A biocontrol bacterium bacillus velezensis and application thereof in preparation of a biocontrol bacterium agent for preventing and treating pepper blight

Abstract

The application belongs to the field of biological control of plant diseases, and specifically discloses a biocontrol bacterium Bacillus velezensis and application of the biocontrol bacterium in preparation of a biocontrol bacterium agent for preventing and treating pepper blight. Bacillus velezensis The strain is Bacillus velezensis (Bacillus velezensis) Y426-7, which was preserved in the China General Microbiological Culture Collection Center on September 23, 2024, has a preservation number of CGMCC NO.32041, and is located at No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The biocontrol bacterium Bacillus velezensis can be used to prepare the biocontrol bacterium agent for preventing and treating pepper blight. Compared with the prior art, the Bacillus velezensis Y426-7 obtained by the application has obvious bacteriostatic effect on pepper Phytophthora capsici Leonian and various crop pathogenic fungi under indoor in vitro conditions; and 2.5x10 9 CFU / g wettable powder prepared from the Bacillus velezensis Y426-7 has good prevention and treatment effect and certain yield-increasing effect on pepper blight in a field.

Description

Technical Field

[0001] This invention relates to the biological control of plant diseases, and in particular to a biocontrol bacterium, Bacillus bellis, and its application in the preparation of biocontrol agents for controlling pepper blight. Background Technology

[0002] chili( Capsicum annuum ( ) is an important economic crop, produced by Phytophthora capsici ( Phytophthora capsici Phytophthora blight, caused by phytotoxicity, is a significant disease in chili pepper production.

[0003] Currently, the control of pepper blight still relies mainly on chemical agents, which are relatively simple to operate, quick to take effect, and low in cost. However, the use of chemical fungicides can easily lead to serious consequences such as increased drug resistance in pathogens, pesticide residues, and environmental pollution.

[0004] As scientific research deepens, it has been discovered that biocontrol microorganisms possess unique advantages in overcoming plant disease resistance, reducing environmental pollution and ecological damage caused by chemical fungicides, and minimizing chemical pesticide residues in agricultural products. Reports indicate that some bacteria produce active substances during their growth that inhibit the growth of plant pathogenic fungi, including lipopeptides, proteins, and polysaccharides. Biopesticides prepared using the secondary metabolites of biocontrol bacteria are characterized by being pollution-free, residue-free, unlikely to induce resistance in harmful organisms, highly compatible with the environment, and safe for humans and animals. Therefore, vigorously developing research on biological control is an important pathway to sustainable agricultural development and has significant practical implications for production. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a biocontrol bacterium, Bacillus belye, and its application in the preparation of biocontrol agents for controlling pepper blight.

[0006] To achieve the above objectives, the present invention is implemented according to the following technical solution:

[0007] One of the technical solutions of this invention is a biocontrol bacterium, Bacillus belyssioides, the strain of which is Bacillus belyssioides (B. belyssioides). Bacillus velezensis Y426-7 was deposited on September 23, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.32041, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] The second technical solution of the present invention is the application of the biocontrol bacterium Bacillus vesicularis in the preparation of a biocontrol agent for the prevention and control of pepper blight.

[0009] The third technical solution of the present invention is a biocontrol agent for preventing and controlling pepper blight, comprising the aforementioned biocontrol bacterium Bacillus berleis.

[0010] Furthermore, the formulation of the biocontrol agent for preventing and controlling pepper blight is a wettable powder.

[0011] Preferably, the wettable powder is composed of the following components in weight percentage: 87% master powder after mixing diatomaceous earth with the fermentation broth of biocontrol bacterium Bacillus belye, 4.8% wetting agent, 7.2% dispersant and 1% ultraviolet protectant.

[0012] Preferably, the mass ratio of the diatomaceous earth carrier to the biocontrol bacterium Bacillus vesiculosus fermentation broth is 1:2.

[0013] Preferably, the wetting agent is sodium lignosulfonate and the dispersant is NNO.

[0014] Preferably, the ultraviolet protectant is ascorbic acid.

[0015] Compared with the prior art, the Bacillus berberis Y426-7 obtained in this invention exhibits superior resistance to Phytophthora capsici under indoor and in vitro conditions. Phytophthora capsici It has significant antibacterial effects against various crop blight pathogens; furthermore, it utilizes 2.5 × 10 9 The wettable powder prepared from Bacillus baileyi Y426-7 at CFU / g has a good control effect on pepper blight and a certain yield-increasing effect. Attached Figure Description

[0016] Figure 1 The biocontrol effect of some biocontrol bacteria on pepper fruit blight.

