Alginate lyase mutant

Through genetic engineering methods, the heterologous expression of alginate lyase and the single-point mutation method is optimized, which solves the problems of high production cost and low yield of alginate lyase, significantly improves the stability and enzymatic efficiency of enzymes, and is suitable for the field of seaweed processing.

CN119614545BActive Publication Date: 2025-06-03WEIFANG KANGDIEN BIOTECH LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510170294.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-17
Publication Date
2025-06-03
Estimated Expiration
2045-02-17

AI Technical Summary

Technical Problem

In the prior art, the production cost of alginate lyase is high, which is difficult to meet the needs of industrial applications, and the enzyme yield of wild-type alginate decomposition bacteria is low.

Method used

Through genetic engineering, alginate lyase genes are heterologously expressed, and the enzyme stability is improved by single point mutation method (T140R).

Benefits of technology

The stability of alginate lyase was significantly improved. The enzyme activity residue rate was as high as 95.9% after treatment at 45°C for 20 minutes, which was 68.7% higher than that of wild type. It is suitable for the field of seaweed processing and improves the enzymatic efficiency of seaweed.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention relates to the technical field of genetic engineering and protein engineering modification, and specifically relates to an alginate lyase mutant. The mutant containing a single mutation site of T140R provided by the present invention has a significantly higher residual enzyme activity rate than the wild-type alginate lyase after being treated at 45°C for 20 minutes, and its stability is significantly improved, achieving unexpected technical effects. It can be widely used in the field of seaweed processing, effectively improving the enzymatic hydrolysis efficiency of seaweeds such as Sargassum and Ascophyllum nodosum, and has broad market prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering and protein engineering modification, and particularly relates to an alginate lyase mutant. Background Art

[0002] Brown algae mainly consist of alginate, laminarin, mannitol, fucoidan, etc. Among them, alginate is an anionic polysaccharide derived from the cell wall of brown algae, which is the main structural component in brown algae and is also called sodium alginate or alginic acid sodium. The first problem to be solved in the utilization of brown algae is the utilization of alginate.

[0003] The degradation methods of alginate mainly include: (1) Chemical degradation. Acid, hydrothermal or alkali pretreatment has been used for the hydrolysis of alginate. Acid hydrolysis is relatively common in chemical degradation. However, alginate is relatively acid-resistant and it is difficult to control the production of uronic acid. In addition, high concentrations of acid are required to obtain a high yield of uronic acid. (2) Hydrothermal pretreatment. Alginate can produce alginate monomers (mannuronate and guluronate) by hydrothermal treatment (180°C - 240°C), and at the same time, substances such as lactic acid and glycolic acid are produced. (3) Enzymatic degradation. The enzymatic degradation of alginate has mild conditions, a controllable process, a high yield, is green and safe, environmentally friendly, has a clear action mechanism, and the products are determined. Different enzyme preparations with substrate specificity can be selected singly or in combination according to the requirements of specific target products. Endo-type alginate lyase produces alginate oligosaccharides with different DPs, while exo-type enzymes degrade alginate or alginate oligosaccharides to produce monosaccharides.

[0004] The production of alginate lyase mostly relies on alginate-decomposing bacteria. Although wild-type alginate-decomposing bacteria can effectively obtain a quantitative amount of enzyme protein, the yield is very low and the cost is high, making it difficult to meet the requirements of practical applications. Therefore, using genetic engineering means to heterologously express the alginate lyase gene is the most effective way to increase the yield of alginate lyase. The research mainly focuses on the cloning of the alginate lyase gene from alginate-decomposing bacteria and its overexpression in Bacillus subtilis. At present, the alginate lyase genes of more than twenty alginate-decomposing bacteria have been cloned, and most of these genes have been successfully heterologously expressed. The expression levels of recombinant alginate lyases are all higher than those of wild strains. According to the classification of the CAZY database, alginate lyase belongs to polysaccharide-degrading enzymes (PL), and is specifically divided into seven families: PL5, PL6, PL7, PL14, PL15, PL17, and PL18.

