Escherichia coli engineering strain for producing beta and gamma dihydric alcohol as well as construction method and application of escherichia coli engineering strain

Abstract

The invention relates to an escherichia coli engineering strain for producing beta and gamma type dihydric alcohol as well as a construction method and application of the escherichia coli engineering strain. The method comprises the following steps: constructing a recombinant plasmid pET-ARO10 of a gene ARO10 for expressing phenylpyruvate decarboxylase; the method comprises the following steps: constructing a recombinant plasmid pRSF-ScIlv2c of a gene ScIlv2 for expressing acetohydroxyacid synthase; and introducing the recombinant plasmid pET-ARO10 and the recombinant plasmid pRSF-ScIlv2c into Escherichia coli, so as to obtain the Escherichia coli engineering strain for producing the beta and gamma type dihydric alcohol. The Escherichia coli engineering strain can be used for producing beta and gamma type dihydric alcohol 4-methylpentane-2, 3-diol, 5-methylhexane-2, 3-diol and 4-methylhexane-2, 3-diol, efficient synthesis of beta and gamma type dihydric alcohol in Escherichia coli is realized, and the Escherichia coli engineering strain can be applied to the industries of medicines, biofuels, novel polymer materials and the like.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to an Escherichia coli engineering strain for producing beta, gamma diols, a construction method and application thereof. Background Art

[0002] Diols are an important class of chemical raw materials, widely used in daily necessities and fine chemical industries such as fuels, solvents, polymer monomers and drug precursors. The traditional diol synthesis process relies on the processing of petroleum raw materials, which has an impact on the environment and resources. In recent years, many advances have been made in the biosynthesis of diols. With the establishment of cell factories and the proposal of various biosynthetic pathways, diols with diverse structures can be obtained by fermenting renewable raw materials such as glycerol, glucose, xylose, sucrose and fiber hydrolysate in various microbial chassis such as Escherichia coli, Corynebacterium glutamicum, Klebsiella pneumoniae, Bacillus licheniformis or Bacillus amyloliquefaciens. At present, the biosynthesis of some short-chain diols has made important progress and has been commercialized. For example, DuPont in the United States successfully used engineered bacteria to convert corn hydrolyzed glucose into 1,3-propanediol (α,γ-type diol).

[0003] Compared with diols with the same molecular structure, β,γ diols have higher melting points, lower boiling points, and higher flash points. Their physical properties make them useful as rocket propellant fuels, synthetic rubbers, and polymer components. However, except for 2,3-butanediol, biosynthesis technology still faces bottlenecks in the synthesis of β,γ diols. Summary of the invention

[0004] The present invention aims to solve one of the technical problems in the related art at least to a certain extent. To this end, one object of the present invention is to provide an Escherichia coli engineered strain for producing β,γ diols and a construction method and application thereof; and to realize the conversion of various renewable raw materials glycerol or glucose into β,γ diols with C6-C7 structure in the Escherichia coli chassis.

[0005] To this end, in the first aspect of the present invention, the present invention provides a method for constructing an Escherichia coli engineering strain for producing β,γ-type diols, which comprises the following steps:

[0006] Constructing a recombinant plasmid pET-ARO10 expressing the phenylpyruvate decarboxylase gene ARO10;

[0007] Constructing a recombinant plasmid pRSF-ScIlv2c expressing the acetohydroxyacid synthase gene ScIlv2;

[0008] The recombinant plasmid pET-ARO10 and the recombinant plasmid pRSF-ScIlv2c are introduced into Escherichia coli to obtain an Escherichia coli engineering strain that produces β,γ-type diols.

[0009] According to the present invention, a method for constructing an Escherichia coli engineering strain for producing β,γ-type diols is disclosed. The method introduces the phenylpyruvate decarboxylase gene ARO10 and the acetohydroxyacid synthase gene ScIlv2 into Escherichia coli, so that the constructed Escherichia coli engineering strain can produce β,γ-type diols 4-methylpentane-2,3-diol, 5-methylhexane-2,3-diol, and 4-methylhexane-2,3-diol, thereby realizing efficient synthesis of β,γ-type diols in Escherichia coli and being applicable to industries such as medicines, biofuels, and new polymer materials.

[0010] Optionally, the nucleotide sequence of the gene ARO10 encoding the phenylpyruvate decarboxylase is shown as SEQ ID NO: 1; the nucleotide sequence of the gene ScIlv2 encoding the acetohydroxyacid synthase is shown as SEQ ID NO: 2.

[0011] Optionally, the Escherichia coli is Escherichia coli K-12MG1655 RARE.

