A strain of Lactobacillus casei ZKLc1221, its lactobacillus and its application in improving ulcerative colitis

Lactobacillin obtained by optimizing fermentation conditions solved the problem of side effects of toxicity in the treatment of ulcerative colitis, and significantly improved the clinical symptoms and pathological status of ulcerative colitis, achieving effective improvement of ulcerative colitis.

CN119614462BActive Publication Date: 2025-06-06SHANDONG ZHONGWEI ZHONGKANG BIOTECHNOLOGY CO LTD

Patent Information

Application Number
CN202510152405.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-12
Publication Date
2025-06-06
Estimated Expiration
2045-02-12

AI Technical Summary

Technical Problem

The existing treatment methods for ulcerative colitis have toxic side effects, and lactic acid bacterial cells show differences under the isolation and culture conditions of different strains, which affects their application effect.

Method used

Lactobacillin of Lactobacillus casei ZKLc1221 was obtained by optimizing fermentation conditions. This lacticobacillin has good thermal stability and pH stability and is used to improve ulcerative colitis.

Benefits of technology

Lactobacillin of Lactobacillus casei ZKLc1221 significantly improves the pathological damage of ulcerative colitis, reduces disease activity index, restores crypt structure, reduces inflammatory cell infiltration, and regulates the level of inflammatory factors in the serum, protects the intestinal mucosal barrier.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119614462B_ABST
    Figure CN119614462B_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of probiotics, and in particular to a strain of Lactobacillus casei ZKLc1221, its lactobacillus and its application in improving ulcerative colitis. Lactobacillus casei )ZKLc1221 has been deposited in the General Microbiology Center of China Microorganism Culture Collection Committee on June 21, 2023, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 27673. The lactobacillus obtained by optimizing the fermentation conditions of Lactobacillus casei ZKLc1221 provided by the present invention has good thermal stability, good effect in improving ulcerative colitis, and can significantly improve pathological damage to the colon.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of probiotics, and in particular to a Lactobacillus casei ZKLc1221, its lactobacillus and application thereof in improving ulcerative colitis. Background Art

[0002] Ulcerative colitis (UC) is a chronic nonspecific inflammatory bowel disease. The cause of the disease is still unclear. It may be related to multiple factors such as genetics, immunity, environment, and infection. It is more common in people with a family history of genetics, long-term smokers, and high-fat diets, and the mortality rate is low. Clinical symptoms include diarrhea, abdominal pain, mucus, pus, and blood in the stool. It is not contagious. Severe cases may be complicated by intestinal perforation, massive bleeding, and cancer. The treatment of this disease is mainly based on Western medicine. Sulfasalazine is effective in treating ulcerative colitis and is a conventional drug, but it may cause nausea, headache, palpitations, anorexia, vomiting, abdominal pain, and other adverse reactions. It may also cause hyperbilirubinemia, liver damage, and kidney damage.

[0003] Bacteriocins produced by lactic acid bacteria are called lactocins, which are a class of biologically active proteins, polypeptides or precursor polypeptides produced by lactic acid bacteria through the ribosome synthesis mechanism during metabolism, with little toxic side effects. Due to its broad-spectrum antibacterial, no toxin residues, and no drug resistance, it is widely used in the food, medicine and feed industries. With the deepening of lactocin research, it is found that lactocins isolated and cultured from different strains often have large differences in composition, size, thermal stability, mode of action, output mechanism, antibacterial spectrum and efficacy, which affects its application in production practice. Summary of the invention

[0004] In view of the technical problem that existing improvement methods for ulcerative colitis have toxic side effects, the present invention provides a strain of Lactobacillus casei ZKLc1221, its lactobacillus and application thereof in improving ulcerative colitis. The lactobacillus casei ZKLc1221 obtained by optimizing fermentation conditions has good thermal stability, is effective in improving ulcerative colitis, and can significantly improve pathological damage to the colon.

[0005] In a first aspect, the present invention provides a strain of Lactobacillus casei ( Lactobacillus casei ) ZKLc1221 was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on June 21, 2023. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No.27673.

[0006] In a second aspect, the present invention provides a lactobacillus of the above-mentioned Lactobacillus casei ZKLc1221, and the preparation method is as follows: inoculate the Lactobacillus casei ZKLc1221 in an MRS liquid culture medium at an inoculation amount of 3%, and culture at 37°C for 24 hours to obtain a first-generation seed liquid, inoculate the first-generation seed liquid in a skim milk culture medium at an inoculation amount of 2%, and culture at 37°C for 24 hours to obtain a second-generation seed liquid, inoculate the second-generation seed liquid in a skim milk culture medium containing glucose at an inoculation amount of 2%, and culture at 37°C for 24 hours, and the supernatant obtained by centrifugation is the lactobacillus casei ZKLc1221;

[0007] The concentration of skim milk powder in the skim milk medium used to culture the first-generation seed solution is 8%;

[0008] The glucose concentration in the glucose-containing skim milk medium for culturing the second-generation seed solution was 6%, and the concentration of skim milk powder was 22%.

