to catalyze 3% T70 substrate solution for 1 h, and detect the enzyme activity by DNS method. Taking the enzyme activity of dextranase as 100%, calculate the relative enzyme activity of the fusion modified dextranase SpyCatcher-padex. Taking the enzyme activity of dextranase padex as 100%, as Figure 4 , the fusion modified dextranase SpyCatcher-padex is 3.21 times the enzyme activity of dextranase padex.

[0069] (9) Incubate dextranase padex and the fusion modified dextranase SpyCatcher-padex at 40 °C, sample at different times, and then detect the enzyme activity to compare the temperature stability of the two at 40 °C. As Figure 5 , it can be seen that when the fusion modified dextranase SpyCatcher-padex is incubated at 40 °C for 1 h, taking the activity at 0 h as 100%, the enzyme activity is 98.04% of the original enzyme activity, while when dextranase padex is incubated at 40 °C for 1 h, the enzyme activity is 84.67% of the original enzyme activity.

[0070] (10) The fusion modified dextranase SpyCatcher-padex has substrate specificity and can specifically recognize and catalyze the cleavage of α-1,6 glycosidic bond. Under the condition of 35 °C, using dextran T70 as the enzymatic hydrolysis substrate and reacting for 3 h, the molecular weight of the hydrolysis product is 6000 Da, and the molecular weight distribution is concentrated. SpyCatcher-padex can efficiently catalyze the hydrolysis of high molecular weight dextran and can be used in industrial production. The HPLC diagram is as Figure 6 .

[0071] From the above determination experiments, it can be known that the fusion modified dextranase constructed in the present invention has higher activity, stability and specific catalytic characteristics, and can be widely applied to fields such as food processing and drug synthesis, with high commercial value.

[0072] It should be noted that the above technical content of the present invention is only an explanation and clarification to enable those skilled in the art to understand the technical essence of the present invention. Therefore, the said technical content is not used to limit the scope of the substantive protection of the present invention. The scope of the substantive protection of the present invention shall be subject to what is described in the claims. Those skilled in the art should be aware that any modifications, equivalent replacements, improvements, etc. made based on the substantive spirit of the present invention shall fall within the scope of the substantive protection of the present invention.

Claims

1. A fusion modified SpyCatcher-padex of dextranase, which is obtained by fusing the SpyCatcher gene fragment at the N-terminus of the dextranase padex gene derived from Penicillium aculeatum by homologous recombination; the gene of the fusion modified SpyCatcher-padex has a nucleotide sequence as shown in SEQ ID NO.

7.

2. A recombinant expression plasmid containing the gene of the fusion modified SpyCatcher-padex according to claim 1, and the vector of the expression plasmid is pPICZα-A.

3. A host expression cell containing the recombinant expression plasmid according to claim 2, and the host expression cell is Pichia pastoris.

4. A genetically engineered bacterium SpyCatcher-padex, which is obtained by culturing the host expression cell according to claim 3 and screening through bleomycin resistance.

5. The genetically engineered bacterium SpyCatcher-padex described in claim 4, classified and named as Pichia pastoris Pichia pastoris , with the preservation number of CGMCC No. 32605, preserved in the China General Microbiological Culture Collection Center, the preservation address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the preservation date is November 13, 2024.

6. A method for obtaining the gene of the fusion transformant SpyCatcher-padex described in claim 1, characterized in that, Comprising the following steps: (1) Synthesize the SpyCatcher gene according to the gene sequence provided by NCBI, and its nucleotide sequence is as shown in SEQ ID NO.1; (2) Using the SpyCatcher gene as a template, the nucleotide sequence of the gene is as shown in SEQ ID NO.1, and using the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 as primers for PCR to obtain the first PCR product; (3) Using the dextranase padex gene of Penicillium aculeatum as a template, and using the sequences shown in SEQ ID NO.4 and SEQ ID NO.5 as primers for PCR to obtain the second PCR product, and the nucleotide sequence of the dextranase padex gene of Penicillium aculeatum is as shown in SEQ ID NO.6; (4) Digest the first and second PCR products with DMT enzyme, then recover the gel and purify again, and perform homologous recombination on the first PCR product: the second PCR product in a ratio of 2:1, transform, and select single colonies to obtain the coding gene of the fusion modified SpyCatcher-padex.

7. The method according to claim 6, wherein The PCR procedures in steps (2) and (3) are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 5 s, annealing at 60°C for 15 s, extension at 72°C for 2 min, for 35 cycles; extension at 72°C for 5 min.

8. The application of the fusion modified SpyCatcher-padex according to claim 1 in catalyzing dextran degradation.

9. The application according to claim 8, characterized in that, When catalyzing the dextran T70 substrate at 35°C and pH 5.5, the enzyme activity of the dextranase fusion modified SpyCatcher-padex is 3-4 times that of the dextranase padex.

Images