[0012] Optionally, the recombinant plasmid pET-ARO10 is constructed by using the genome of Saccharomyces cerevisiae S288C as a template, using the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 as primers, PCR amplifying the ARO10 gene fragment, and connecting it into the vector pETDuet-1 to obtain the recombinant plasmid pET-ARO10 with ampicillin resistance.

[0013] Optionally, the recombinant plasmid pRSF-ScIlv2c is constructed using the genome of Saccharomyces cerevisiae S288C as a template, using the sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6 as primers, amplifying the ScIlv2 gene fragment by PCR, and connecting it into pRSFDuet-1 to obtain the recombinant plasmid pRSF-ScIlv2c with kanamycin resistance.

[0014] In the second aspect of the present invention, the present invention provides an engineered strain of Escherichia coli for producing β,γ-type diols obtained by the above construction method.

[0015] In the third aspect of the present invention, the present invention provides a method for producing β,γ diols, wherein the β,γ diols are produced by fermenting the above-mentioned engineered strain of Escherichia coli.

[0016] Optionally, the engineered E. coli strain is fermented in a modified M9 medium using glycerol or glucose as a carbon source to produce β,γ-type diols.

[0017] Optionally, the β,γ-type diol includes 4-methylpentane-2,3-diol, 5-methylhexane-2,3-diol and 4-methylhexane-2,3-diol.

[0018] Optionally, the concentration of the glycerol or glucose is 40 g / L.

[0019] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 A gel electrophoresis diagram of a target gene amplified by PCR according to an embodiment of the present invention;

[0021] Figure 2 is a map of the recombinant plasmid pET-ARO10 according to an embodiment of the present invention;

[0022] Figure 3 is a map of the recombinant plasmid pRSF-ScIlv2c according to an embodiment of the present invention;

[0023] Figure 4 A gas chromatography detection diagram of diol production by a recombinant strain according to an embodiment of the present invention;

[0024] Figure 5 This is a gas phase mass spectrometry result diagram of diols produced by the recombinant strain according to an embodiment of the present invention;

[0025] Figure 6 This is a graph showing the yield of diols produced by fermentation using different carbon sources by the recombinant strain according to an embodiment of the present invention;

[0026] Figure 7 Comparison of biomass (OD600) of recombinant strains according to embodiments of the present invention using different carbon sources;

[0027] Figure 8 Schematic diagram of the synthesis of diols according to an embodiment of the present invention. DETAILED DESCRIPTION

[0028] The technical solution of the present invention is described below through specific examples. It should be understood that the one or more method steps mentioned in the present invention do not exclude the existence of other method steps before and after the combination step or the insertion of other method steps between these explicitly mentioned steps; it should also be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. Moreover, unless otherwise specified, the numbering of each method step is only a convenient tool for identifying each method step, and is not intended to limit the order of arrangement of each method step or to limit the scope of the present invention. The change or adjustment of the relative relationship thereof shall also be regarded as the scope of the present invention without substantially changing the technical content.

[0029] In order to better understand the above technical scheme, the exemplary embodiments of the present invention are described in more detail below. Although exemplary embodiments of the present invention are shown, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided in order to enable a more thorough understanding of the present invention and to enable the scope of the present invention to be fully communicated to those skilled in the art.

[0030] The test materials used in the present invention are all common commercial products and can be purchased on the market; the experiments involved are all conventional experimental methods unless otherwise specified.

[0031] E. coli K-12MG1655 RARE can be purchased from commercial channels (Addgene: E. coli K-12MG1655RARE).

[0032] Table 1: Primers used for PCR amplification

[0033] Primer name Primer 5'-3 Sequence number ARO10-F ACGGGATCCGATGGCACCTGTTACAATTG SEQ ID NO: 3 ARO10-R TTGGTCTCCTCGAGCTATTTTTTATTTCTTTTAAGTG SEQ ID NO: 4 ScIlv2-F TTGGTCTCGGATCCGATGCCAGAGCCTGCTCCAAG SEQ ID NO: 5 ScIlv2-R TTGGTCTCTCGAGTCAGTGCTTACCGCCTGTAC SEQ ID NO: 6

[0034] The present invention is described below with reference to specific embodiments. It should be noted that these embodiments are merely illustrative and do not limit the present invention in any way.

[0035] Example 1 Target gene amplification and recombinant plasmid construction

[0036] (1) Based on the gene ARO10 (Gene ID: 851987) encoding phenylpyruvate decarboxylase from Saccharomyces cerevisiae S288C on NCBI, the primer sequences of ARO10-F and ARO10-R were designed (Table 1). Based on the gene ScIlv2 (Gene ID: 855135) encoding acetohydroxyacid synthase from Saccharomyces cerevisiae S288C, the primer sequences of ScIlv2-F and ScIlv2-R were designed (Table 1).