[0009] Furthermore, the number of Lactobacillus casei ZKLc1221 cells in the lactobacillus of Lactobacillus casei ZKLc1221 was 1.20×10 9 cfu / mL.

[0010] In a third aspect, the present invention further provides a use of the lactobacillus of the above-mentioned Lactobacillus casei ZKLc1221 in the preparation of a medicament for improving ulcerative colitis.

[0011] Furthermore, the ulcerative colitis is 2,4,6-trinitrobenzenesulfonic acid-induced ulcerative colitis.

[0012] Further, improving ulcerative colitis includes reducing the disease activity index.

[0013] Further, improvement in ulcerative colitis includes alleviation of shortening of colon length.

[0014] Furthermore, improvement of ulcerative colitis includes restoration of crypt structure, alleviation of colon mucosal epithelial cell shedding and reduction of inflammatory cell infiltration.

[0015] Furthermore, the improvement of ulcerative colitis includes reducing the levels of inflammatory factors IL-1β, IL-18, IL-6 and TNF-α in serum.

[0016] Furthermore, improving ulcerative colitis includes increasing the expression levels of Occludin and ZO-1.

[0017] The beneficial effects of the present invention are:

[0018] The present invention has been found through research that lactobacillus casei ZKLc1221 obtained under certain fermentation conditions has good thermal stability and pH stability, and still retains 73.10% of antibacterial activity after heat treatment at 121°C for 20 minutes. Compared with the strain itself, the lactobacillus fermented can maintain good antibacterial activity under a wider pH range, and can also safely and effectively improve ulcerative colitis, including improving the disease activity index of ulcerative colitis, restoring colon length, alleviating tissue pathological structure damage, regulating the content of inflammatory factors in serum, regulating the expression of tight junction proteins Occludin and ZO-1 in colon epithelial cells, and protecting the intestinal mucosal barrier, and the effect is close to that of sulfasalazine. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a photo of the colony morphology of Lactobacillus casei ZKLc1221.

[0020] Figure 2 This is a Gram staining picture of Lactobacillus casei ZKLc1221.

[0021] Figure 3 is a line graph of the weight changes of mice in each group; ** indicates a significant difference compared with NC (P<0.01). ## It indicates that the difference is significant compared with UC (P<0.01).

[0022] Figure 4 is a line graph of the changes in the DAI index of each group of mice; among them, ** indicates a significant difference compared with NC (P<0.01), ## It indicates that the difference is significant compared with UC (P<0.01).

[0023] Figure 5 is a bar graph of the colon length of mice in each group; ** indicates a significant difference compared with NC (P<0.01). ## It indicates that the difference is significant compared with UC (P<0.01).

[0024] Figure 6 These are HE staining photos of colon tissues of mice in each group.

[0025] Figure 7 is a bar graph of the staining scores of mice in each group; ** indicates a significant difference compared with NC (P<0.01). ## It indicates that the difference is significant compared with UC (P<0.01).

[0026] Figure 8A is a bar graph of the expression levels of serum inflammatory factors in each group of mice; A is a bar graph of the expression levels of IL-1β in each group of mice; B is a bar graph of the expression levels of IL-18 in each group of mice; C is a bar graph of the expression levels of TNF-α in each group of mice; D is a bar graph of the expression levels of IL-6 in each group of mice; ** indicates a significant difference compared with NC (P<0.01), ## It indicates that the difference is significant compared with UC (P<0.01).

[0027] Fig. 9 A is a bar graph showing the mRNA expression levels of tight junction proteins Occludin and ZO-1 in the colon of each group of mice; A is a bar graph showing the mRNA expression levels of tight junction protein Occludin in the colon of each group of mice; B is a bar graph showing the mRNA expression levels of tight junction protein ZO-1 in the colon of each group of mice; where ** indicates a significant difference compared with NC (P<0.01), ## It indicates that the difference is significant compared with UC (P<0.01). DETAILED DESCRIPTION

[0028] In order to enable those skilled in the art to better understand the technical solutions of the present invention, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0029] Example 1 Isolation, screening and identification of bacterial species

[0030] 1. Strain screening and purification

[0031] (1) Sampling: Mare’s milk cheese, collected in the Horqin pasture area of ​​Chifeng City, Inner Mongolia Autonomous Region, China in December 2015;

[0032] (2) Reagents: MRS solid culture medium (Beijing Aobox Biotechnology Co., Ltd.), MRS-CaCO 3 Solid medium (1.5% CaCO 3 Add to MRS solid culture medium and sterilize at 121°C for 15 min to obtain MRS liquid culture medium (Beijing Aoboxing Biotechnology Co., Ltd.), DNA extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.);

[0033] (3) Strain isolation: The collected samples were diluted with physiological saline to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10-5 times, and 100 µL of the dilution was evenly applied on the MRS-CaCO 3 In solid culture medium, invert and culture at 37℃ for 24-48h, and observe the growth of colonies. After the colonies are formed, pick a single colony with calcium rings and perform three-zone streaking three times, and repeat the streaking separation several times until the colonies are purified. Inoculate the purified strain into MRS liquid culture medium for culture, and then mix it with 50% sterile glycerol at a ratio of 1:1 (v / v), and store it in a -80℃ refrigerator for use.