[0017] Figure 2 The inhibitory effects of some biocontrol bacteria on different crop blight pathogens.

[0018] Figure 3 Morphological identification of Bacillus belyssus Y426-7: A is colony morphology; B is Gram staining; C is cell morphology.

[0019] Figure 4 Molecular sequencing analysis of Bacillus bereaves Y426-7: A is a phylogenetic tree of strain Y426-7 constructed based on the 16S rDNA sequence; B is based on... gyrA Phylogenetic tree of strain Y426-7 constructed from gene sequences; C is based on gvrB Phylogenetic tree of gene-constructed strain Y426-7.

[0020] Figure 5 The ability of Bacillus belyssus Y426-7 to produce extracellular enzymes was tested: A was amylase; B was chitinase; C was carboxymethyl cellulase; and D was extracellular protease.

[0021] Figure 6The growth-promoting abilities of Bacillus bereaves Y426-7 were tested: A for phosphorus solubilization; B for potassium solubilization; C for nitrogen fixation; D for biofilm formation; and E for IAA production.

[0022] Figure 7 Stability determination of antibacterial active substances in the fermentation broth of Bacillus belyssus Y426-7; A represents different pH conditions; B represents different temperature conditions; C represents different light exposure times; D represents different UV irradiation times; E represents different passage numbers.

[0023] Figure 8 Fermentation broth of Bacillus vesiculosus Y426-7 for the treatment of Phytophthora capsici ( Phytophthora capsici The effect of mycelial morphology: A is the control; B is the Y426-7 treatment.

[0024] Figure 9 Fermentation broth of Bacillus vesiculosus Y426-7 for the treatment of Phytophthora capsici ( Phytophthora capsici The influence of sporangium formation. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0026] Example 1: Screening and identification of the biocontrol bacterium Bacillus belyssus Y426-7

[0027] 1. *Phytophthora capsici* ( Phytophthora capsici Using the plate assay, 230 biocontrol bacteria strains, both laboratory-preserved and isolated from soil, were initially screened for antibacterial activity against *Phytophthora capsici*. The initial screening yielded 20 strains with inhibition rates exceeding 65% against *Phytophthora capsici*, as shown in Table 1. Based on this initial screening, secondary screening was conducted through in vitro inoculation of pepper, determination of antibacterial activity against *Phytophthora capsici* in various crops, and determination of the antibacterial spectrum. Ultimately, one biocontrol bacterium, Y426-7, exhibiting significant biocontrol activity against *Phytophthora capsici*, was obtained, as shown in Tables 2-4. Figure 1 , 2 .

[0028] Table 1. Inhibitory effects of 20 biocontrol bacteria against *Phytophthora capsici*.

[0029]

[0030] Table 2. Biocontrol efficacy of 20 biocontrol bacteria against pepper fruit blight.

[0031]

[0032] Table 3. Inhibitory effects of 20 biocontrol bacteria against Phytophthora in different crops

[0033]

[0034] Table 4. Determination of the antibacterial spectrum of biocontrol bacteria Y426-7

[0035]

[0036] 2. The strain Y426-7 was identified by combining morphological characteristics and culture traits, physiological and biochemical index determination, and multi-gene molecular sequencing analysis.

[0037] After inoculating strain Y426-7 onto NA solid medium and culturing at 28 °C for 24 h, the colonies were irregularly round, milky white, opaque, rough, and wrinkled, containing oval spores. Under an electron microscope, the bacteria were rod-shaped and Gram-positive. Figure 3 .

[0038] The physiological and biochemical characteristics of strain Y426-7 are as follows: It is negative for methyl red, malonic acid utilization, and oxidase tests; positive for catalase and arginine dihydrolase reactions; positive for nitrate reduction; it can grow in media containing 2%, 5%, 7%, and 10% NaCl; it produces indoleacetic acid; it is positive for starch hydrolysis; it is positive for gelatin liquefaction; it cannot utilize citrate; it is positive for VP reaction; and it does not produce fluorescent pigments, etc. See Table 5.