[0037] (2) Using the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 as upstream and downstream primers (Table 1), the genome of Saccharomyces cerevisiae S288C (Gene ID: 851987) was used as a template to amplify the ARO10 gene fragment by PCR. The nucleotide sequence of the ARO10 gene fragment is shown in SEQ ID NO: 1. Using the sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6 as upstream and downstream primers (Table 1), the genome of Saccharomyces cerevisiae S288C (Gene ID: 855135) was used as a template to amplify the ScIlv2 gene fragment by PCR. The nucleotide sequence of the ScIlv2 gene fragment is shown in SEQ ID NO: 1. The PCR enzyme used for amplification was New England Biolabs' High-Fidelity DNA Polymerases, reaction system is shown in Table 2; PCR reaction conditions are shown in Table 3.

[0038] Table 2 PCR reaction system

[0039]

[0040] Table 3 PCR amplification program

[0041] step temperature time 1 98℃ 30s 2 98℃ 15s 3 57-63℃ 15s 4 72℃ 60s 5 Repeat steps 2-4 30 times 6 72℃ 2min 7 4℃ ∞

[0042] The PCR amplified products were verified by agarose gel electrophoresis. The PCR results of ARO10 gene were as follows: Figure 1 As shown in A, the size of the amplified fragment is between 1kb and 2kb, which is basically consistent with the size of the ARO10 gene. Figure 1 As shown in B, the size of the amplified fragment is about 3 kb, which is basically consistent with the size of the ScIlv2c gene. The target band was cut and the target fragments ARO10 and ScIlv2 were purified and recovered using the DNA purification kit of BioFlux.

[0043] (3) Use restriction enzymes from New England Biolabs The target fragments ARO10, ScIlv2 and vectors pRSFDuet-1 and pETDuet-1 were digested with XhoI and the reaction system was shown in Table 4.

[0044] Table 4 Enzyme digestion system

[0045] system 50μL Purification and recovery of fragments / vectors 1 μg 10x Cutsmart buffer 5μL BamHI-HF 1μL XOt 1μL Double distilled water Make up to 50 μL

[0046] The restriction endonuclease-cleaved fragments and vectors were purified using the DNA purification kit from BioFlux.

[0047] (4) The restriction endonuclease-cut fragments and the vector were connected using T4 ligase from New England Biolabs. The gene of phenylpyruvate decarboxylase ARO10 was inserted into the BamHI and XhoI sites of pETDuet-1; the gene of acetohydroxyacid synthase ScIlv2c was inserted into the BamHI and XhoI sites of pRSFDuet-1. The connection system is shown in Table 5.

[0048] Table 5 Connection system

[0049] system 10μL Enzyme digestion vector 100ng Restriction fragments 300ng T4 ligase 0.5μL 10x T4 ligase buffer 1μL Double distilled water Make up to 10 μL

[0050] After ligation at room temperature for 3-4 hours, the ligation product was transformed into E. coli DH5α competent cells, and positive clones were screened by ampicillin and kanamycin, respectively. Positive single clones were verified by colony PCR and sequenced. After the plasmid was correct, the recombinant plasmid pET-ARO10 was obtained. Figure 2 As shown; and the recombinant plasmid pRSF-ScIlv2c, as Figure 3 shown.

[0051] Example 2 Construction of recombinant strains

[0052] After the original strain E.coli K-12MG1655 RARE was cultured overnight in 2mL of antibiotic-free LB medium, electroporation competent cells were prepared; electroporation competent preparation method: 1) Inoculate the bacterial solution into 100mL LB medium at a ratio of 1:100. Shake for about 2-3h until OD600 reaches between 0.6-0.8. 2) Ice bath the bacterial solution for 10 minutes, centrifuge at 4℃, 7000rpm for 10 minutes, and remove the supernatant. Add double distilled water to resuspend the bacterial pellet. 3) Centrifuge at 4℃, 7000rpm for 10 minutes, remove the supernatant, and add 10% glycerol to resuspend the bacterial pellet. 4) Repeat step 3) once. 5) Add 5mL 10% glycerol to resuspend the bacterial pellet, divide it into EP, freeze it in liquid nitrogen and store it in a -80℃ refrigerator.