[0034] 2. Identification and preservation

[0035] (1) Colony morphology identification

[0036] The isolated strains were cultured on MRS solid medium plates for 48 h, and the colony morphology and color were observed and recorded. Figure 1 The colonies are round, smooth, convex, milky white, occasionally light yellow or dark yellow, with neat edges and opaque.

[0037] The colonies on the MRS solid culture medium plate were selected for smearing, fixation, crystal violet primary staining, mordanting, decolorization, water washing, safranin counterstaining, drying and microscopic examination. The results are shown in Figure 2 .

[0038] (2) 16S rDNA sequence determination

[0039] Extraction of strain genomic DNA: Take the MRS liquid culture medium containing the strain to be tested, centrifuge at 5000r / min for 10min, discard the supernatant after centrifugation, collect the pure culture bacteria to be tested, and use the DNA extraction kit to extract the strain genomic DNA according to the instructions.

[0040] PCR amplification: Based on the conserved region of the Lactobacillus 16S rDNA sequence, the bacterial universal primers 27F / 1492R were used. The primers used are as follows:

[0041] 27F (sequence 1): 5′-AGAGTTTGATCCTGGCTCAG-3′;

[0042] 1492R (sequence 2): 5'-GGTTACCTTGTTACGACTT-3'.

[0043] The PCR amplification conditions were as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s; annealing at 55°C for 35 s; extension at 72°C for 90 s; after 32 cycles, the final extension was at 72°C for 5 min.

[0044] The amplified product was sequenced by Beijing Qingke Biotechnology Co., Ltd. The sequencing results were compared with the NCBI database by BLAST, and a phylogenetic tree was constructed to determine that the strain to be tested was Lactobacillus casei ( Lactobacillus casei ), named Lactobacillus casei ZKLc1221.

[0045] The Lactobacillus casei Lactobacillus casei ) The 16S rDNA gene sequence of ZKLc1221 (sequence 3) is:

[0046]

[0047] Lactobacillus casei ( Lactobacillus casei ) ZKLc1221 was sent to the General Microbiology Center of China Microorganism Culture Collection Administration for preservation. The preservation date was June 21, 2023, and the preservation number was CGMCC No.27673.

[0048] Example 2 Optimization of fermentation conditions of Lactobacillus casei ZKLc1221

[0049] 1. Reagents and strains

[0050] LB medium (Beijing Aobxing Biotechnology Co., Ltd.); MRS medium (Beijing Aobxing Biotechnology Co., Ltd.); skim milk powder (Fonterra Cooperative Group Co., Ltd.); glucose (Beijing Aobxing Biotechnology Co., Ltd.); white sugar (COFCO Group Co., Ltd.); Escherichia coli CVCC233, Salmonella CVCC3383, and Staphylococcus aureus CVCC-519 were all purchased from China General Microorganism Collection Center; Lactobacillus casei ZKLc1221 was isolated and screened by ourselves.

[0051] 2. Experimental Methods

[0052] (1) Fermentation of skim milk powder by Lactobacillus casei ZKLc1221 to prepare Lactobacillus casei ZKLc1221 fermentation supernatant

[0053] Preparation of skim milk medium: Accurately weigh 15 g of skim milk powder, add water to make up to 100 mL, and prepare 15% skim milk medium (skim milk powder concentration is 15%). Prepare 8% skim milk medium (skim milk powder concentration is 8%) in the same way; sterilize at 115℃ for 15 min and set aside.

[0054] Activation and inoculation of seed liquid: inoculate the bacteria preserved in glycerol tube into MRS liquid culture medium (prepare MRS culture medium according to the instruction manual and sterilize at 115℃ for 15min) at a rate of 2% (v / v), and culture at 37℃ for 24h to obtain the first-generation seed liquid; inoculate the first-generation seed liquid into 8% skim milk culture medium at a rate of 2% (v / v), and culture at 37℃ for 24h to obtain the second-generation seed liquid; inoculate the second-generation seed liquid into 15% skim milk culture medium at a rate of 2% (v / v), and culture at 37℃ for 24h. Centrifuge to obtain the fermentation supernatant of Lactobacillus casei ZKLc1221.