[0039] Multi-gene molecular sequencing analysis, based on 16S rDNA, gyrA and gyrB Construct a phylogenetic tree for strain Y426-7, such as Figure 4 The sequencing results of the PCR amplification product of strain Y426-7's 16S rDNA are as follows:

[0040]

[0041] strain Y426-7 gyrAThe sequencing results of the PCR amplification product of the gene are as follows: CGGCATGGCATGGAGCGTTATCGTATCCCGGGCGCTTCCGGATGTGCGTGACGGTCTGAAGCCGGTTCACAGACGGATTTTGTACGCAATGAATGATTTAGGCATGACCAGTGACAAACCATATAAAAAATCTGCCCGTATCGTCGGTGAAGTTATCGGTAAGTACCACCCGCACGGTGACTCAGCGGTTTACGAATCAATGGTCAGAATGGCGCAGGATTTTAACTACCGCTACATGCTTGTTGACGGACACGGCAACTTCGGTTCGGTTGACGGCGACTCAGCGGCCGCGATGCGTTACACAGAAGCGAGAATGTCAAAAATCGCAATGGAAATTCTGCGTGACATTACGAAAGACACGATTGACTATCAAGATAACTATGACGGTTCAGAAAGAGAACCTGCCGTCATGCCTTCGAGATTTCCGAATCTGCTCGTAAACGGAGCTGCCGGTATTGCGGTCGGAATGGCGACAAATATTCCTCCGCATCAGCTTGGGGAAGTCATTGAAGGCGTGCTTGCCGTAAGTGAGAATCCTGAGATTACAAACCAGGAGCTGATGGAATACATCCCGGGCCCGGATTTTCCGACTGCAGGTCAGATTTTGGGCCGGAGCGGCATCCGCAAGGCATATGAATCCGGACGGGGATCAATCACAATCCGGGCTAAGGCTGAAATCGAAGAGACATCATCGGGAAAAGAAAGAATTATTGTCACAGAACTTCCTTATCAGGTGAACAAAGCGAGATTAATTGAAAAAATCGCAGATCTTGTCCGGGACAAAAAAATCGAAGGAATTACCGATCTGCGTGACGAATCCGACCGTAACGGAATGAGAATCGTCATTGAGATCCGCCGTGACGCCAATGCTCACGTCATTTTGAATAACCTTTACAAACAAACGGCCCTGCAGACGTCTTTCGGAATCAACCTGCTGGCGCTCGTGACGGACAGCCGAAAC。

[0042] strain Y426-7 gyrB

[0043] Based on the above, combined with morphological observation, physiological and biochemical index determination, and molecular sequencing analysis, strain Y426-7 was finally identified as a strain of Bacillus belyssus (B. belyssus). Bacillus velezensis It was deposited on September 23, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.32041, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0044] Table 5 Physiological and biochemical characteristics of Y426-7

[0045]

[0046] Note: "+" indicates a positive reaction or that the plant can grow and be utilized; "-" indicates a negative reaction or that the plant cannot grow and be utilized.

[0047] Example 2: Optimization of Y426-7 shake flask fermentation conditions and preparation of wettable powder

[0048] The shake-flask fermentation conditions of *Bacillus belyssiensis* Y426-7 were optimized using a combination of single-factor experiments and response surface methodology. The optimal fermentation medium composition was determined to be: 2.5% soluble starch, 1.5% tryptone, and 1% NaCl. The optimal shake-flask culture conditions were: 125 mL / 250 mL flask volume, 5% inoculum, pH 6.5, 30℃, and 180 r / min for 72 h. After optimization, the viable cell count reached 3.88 × 10⁻⁶. 9 The CFU / mL was increased by 7.92 times compared to before optimization.

[0049] The biocontrol agent for controlling pepper blight in this embodiment is a wettable powder. Therefore, using suspension rate, moisture content, and wetting time as evaluation indicators, the carrier, wetting agent, dispersant, stabilizer, UV protectant, and their compounding ratios were screened to create the Bacillus berreatus Y426-7 wettable powder. The specific preparation method adopted conventional methods in the art and will not be described in detail in this embodiment. The optimal formula for the Bacillus berreatus Y426-7 wettable powder was finally determined to be: diatomaceous earth as the carrier and the mother powder (87%) after mixing with the fermentation broth (Bacillus berreatus Y426-7 fermentation broth: diatomaceous earth 2:1), the wetting agent and dispersant being sodium lignosulfonate and NNO, respectively, with an optimal ratio of 4:6 and an optimal dosage of 12%, and ascorbic acid (1%) as the UV protectant. The final viable count was 2.5 × 10⁻⁶. 9 The spores were stored at CFU / g, with a suspension rate of 85%, pH of 7.4, a wetting time of 14.7 s, and a fineness of 92%. The spore survival rates at 4℃ and 25℃ for 180 days were 88.45% and 80.37%, respectively, and the quality test results met the national standards.