[0053] The recombinant plasmids pET-ARO10 and pRSF-ScIlv2c were transformed into E. coli K-12MG1655RARE competent cells by electroporation, and 1 mL of LB medium was added to recover the cells for one hour.

[0054] The LB platform supplemented with ampicillin and kanamycin was used for screening. After overnight culture, a positive single clone was obtained and named MR-ScIlv2-ARO10. The positive bacterial solution was added with 20% glycerol and stored in a -80°C refrigerator.

[0055] Example 3 Application of the recombinant strain in the production of β, γ-type diols

[0056] (1) Cultivation of engineered strains: Take out the recombinant strain MR-ScIlv2-ARO10 obtained in Example 2, streak it onto a solid LB plate containing kanamycin and ampicillin, and culture it at 37°C overnight. The next day, pick out a single clone of the recombinant strain MR-ScIlv2-ARO10 and put it into a liquid LB medium supplemented with kanamycin and ampicillin, and shake it at 37°C and 250rpm for 8-10 hours as a fermentation seed liquid. Inoculate the seed liquid at an inoculum size of 1% into 10mL of M9 medium supplemented with kanamycin and ampicillin; culture it at 37°C and 250rpm for 4 hours until the OD600 is between 0.8-10. Add IPTG to a final concentration of 100μM. The culture is cultured at 30°C and 250rpm for 108 hours, and samples are taken every 24 hours for testing.

[0057] Among them, other components of M9 medium include: 11.1μg / L CaCl 2 、240.7mg / L MgSO 4 、17.08 g / LNa 2 HPO 4 12H 2 O, 3 g / L KH 2 PO 4 、1 g / L NH 4 Cl, 0.5 g / L NaCl, trace elements: 50 mg / L EDTA, 8.3 mg / L FeCl 3 6H 2 O, 0.84mg / L ZnCl 2 、0.13mg / L CuCl 2 ·2H 2 O, 0.1mg / L CoCl 2 6H 2 O, 0.1mg / LH 3 BO 3 、16mg / L MnCl 2 6H 2 O, 0.3mg / L Na 2 MoO 4 ·4H 2 O, 5 mg / L thiamine hydrochloride, 10 mg / L niacin, 0.1 mg / L biotin (pH 7.2), 7 g / L yeast extract, 4% (w / v) glucose or 4% (w / v) glycerol.

[0058] (2) Diol extraction

[0059] Take 300 μL of the mixed fermentation broth into a 1 mL EP tube and mix with 300 μL of ethyl acetate. Vortex for 2 minutes to extract the diol in the fermentation broth layer into the ethyl acetate layer. Centrifuge at 14000 rpm for 5 minutes and take 200 μL of ethyl acetate for analysis.

[0060] (3) Diol Detection

[0061] The diols were detected using gas chromatography, and GC analysis was performed on a SH-Rtx-5 capillary column (25m×0.32mm×0.5μm) using a Nexis GC-2030 instrument equipped with a flame ionization detector (FID). 1μL of each sample was injected using a split injector operating at 250°C. Nitrogen was used as the carrier gas and the column flow rate was 1.0mL / min. The column oven temperature program used was: initial temperature 40°C (held for 2 minutes), then increased to 250°C at a rate of 15°C / min (held for 2 minutes). The FID detector was operated at 350°C. Quantification of diols was achieved using external standard calibration.

[0062] The results are as follows Figure 4 As shown, this is a gas chromatography detection diagram of the production of diols by the recombinant strain MR-ScIlv2-ARO10. It can be seen that the recombinant strain MR-ScIlv2-ARO10 can produce β,γ-type diols: 4-methylpentane-2,3-diol, 5-methylhexane-2,3-diol, and 4-methylhexane-2,3-diol, realizing the efficient synthesis of β,γ-type diols in Escherichia coli.

[0063] (4) Identification of diol structure

[0064] GC / MS analysis was performed on an Agilent 7890B gas chromatograph coupled to a mass spectrometer to confirm the formation of the target diol. The gas chromatograph column used was an Agilent DB-5ms UI capillary column (30m×250μm×0.25μm). Using a split injector operating at 250°C, 1μL of each sample was injected. Helium was used as the carrier gas and the column flow rate was 1.0mL / min. The column oven temperature program used was: initial temperature 40°C (held for 2 minutes), then heated to 250°C at a rate of 15°C / min (held for 2 minutes). The MS was operated in a scan mode of 2-500amu with a solvent delay of 4.5min. The temperatures of the MS ion source and MS Quad were set to 230°C and 150°C, respectively.