[0055] (2) Antibacterial effect test (Oxford cup method)

[0056] Preparation of indicator bacteria: Salmonella CVCC3383, Escherichia coli CVCC233, and Staphylococcus aureus CVCC-519 were inoculated into LB medium, activated twice, and grown for three generations before taking the above fermentation bacterial suspension and adjusting the concentration to 1×10 6 CFU / mL.

[0057] Test method: 100 μL of the above indicator bacteria suspension was spread on LB medium, an Oxford cup was placed on the LB medium, 100 μL of Lactobacillus casei ZKLc1221 fermentation supernatant was added to the Oxford cup, and the cup was placed in an incubator at 37°C for 12 hours. The diameter of the inhibition zone was measured using a vernier caliper.

[0058] (3) Optimization of fermentation conditions

[0059] Skim milk powder concentration: Adjust the skim milk powder concentration in the skim milk medium inoculated with the second-generation seed solution by increasing the skim milk powder concentration by 8%, 12%, 18%, 22% and 25%. Keep other conditions unchanged (i.e., other conditions are the same as those in (1) seed solution activation and inoculation). Use (2) the Oxford cup method to detect their antibacterial effects.

[0060] Carbon source: The concentration of skim milk powder inoculated with the second-generation seed liquid was selected to be 22% (obtained based on the optimized conditions of skim milk powder concentration). Different types of carbon sources were added to the skim milk medium, namely sucrose, glucose, fructose or lactose, with an addition amount of 4% (m / v). Other conditions remained unchanged (i.e., other conditions were the same as (1) conditions for activation and inoculation of seed liquid). Their antibacterial effects were detected using (2) the Oxford cup method.

[0061] Glucose concentration: skim milk powder concentration was 22% (obtained based on the optimized conditions for skim milk powder concentration). Glucose was added to the skim milk medium (obtained based on the optimized conditions for carbon source). The glucose concentrations were 2%, 4%, 6%, and 8%, respectively. Other conditions remained unchanged (i.e., other conditions were the same as those for (1) seed liquid activation and inoculation). Their antibacterial effects were detected using the (2) Oxford cup method.

[0062] Inoculation amount of Lactobacillus casei ZKLc1221: skim milk powder concentration 22% (obtained according to the optimized conditions of skim milk powder concentration), glucose concentration 6% (obtained according to the optimized conditions of glucose concentration), the inoculation amount of Lactobacillus casei ZKLc1221 (second generation seed liquid) was set to 1%, 2%, 3%, 4%, 5%, and other conditions remained unchanged (i.e., other conditions were the same as (1) conditions for activation and inoculation of seed liquid), and their antibacterial effects were detected by (2) Oxford cup method.

[0063] 3. Experimental results

[0064] Table 1 Effect of changing the skim milk powder concentration in the fermentation supernatant of Lactobacillus casei ZKLc1221 on the size of the inhibition zone

[0065]

[0066] Note: The diameter of the inhibition zone includes the outer diameter of the Oxford cup (7.80mm); +: the diameter of the inhibition zone is 8.00~12.00mm; ++: the diameter of the inhibition zone is 12.00~16.00mm; +++: the diameter of the inhibition zone is 16.00~20.00mm; ++++: the diameter of the inhibition zone is greater than 20.00mm.

[0067] As can be seen from Table 1, when the skim milk powder concentration is 8%-22%, the diameter of the inhibition zone of Salmonella, Staphylococcus aureus and Escherichia coli formed by the fermentation supernatant of Lactobacillus casei ZKLc1221 on LB medium gradually increases, and the antibacterial effect gradually increases; on the contrary, when the skim milk powder concentration is 22%-25%, the diameter of the inhibition zone of Salmonella, Staphylococcus aureus and Escherichia coli formed by the fermentation supernatant of Lactobacillus casei ZKLc1221 on LB medium gradually decreases, and the antibacterial effect decreases. This shows that when the skim milk powder concentration is 22%, the amount of lactobacillus in the fermented Lactobacillus casei ZKLc1221 is higher, and the antibacterial effect is stronger. Therefore, the skim milk powder concentration is selected to be 22%.

[0068] Table 2 Effect of changing the carbon source type of the fermentation supernatant of Lactobacillus casei ZKLc1221 on the size of the inhibition zone

[0069]

[0070] As can be seen from Table 2, compared with sucrose, fructose and lactose, when glucose is used as a carbon source, the diameter of the Salmonella inhibition zone formed by the fermentation supernatant of Lactobacillus casei ZKLc1221 on LB medium is the largest, and the antibacterial effect is the strongest. In addition, the same results were obtained when measuring the inhibition zones of Staphylococcus aureus and Escherichia coli, so glucose was selected as a carbon source.