[0005] In recent years, with the wide application of protein engineering modification technology in the field of enzyme preparations, the development of new alginate lyases with high enzyme activity levels and excellent properties has become a research hotspot in this field, which is of great significance for reducing the production cost of alginate lyase and promoting the industrialization of alginate lyase. Summary of the Invention

[0006] The object of the present invention is to provide an alginate lyase mutant. The stability of the mutant is significantly improved compared with the wild type, which is beneficial to its wide application in industrial fields such as seaweed processing.

[0007] On the one hand, the present invention relates to an alginate lyase mutant, in which the 140th amino acid of the alginate lyase with the amino acid sequence of SEQ ID NO: 1 is changed from Thr to Arg.

[0008] The present invention also relates to a DNA molecule encoding the above-mentioned alginate lyase mutant.

[0009] The present invention also relates to a recombinant expression plasmid containing the above DNA molecule.

[0010] The present invention also relates to a host cell containing the above recombinant expression plasmid.

[0011] After transferring the above plasmid into the host cell, the stability of the recombinantly expressed alginate lyase mutant is significantly improved.

[0012] In some embodiments of the present invention, the host cell is Bacillus subtilis ( Bacillus subtilis )

[0013] The T140R single-point mutant provided by the present invention has the highest stability. After being treated at 45 °C for 20 min, the residual enzyme activity rate is as high as 95.9%, which is 68.7% higher than that of the wild-type alginate lyase AH1, and the effect is significant. The mutant can be widely used in the field of seaweed processing, effectively improving the enzymatic hydrolysis efficiency of seaweeds such as Sargassum and Ascophyllum nodosum, and has a broad market prospect. Detailed implementation manners

[0014] The following further illustrates the method of the present invention with examples. For the experimental methods without specific conditions indicated in the examples, they can generally be carried out under conventional conditions, such as the conditions described in "Molecular Cloning: A Laboratory Manual" written by J. Sambrook et al., or according to the conditions recommended by the manufacturer. Those skilled in the relevant art can better understand and master the present invention with the help of the examples. However, the methods for implementing the present invention should not be limited to the specific method steps recorded in the embodiments of the present invention.

[0015] The present invention will be described in detail below in conjunction with the specific implementation manners.

[0016] Example 1 Screening of alginate lyase mutant

[0017] The amino acid sequence of the wild-type alginate lyase AH1 is SEQ ID NO: 1, and the encoding nucleotide sequence is SEQ ID NO: 2.

[0018] In order to further improve the stability of alginate lyase AH1, the applicant carried out protein structure analysis on it. This protein is an alginate lyase of the PL7 family, and its structure is a β-jelly roll structure. Both the protein surface and the active center of the protein are exposed to the external environment. Therefore, it is considered that changes in the external environment can directly affect the stability of the enzyme's active center. Without destroying the protein secondary structure and the active center, the applicant further mutated this gene.

[0019] Primer AH1-ss-F: CGG GGTACC ATGGATCCGAATCTGGAGATTT (SEQ ID NO:3);

[0020] Primer AH1-ss-R: CG ACGCGT TTAATCATGTGTATGTTCCAGGC (SEQ ID NO:4).

[0021] Using the AH1 gene as a template, PCR amplification was carried out with the above primers using the GeneMorph II Random Mutagenesis PCR Kit (Bioline). The PCR products were recovered by gel electrophoresis, double digested with KpnI and MluI, and ligated to the expression plasmid pSZX101 digested with the same enzymes. Then it was transformed into Escherichia coli DH5α, and spread on LB+Amp plates and cultured inverted at 37°C. After the transformants appeared, the plasmids were extracted and transformed into Bacillus subtilis. After the transformants grew out, they were individually picked with toothpicks into a 48-well plate, and 20 μg / ml kanamycin was added to each well. They were cultured at 37°C and 500 rpm for about 48 h, and the supernatant was taken by centrifugation for high-throughput determination. They were incubated at 45°C for 20 minutes, and the alginate lyase activity was measured respectively, and the enzyme activity residual rate of different mutants was calculated.

[0022] The experimental results showed that different mutants had different stabilities. Some mutants still had relatively high enzyme activity under the same temperature treatment conditions, some mutants even made their tolerance worse; in addition, there were some mutants whose enzymatic properties changed significantly after mutation, and these did not meet the requirements. Finally, the applicant screened out mutation sites that could significantly improve the stability of alginate lyase without significantly affecting its original enzymatic properties, which were: T140R.