[0050] Furthermore, the antibacterial mechanism of Bacillus belyssus Y426-7 was investigated. The Y426-7 strain produces amylase, carboxymethyl cellulase, and extracellular protease, but not chitinase. (See [link to study]). Figure 5 It possesses the ability to solubilize phosphorus, fix nitrogen, and produce biofilms, with a phosphorus-solubilizing zone diameter (D) to colony diameter (d) ratio (D / d) of 1.375. It does not possess the ability to solubilize potassium or produce IAA. (See...) Figure 6 Stable to temperature, pH, light, ultraviolet light, etc., see [link to relevant documentation]. Figure 7 The fermentation broth showed a good inhibitory effect on *Phytophthora capsici*. Treatment with the fermentation broth significantly inhibited mycelial growth (see Tables 6-8). Compared with the control mycelium, the mycelial morphology showed increased abnormal branching, disrupting polar growth and causing partial dissolution of the mycelium (see Tables 6-8). Figure 8 Furthermore, the inhibitory effect on the formation of zoosporangia of Phytophthora capsici gradually increased with the increase of the fermentation broth concentration. Figure 9 .

[0051] Table 6. Effects of Bacillus vesiculosus Y426-7 biocontrol solution on the growth rate of Phytophthora capsici mycelium.

[0052]

[0053] Table 7. Effects of Bacillus belyss Y426-7 aseptic fermentation broth on the growth rate of Phytophthora capsici mycelia.

[0054]

[0055] Table 8. Effect of Bacillus belyss Y426-7 on the weight of Phytophthora capsici mycelia.

[0056]

[0057] Example 3: Evaluation of the field control effect of Bacillus vesicularis Y426-7 wettable powder on pepper blight.

[0058] 2.5×10 were rated. 9 The field control efficacy of CFU / g Bacillus berberis Y426-7 wettable powder against Phytophthora blight in peppers was investigated. Different treatments were established in the field: root drenching, foliar spraying, and a combination of root drenching and foliar spraying. Sampling was conducted at 14, 21, and 28 days after the last application to determine the control efficacy. Results showed that 2.5 × 10⁻⁶ CFU / g of this wettable powder was effective against Phytophthora blight in peppers. 9 Low-concentration root irrigation, high-concentration spraying, and simultaneous low-concentration root irrigation and spraying of Bacillus cereus Y426-7 wettable powder with CFU / g showed good control effects on pepper blight, with a residual effect of more than 3 weeks and a significant yield-increasing effect, as shown in Tables 9 and 10.

[0059] Table 9. Control efficacy of Bacillus vesiculosus Y426-7 wettable powder against pepper blight.

[0060]

[0061] Table 10 Effects of Bacillus vesiculosus Y426-7 wettable powder on chili pepper yield

[0062]

[0063] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. A biocontrol bacterium, *Bacillus belye*, with broad-spectrum antibacterial activity, characterized in that... This strain is *Bacillus belyssus* ( Bacillus velezensis Y426-7 was deposited on September 23, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO. 32041, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The biological control targets are ginseng blight, tomato late blight, pepper blight, eggplant blight, pumpkin blight, zucchini blight, tobacco blight, and tobacco target spot pathogen. Rhizoctonia solani Rice seedling blight pathogen Fusarium fujikuroi Ginseng Solanum lycopersicum Rhizoctonia solani Tobacco red spot bacterium Alternaria alternata Schisandra chinensis fruit rot fungus Pineapple Pantoea Fine Alternaria Alternate very thin Fusarium verticillata Fusarium verticillium Alternaria Alternaria alternate Fusarium ginseng Fusarium oxysporum Blueberry-spotted Photinia spp. Pestalotiopsis photiniae Fusarium oxysporum Fusarium oxysporum Apple globulus anthracnose Colletotrichum gloeosporioides Mango anthracnose fungus Colletotrichum gloeosporioides ginseng verticillium pathogen Fusarium verticillium Ginseng robust columnar spores Ilyonectria robusta , ginseng raw anthrax Colletotrichum panacicola Botrytis cinerea (tomato Botrytis cinerea) Botrytis cinerea Fusarium solani Fusarium solani tobacco anthrax bacteria Colletotrichum destructive Alternaria ginseng Althea panax , Sclerotinia ginseng Sclerotinia ginseng Botrytis cinerea Botrytis cinerea .

Images