[0071] Table 3 Effect of changing the glucose concentration of the fermentation supernatant of Lactobacillus casei ZKLc1221 on the size of the inhibition zone

[0072]

[0073] As can be seen from Table 3, when glucose concentration increased to 6%, the diameter of the inhibition zone of Salmonella, Staphylococcus aureus and Escherichia coli formed by Lactobacillus casei ZKLc1221 fermentation supernatant on LB medium gradually increased, and the antibacterial effect gradually increased; However, when glucose concentration increased to 8% again, the trend of increasing the diameter of the inhibition zone of Salmonella, Staphylococcus aureus and Escherichia coli formed by Lactobacillus casei ZKLc1221 fermentation supernatant on LB medium was smaller, and the antibacterial effect increased trend was smaller. It is shown that the amount of lactobacillusin of Lactobacillus casei ZKLc1221 produced by fermentation at 6% glucose concentration is higher, and the antibacterial effect is stronger. So selecting glucose concentration is 6%.

[0074] Table 4 Effect of changing the inoculum amount of Lactobacillus casei ZKLc1221 fermentation supernatant on the size of the inhibition zone

[0075]

[0076] As can be seen from Table 4, when the inoculum amount of Lactobacillus casei ZKLc1221 was 1%-3%, the diameter of the inhibition zone of Salmonella, Staphylococcus aureus and Escherichia coli formed on LB medium increased gradually, and the antibacterial effect increased gradually; However, when the inoculum amount of Lactobacillus casei ZKLc1221 was increased to 5% again, the trend of the increase of the diameter of the inhibition zone of Salmonella, Staphylococcus aureus and Escherichia coli formed on LB medium was smaller, and the antibacterial effect increased trend was smaller. It is shown that the amount of lactobacillus casei ZKLc1221 produced by fermentation of the inoculum amount of Lactobacillus casei ZKLc1221 is higher, and the antibacterial effect is stronger. So the inoculum amount of Lactobacillus casei ZKLc1221 is selected to be 3%.

[0077] Example 3 Preparation of lactobacillus casei ZKLc1221

[0078] Preparation of skim milk medium: Accurately weigh 8g skim milk powder, add water to make up to 100mL, prepare 8% skim milk medium, sterilize at 115℃ for 15min, and set aside. Accurately weigh 22g skim milk powder and 6g glucose, add water to make up to 100mL, prepare 22% skim milk medium containing 6% glucose, sterilize at 115℃ for 15min, and set aside.

[0079] Activation and inoculation of seed solution: Lactobacillus casei ZKLc1221 preserved in a glycerol tube was inoculated in an MRS liquid medium (prepared by the same method as the MRS liquid medium in Example 2) at an inoculation rate of 3% (v / v), and cultured at 37°C for 24 h to obtain a first-generation seed solution; the first-generation seed solution was inoculated in an 8% skim milk medium at an inoculation rate of 2% (v / v), and cultured at 37°C for 24 h to obtain a second-generation seed solution; the second-generation seed solution was inoculated in a 22% skim milk medium containing 6% glucose at an inoculation rate of 2% (v / v), and cultured at 37°C for 24 h. The number of viable bacteria detected was 1.20×10 9 cfu / mL, and the fermentation supernatant of Lactobacillus casei ZKLc1221 was obtained by centrifugation, which was the lactobacillus of Lactobacillus casei ZKLc1221.

[0080] Comparative Example 1 Preparation of Lactobacillus acidophilus RZKLa0701 lactobacillus

[0081] The preparation method is the same as that in Example 3, except that the strain is replaced by Lactobacillus casei ZKLc1221 with Lactobacillus acidophilus RZKLa0701 (preservation number: CGMCC No. 22893), and the number of viable bacteria in the lactobacillus acidophilus RZKLa0701 lactobacillus is 1.20×10 9 cfu / mL.

[0082] Experimental Example 1 Study on the lactobacillus characteristics of Lactobacillus casei ZKLc1221

[0083] 1. Thermal stability study

[0084] The lactobacillus of Lactobacillus casei ZKLc1221 was kept at different temperatures (45℃, 60℃, 80℃, 100℃, 121℃) for 20 min. The lactobacillus casei ZKLc1221 at room temperature (25℃) was used as a control, and Staphylococcus aureus was used as an indicator bacteria. The antibacterial activity was detected by the Oxford cup method.

[0085] Table 5 Effect of temperature on the antibacterial activity of lactobacillus from Lactobacillus casei ZKLc1221

[0086]

[0087] As can be seen from Table 5, with the continuous increase of treatment temperature, the antibacterial activity continued to decrease, but after treatment at 121 ° C for 20 min, it still retained 73.10% of the antibacterial activity, which proves that the lactobacillus of Lactobacillus casei ZKLc1221 has quite good thermal stability.

[0088] 2. pH stability study

[0089] The pH of lactobacillus of Lactobacillus casei ZKLc1221 was adjusted to 3, 4, 5, 6, and 7 using lactic acid and sodium hydroxide. Lactic acid with the same pH was used as the control group. Staphylococcus aureus was used as the indicator bacteria, and the antibacterial activity was detected by the Oxford cup method.