[0023] Based on the truncated form of alginate lyase AH1, the present invention provides mutants containing a single mutation site of T140R. Referring to the amino acid sequence of the mutant, the coding nucleotide sequences of the alginate lyase mutants were obtained respectively.

[0024] Example 2 Expression of Alginate Lyase Mutants in Bacillus subtilis

[0025] According to the codon preference of Bacillus, the gene sequences of alginate lyase AH1 and its mutants were optimized and synthesized respectively, and two restriction enzyme sites, KpnI and MluI, were added to the 5' and 3' ends of the synthesized sequences.

[0026] 2.1 Vector construction

[0027] The synthesized alginate lyase gene fragment was obtained by PCR, and the obtained gene fragment and the expression plasmid pSZX101 were double digested with KpnI and MluI respectively, and the target fragment was recovered by gel electrophoresis. The ligation was carried out overnight with T4 ligase. The ligation product was transformed into competent Escherichia coli DH5α, spread on an LB + Amp plate, and single colonies grew after culturing overnight at 37°C. The transformants with correct ligation were verified by colony PCR, and the plasmids were extracted and sent to Beijing Genomics Institute for sequencing analysis.

[0028] The plasmid was purified from the Escherichia coli clone with correct sequencing results using a midiprep kit (Axygen).

[0029] 2.2 Preparation and transformation of competent Bacillus subtilis

[0030] The transformation solution was prepared as follows:

[0031] 1× Minimal salt solution: K 2 HPO 4 7 g, KH 2 PO 4 3 g, (NH 4 ) 2 SO4 1 g, trisodium citrate Na 2 C 6 H 5 O 7 ·2H 2 O 0.5 g, MgSO 4 ·7H 2 O 0.1 g, add water to 500 mL.

[0032] GMⅠ solution: 95.6 mL of 1× minimal salt solution, 2.5 mL of 20% glucose, 0.4 mL of 5% hydrolyzed casein, 1 mL of 10% yeast extract.

[0033] GMⅡ solution: 96.98 mL of 1× minimal salt solution, 2.5 mL of 20% glucose, 0.08 mL of 5% hydrolyzed casein, 0.04 mL of 10% yeast extract, 0.25 mL of 1 M MgCl 2 0.25 mL, 0.05 mL of 1 M CaCl 2 0.05 mL.

[0034] Transformation operation method: Inoculate the bacteria on an LB plate and culture overnight at 37°C. Pick up a loopful of bacterial lawn with an inoculation loop and transfer it to 5 mL of GMⅠ solution, and culture it overnight with slow shaking (125 rpm) at 30°C. The next day, take 2 mL and transfer it to 18 mL of GMⅠ, and culture it at 37°C with fast shaking (220 rpm) for 3.5 h. Then take 5 mL of the culture solution from the previous step and transfer it to 45 mL of GMⅡ, and culture it at 37°C with slow shaking (125 rpm) for 90 min. Then centrifuge at 8000 g for 10 min to collect the bacterial cells. Gently suspend the bacterial cells with 5 mL of the original culture supernatant. The suspended bacterial cells are competent cells and can be used for transformation. Preservation of competent cells: Add sterilized glycerol at 30% to a final concentration of 10%, mix well and dispense into centrifuge tubes, and immediately store at -70°C.

[0035] Mix 1 μg of the recombinant plasmid evenly with 200 μL of the above-mentioned competent cells, resuscitate at 37°C with shaking (200 rpm) for 30 min, and then spread it on the corresponding resistant medium and culture overnight at 37°C. The single colonies grown overnight are the engineered strains containing alginate lyase and mutants.

[0036] Example 3 Fermentation verification

[0037] Inoculate the engineered strain into 5 mL of LB (0.5% yeast extract powder, 1% tryptone, 1% sodium chloride) medium, culture at 220 rpm for about 6 - 8 h at 37°C, and transfer it to 50 mL of liquid fermentation medium (0.5% yeast extract powder, 0.5% tryptone, 1% glucose, K 2 HPO 4 1.8%), and shake flask ferment at 220 rpm at 37°C for 72 h. Then centrifuge at 5000 g for 10 min to collect the supernatant, and the fermentation supernatant containing alginate lyase and its mutants is obtained.