[0065] The results are as follows Figure 5As shown, the formation of β,γ-type diols: 4-methylpentane-2,3-diol, 5-methylhexane-2,3-diol, and 4-methylhexane-2,3-diol was confirmed by comparing the mass spectrum with the mass spectrum in the NIST database to confirm the same MS fragmentation peaks.

[0066] Example 4 Recombinant strain fermentation optimization

[0067] The fermentation method was the same as in Example 3 above; two basic carbon sources, glycerol and glucose, were selected for comparison in the culture medium. 40 g / L glycerol or 40 g / L glucose was added to the basic M9 culture medium to prepare a modified M9 culture medium. The culture was fermented at 30°C and 250 rpm for 108 hours, and the OD600 and metabolite parameters of the samples were sampled every 24 hours to compare the effects of different carbon sources on biomass and diol production.

[0068] The results are as follows Figure 6 and Figure 7 As shown in the figure, by comparing different carbon sources, it was found that the diol yield and biomass were higher when glycerol was used as the carbon source than when glucose was used as the carbon source. The yield of 4-methylpentane-2,3-diol reached 4.4±0.3mM, the yield of 5-methylhexane-2,3-diol reached 4.4±0.5, and the yield of 4-methylhexane-2,3-diol reached 0.2mM.

[0069] In summary, according to the embodiments of the present invention, Figure 8 As shown, the phenylpyruvate decarboxylase ARO10 gene and the acetohydroxyacid synthase ScIlv2 gene from Saccharomyces cerevisiae were introduced into Escherichia coli K-12MG1655 RARE to obtain a recombinant strain; the construction method of the recombinant strain is simple, and fermentation experiments have proved that the recombinant strain can produce β,γ-type diols 4-methylpentane-2,3-diol, 5-methylhexane-2,3-diol, and 4-methylhexane-2,3-diol, realizing the conversion of various renewable raw materials glycerol into C6-C7 structure β,γ-type diols on the chassis of Escherichia coli; and the recombinant strain is fermented with renewable carbon source glycerol or glucose, which is a green and sustainable method for synthesizing diols.

[0070] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms should not be understood as necessarily being directed to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine different embodiments or examples described in this specification.

[0071] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A method for constructing an Escherichia coli engineered strain for producing β,γ-diols, characterized in that: The following steps are involved: Constructing a recombinant plasmid pET-ARO10 expressing the phenylpyruvate decarboxylase gene ARO10; Constructing a recombinant plasmid pRSF-ScIlv2c expressing the acetohydroxyacid synthase gene ScIlv2; The recombinant plasmid pET-ARO10 and the recombinant plasmid pRSF-ScIlv2c are introduced into Escherichia coli to obtain an Escherichia coli engineering strain that produces β,γ-type diols.

2. The construction method according to claim 1, characterized in that: The nucleotide sequence of the gene ARO10 encoding the phenylpyruvate decarboxylase is shown in SEQ ID NO: 1; the nucleotide sequence of the gene ScIlv2 encoding the acetohydroxyacid synthase is shown in SEQ ID NO:

2.

3. The construction method according to claim 1, characterized in that: The Escherichia coli is E. coli K-12MG1655 RARE.

4. The construction method according to claim 1, characterized in that: The recombinant plasmid pET-ARO10 is constructed by using the genome of Saccharomyces cerevisiae S288C as a template, using the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 as primers, PCR amplifying the ARO10 gene fragment, and connecting it into the vector pETDuet-1 to obtain the recombinant plasmid pET-ARO10 with ampicillin resistance.

5. The construction method according to claim 1, characterized in that: The recombinant plasmid pRSF-ScIlv2c is constructed by using the genome of Saccharomyces cerevisiae S288C as a template, using the sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6 as primers, amplifying the ScIlv2 gene fragment by PCR, and connecting it into pRSFDuet-1 to obtain the recombinant plasmid pRSF-ScIlv2c with kanamycin resistance.

6. An engineered strain of Escherichia coli for producing β,γ-diols, characterized in that: The method is constructed according to any one of claims 1 to 5.

7. A method for producing β,γ-type diols, characterized in that: The β,γ-type diol is produced by fermentation using the engineered Escherichia coli strain described in claim 6.

8. The method according to claim 7, characterized in that The engineered strain of Escherichia coli is fermented in a modified M9 medium using glycerol or glucose as a carbon source to produce β,γ-type diols.

9. The method according to claim 7, characterized in that The β,γ type diols include 4-methylpentane-2,3-diol, 5-methylhexane-2,3-diol and 4-methylhexane-2,3-diol.

10. The method according to claim 8, characterized in that The concentration of the glycerol or glucose is 40 g / L.

Images