[0090] Table 6 Effect of pH on the antibacterial activity of lactobacillus in Lactobacillus casei ZKLc1221

[0091]

[0092] As can be seen from Table 6, when the pH is 3 and 4, the inhibition zone of the lactic acid bacteria of Lactobacillus casei ZKLc1221 is not much different from that of the control group, indicating that the antibacterial effect at this time is likely to be the effect of acid; when the pH is 5, the inhibition zone of the lactic acid bacteria of Lactobacillus casei ZKLc1221 is 19.28 mm, which is 3.14 mm higher than that of the control group; when the pH is 6, the inhibition zone of the lactic acid bacteria of Lactobacillus casei ZKLc1221 is 14.89, and the control group has no antibacterial activity at this time; when the pH is 7, neither the lactic acid bacteria of Lactobacillus casei ZKLc1221 nor the control group has antibacterial activity. It can be seen that at pH 5 and 6, the antibacterial activity of lactobacillus casei ZKLc1221 was significantly higher than that of the control group, and with the increase of pH, the antibacterial activity gradually decreased, indicating that the antibacterial activity of lactobacillus casei ZKLc1221 was higher under slightly acidic conditions, and was higher at pH 5, showing that the pH range of antibacterial activity was 5-6.

[0093] Example 5 Effect of lactobacillus from Lactobacillus casei ZKLc1221 on TNBS (2,4,6-trinitrobenzenesulfonic acid)-induced ulcerative colitis (UC)

[0094] 1. Grouping and Dosing of Experimental Animals

[0095] Grouping: Fifty C57BL / 6 mice were randomly divided into 5 groups: blank control group (NC group), UC model group (UC group), UC+Lactobacillus casei ZKLc1221 lactobacillus group (CFSM group), UC+Lactobacillus acidophilus RZKLa0701 lactobacillus group (AFSM group), and positive control group (SASP group), with 10 mice in each group.

[0096] Experiment: After one week of adaptive feeding, except for the blank control group, the other four groups of mice were fasted but not watered for 24 hours before modeling. Mice were anesthetized by intramuscular injection of Shutai (Zolazepam hydrochloride for injection, 0.1mL / 100g), and an 8-gauge enema needle was inserted about 3-4cm from the anus. The TNBS / ethanol (5% TNBS: 50% ethanol = 1:1) mixture was slowly injected into the intestinal cavity of the mice at a dose of 0.1mL / 20g body weight. After the injection, about 0.2mL of air was injected, and the enema needle was pulled out after standing upside down for 1min. The mice were fed normally after waking up, and the modeling lasted for 7 days. Starting from the second day after modeling (for 7 consecutive days), the general conditions of the mice, such as activity, eating, and hair, were observed daily, and weight was tested at the same time. The mice showed symptoms such as reduced activity, reduced food intake, severe weight loss, and bloody stools, proving that UC mice were successfully modeled.

[0097] After the UC mouse model was established, mice in each group entered the drug intervention phase, specifically: NC group and UC group were gavaged with normal saline; CFSM group was gavaged with lactobacillus casei ZKLc1221 lactobacillus; AFSM group was gavaged with Lactobacillus acidophilus RZKLa0701 lactobacillus; SASP group was gavaged with SASP (sulfasalazine), the gavage dose was 200 mg / kg. The gavage volume was 0.2 mL / mouse / time, once a day, and the intervention lasted for 7 consecutive days.

[0098] 2. Index detection

[0099] (1) Body weight measurement: After modeling, the mice’s general conditions, such as activity, eating, and hair, were observed daily, and their body weight was measured.

[0100] (2) Fecal occult blood and DAI index: A fecal occult blood kit was used to detect occult blood in mice. The colitis disease activity index (DAI) score was calculated by measuring the weight of mice regularly during the experiment and evaluating the DAI score based on the clinical symptoms of the mice (weight loss, stool characteristics, and blood in the stool). According to the scoring criteria, the sum of the above three symptom scores divided by 3 was used as the DAI score.

[0101] (3) Colon length measurement: After the intervention, the colon length was measured.

[0102] (4) Colon pathology detection: HE staining was used to detect the changes in colon pathology in mice, and histological scoring was performed.

[0103] (5) Detection of serum inflammatory factors: Enzyme-linked immunosorbent assay (ELISA) kits (Wuhan Lingjiesi Biotechnology Co., Ltd.) were used to detect the inflammatory factors IL-1β, IL-18, TNF-α, and IL-6 in the serum of each group of mice.

[0104] (6) mRNA expression levels of tight junction proteins occludin and ZO-1 in colon tissue: Real-time PCR was used to determine the mRNA expression levels of tight junction proteins occludin and ZO-1 related genes, and Trizol reagent was used to extract total RNA from mouse colon inflammatory tissue.