[0038] 3.1 Determination of alginate lyase activity

[0039] Principle of determination of alginate lyase activity: Alginate lyase can cleave the glycosidic bond in the alginate molecule through a β-elimination reaction, generating an unsaturated double bond at the non-reducing end. The double bond is located between C4 and C5 at the non-reducing end of the product, and the maximum ultraviolet absorption occurs at 235 nm.

[0040] (1) Definition of enzyme activity unit:

[0041] Under the conditions of 40°C and pH 7.0, in the reaction system specified in this method. Every minute, the substrate sodium alginate is degraded to generate an unsaturated double bond. At 235 nm, when the absorbance increases by 0.1, it is 1 enzyme activity unit U.

[0042] (2) Determination method

[0043] Dilute it to an appropriate multiple with buffer solution, and control the absorbance OD 235 to be between 0.22 and 0.35, and the enzyme activity is about 0.5 U / mL.

[0044] Enzyme reaction: Take three 15mm * 150mm test tubes, add 1.8 mL of substrate, preheat in a water bath at 40 °C for 5 min, add 0.2 mL of the diluted enzyme solution, accurately time, vortex, incubate at 40 °C for 10 min, take the test tubes out of the water bath and immediately add 2 mL of phosphoric acid termination solution, vortex, and place the test tubes on the test tube rack outside the water bath.

[0045] Blank: Take a 15mm * 150mm test tube, add 1.8 mL of substrate, preheat in a water bath at 40 °C for 5 min, add 0.2 ml of buffer solution, accurately time, vortex, incubate at 40 °C for 10 min, take the test tubes out of the water bath and immediately add 2 mL of phosphoric acid termination solution, vortex, and place the test tubes on the test tube rack outside the water bath.

[0046] 3.2 Analysis of the stability of alginate lyase

[0047] After the fermentation supernatants of the engineered Bacillus subtilis strains expressing the recombinant alginate lyase AH1 and its mutants constructed above were incubated at 45 °C for 20 min, the alginate lyase activities were detected respectively. Taking the initial enzyme activity as 100%, the residual enzyme activity rate was calculated. The results are shown in Table 1.

[0048] Residual enzyme activity rate: It refers to the catalytic ability that the enzyme still retains after being treated under specific conditions, usually expressed as a percentage. Generally speaking, the higher the residual enzyme activity rate, the more stable the enzyme.

[0049] Calculation formula: Residual enzyme activity rate (%) = enzyme activity after treatment / initial enzyme activity × 100%.

[0050] Table 1 Residual enzyme activity rates of alginate lyase and its mutants

[0051] Alginate lyase Residual enzyme activity rate Wild-type AH1 27.2% T140R single-point mutant 95.9%

[0052] It can be seen from the data in Table 1 that compared with the wild-type alginate lyase AH1, after the single-point mutant T140R provided by the present invention was treated at 45 °C for 20 min, the residual enzyme activity rate increased by 68.7%, and the stability was significantly improved, achieving an unexpected technical effect.

[0053] In summary, the stability of the alginate lyase mutant provided by the present invention is significantly improved, and it can be widely used in the field of seaweed processing, effectively improving the enzymatic hydrolysis efficiency of seaweeds such as Sargassum and Ascophyllum nodosum, and having a broad market prospect.

Claims

1. An alginate lyase mutant, characterized in that: The mutant is an alginate lyase with an amino acid sequence of SEQ ID NO: 1, in which the 140th amino acid is mutated from Thr to Arg.

2. A DNA molecule encoding the alginate lyase mutant according to claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3.

5. The host cell according to claim 4, characterized in that The host cell is Bacillus subtilis ( Bacillus subtilis ).

Citation Information

Patent Citations

  • Novel alginate lyase, preparation method and application thereof

    CN109295043A

  • A Bacillus subtilis mutant strain producing alginate lyase, its construction method and application

    CN114921390B