[0105] The primer sequences for Occludin are:

[0106] F (sequence 4): TGGCAAGCGATCATACCCAGAG;

[0107] R (sequence 5):CTGCCTGAAGTCATCCACACTC.

[0108] Primer sequence for ZO-1 (SEQ ID 6): F: GTTGGTACGGTGCCCTGAAAGA;

[0109] R (sequence 7): GCTGACAGGTAGGACAGACGAT.

[0110] 3. Results Analysis

[0111] (1) Effect of lactobacillus from Lactobacillus casei ZKLc1221 on body weight of mice

[0112] like Figure 3 As shown in the figure, compared with the NC group, the weight gain of mice in each group treated with TNBS was slower; compared with the UC group, the weight of mice in the CFSM group increased significantly (P<0.01), and was close to that of the SASP group, and there was no significant difference in the weight of mice in the AFSM group and the model group (P>0.05). This indicates that the lactobacillus of Lactobacillus casei ZKLc1221 can improve the weight loss symptoms of UC mice, while the lactobacillus acidophilus RZKLa0701 lactobacillus has little effect on the weight loss symptoms of UC mice (no significant difference from the UC group, P>0.05).

[0113] (2) Effect of lactobacillus from Lactobacillus casei ZKLc1221 on the DAI index of mice

[0114] like Figure 4 As shown in the figure, the DAI index of mice in the UC group was significantly higher than that in the NC group (P < 0.01); compared with the UC group, the DAI index of the CFSM group was significantly lower (P < 0.01) and close to that of the SASP group, and there was no significant difference in the DAI index of mice in the AFSM group and the model group (P > 0.05). This indicates that the lactobacillus of Lactobacillus casei ZKLc1221 can effectively reduce the DAI index of UC mice and improve the fecal status of ulcerative colitis, while the lactobacillus acidophilus RZKLa0701 lactobacillus has little effect on the DAI index of UC mice (no significant difference with the UC group, P > 0.05).

[0115] (3) Effect of lactobacillus from Lactobacillus casei ZKLc1221 on colon length in mice

[0116] like Figure 5 As shown in the figure, compared with the NC group, the colon length of the mice in the UC group was extremely significantly reduced (P < 0.01); compared with the UC group, the colon length of the mice in the CFSM group was significantly increased (P < 0.01), and there was no significant difference with the SASP group (P > 0.05), and there was no significant difference in the colon length of the mice in the AFSM group with that in the UC group (P > 0.05). This indicates that the lactobacillus of Lactobacillus casei ZKLc1221 can reverse the adverse intestinal changes caused by UC, and the effect is close to that of the SASP group, while the lactobacillus acidophilus RZKLa0701 lactobacillus has little effect on the adverse intestinal changes caused by UC (no significant difference with the UC group, P > 0.05).

[0117] (4) Effects of lactobacillus from Lactobacillus casei ZKLc1221 on colon pathology in mice

[0118] like Figure 6 As shown in the figure, the intestinal tissue morphology and structure of the NC group were intact, the tissue layering structure was clear, the mucosal columnar epithelium was regular, and no other obvious abnormalities were observed; compared with the NC group, the intestinal mucosal columnar epithelial cells of the UC group mice were severely shed with obvious ulcer formation, local crypt loss, and inflammatory cell infiltration was observed in the interstitium; the mucosal epithelial cells of the CFSM group mice were disordered but not severely shed, some epithelial cells were damaged, shed, disintegrated and ablated, and the inflammatory cell infiltration in the interstitium was significantly reduced. The intestinal tissue morphology and structure of the AFSM group were clear, the mucosal epithelial cells were disordered, some intestinal mucosa disintegrated and ablated, obvious ulcer formation was observed locally, and obvious inflammatory cell infiltration was observed in the interstitium. The above results show that the intervention of lactobacillus casei ZKLc1221 lactobacillus improves the arrangement of intestinal epithelial cells, alleviates the shedding of some damaged epithelial cells and promotes the repair of epithelial tissue, and can significantly inhibit inflammatory infiltration, and the effect is close to that of the SASP group, while the lactobacillus acidophilus RZKLa0701 lactobacillus has little effect on the changes in colon pathology caused by UC. Figure 7 The same conclusion can be drawn from the histological scores.

[0119] (5) Effects of lactobacillus from Lactobacillus casei ZKLc1221 on serum inflammatory factors in mice

[0120] like Figure 8As shown in the figure, compared with the NC group, the serum inflammatory factors IL-1β, IL-18, TNF-α, and IL-6 concentrations in the UC group were significantly increased (P<0.01); compared with the UC group, the levels of IL-1β, IL-18, IL-6, and TNF-α in the CFSM group were significantly decreased (P<0.01), and there was no significant difference in the levels of IL-1β, IL-18, IL-6, and TNF-α in the AFSM group (P>0.05). This indicates that the lactobacillus of Lactobacillus casei ZKLc1221 significantly reduced the inflammatory response of UC mice and alleviated the inflammatory damage caused by UC, and the effect was close to that of the SASP group; while the lactobacillus acidophilus RZKLa0701 had little effect on the inflammatory damage caused by UC (no significant difference with the UC group, P>0.05).

[0121] (6) Effect of lactobacillus from Lactobacillus casei ZKLc1221 on the mRNA expression levels of tight junction proteins occludin and ZO-1 in mouse colon tissue

[0122] The expression of tight junction proteins occludin and ZO-1 in colonic epithelial cells is an important indicator for detecting colonic epithelial barrier function. This study further evaluated the effect of lactobacillus casei ZKLc1221 on colonic epithelial barrier by detecting the relative expression of occludin and ZO-1 mRNA in colonic tissue. Fig. 9 As shown in the data, compared with the NC group, the expressions of tight junction proteins Occludin and ZO-1 in colon epithelial cells of the UC group were significantly decreased (P < 0.01); compared with the UC group, the expression levels of tight junction proteins Occludin and ZO-1 in colon epithelial cells of the CFSM group were significantly increased (P < 0.01), and there was no significant difference in the expression levels of tight junction proteins Occludin and ZO-1 in colon epithelial cells compared with the SASP group (P > 0.05), indicating that the lactic acid bacteria of Lactobacillus casei ZKLc1221 significantly reduced the intestinal permeability of UC mice and protected the colon epithelial barrier function, and the effect was close to that of the SASP group; while the lactic acid bacteria of Lactobacillus acidophilus RZKLa0701 had little effect on the intestinal permeability of UC mice (no significant difference compared with the UC group, P > 0.05).

[0123] Under the premise of the spirit and essence of the present invention, ordinary technicians in the field can make various equivalent modifications or substitutions to the embodiments of the present invention, and these modifications or substitutions should be within the scope of the present invention. Any technician familiar with the technical field can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention.

Claims

1. A lactobacillus of Lactobacillus casei ZKLc1221, characterized in that: The preparation method comprises the following steps: inoculating Lactobacillus casei ZKLc1221 in an MRS liquid culture medium at an inoculation amount of 3%, culturing at 37°C for 24 hours to obtain a first-generation seed liquid; inoculating the first-generation seed liquid in a skim milk culture medium at an inoculation amount of 2%, culturing at 37°C for 24 hours to obtain a second-generation seed liquid; inoculating the second-generation seed liquid in a skim milk culture medium containing glucose at an inoculation amount of 2%, culturing at 37°C for 24 hours, and centrifuging to obtain a supernatant, which is the lactobacillus casei ZKLc1221; The concentration of skim milk powder in the skim milk medium used to culture the first-generation seed solution is 8%; The glucose concentration in the skim milk medium containing glucose used to culture the second generation seed solution was 6%, and the concentration of skim milk powder was 22%; The Lactobacillus casei ( Lactobacillus casei ) ZKLc1221 was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on June 21, 2023. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 27673.

2. The lactobacillus of Lactobacillus casei ZKLc1221 as claimed in claim 1, characterized in that, The number of Lactobacillus casei ZKLc1221 cells was 1.20×10 9 cfu / mL.

3. An application of the lactobacillus of Lactobacillus casei ZKLc1221 as claimed in claim 1 in the preparation of a medicament for improving ulcerative colitis, characterized in that: The ulcerative colitis is 2,4,6-trinitrobenzenesulfonic acid-induced ulcerative colitis; the improvement of ulcerative colitis includes increasing the expression levels of Occludin and ZO-1.

4. The use according to claim 3, characterized in that Improvement in ulcerative colitis includes a reduction in the disease activity index.

5. The use according to claim 3, characterized in that Improvement in ulcerative colitis includes relief from shortening of the colon length.

6. The use according to claim 3, characterized in that Improvement of ulcerative colitis includes restoration of crypt structure, alleviation of colonic mucosal epithelial cell shedding and reduction of inflammatory cell infiltration.

7. The use according to claim 3, characterized in that Improvement of ulcerative colitis includes reducing the levels of inflammatory factors IL-1β, IL-18, IL-6 and TNF-α in serum.

Citation Information

Patent Citations

  • Lactobacillus casei with immunomodulatory, anti-inflammatory and anti-cervical cancer effects and application

    CN111560330A

Cited By

  • Lactobacillus reuteri ZKLr0413 spina date seed fermentation liquor for improving sleep and lactobacillus reuteri ZKLr0413

    CN120605296A

  • A lactobacillus reuteri zklr0413 and a zizyphus jujuba fermenting liquid for improving sleep

    CN120605296B