Methods and applications of constructing IL-11 knock-in mouse models

Abstract

The present invention discloses a method and application for constructing an IL-11 knock-in mouse model. The present invention provides a specific DNA molecule, which comprises the following elements from upstream to downstream: an upstream homology arm, an mTFP1 encoding gene, a P2A self-cleavage peptide encoding gene, a Cre recombinase encoding gene, WPRE-polyA and a downstream homology arm. The present invention also provides a method for preparing a recombinant mouse, comprising the following steps: replacing the target segment in the mouse genomic DNA with the specific DNA molecule to obtain a recombinant mouse. The present invention constructs an IL-11-Cre tool mouse based on the Cre-LoxP recombination system, which can be used to solve the scientific problem of the IL-11+ regulatory molecular mechanism during the occurrence and progression of important diseases. The present invention will help to further explore the mechanism of action of IL-11 in the occurrence and development of diseases in the future, so as to find new therapeutic targets and develop more effective treatment strategies.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, specifically to the field of animal model preparation, and specifically relates to a method and application of constructing an IL-11 knock-in mouse model. Background Art

[0002] IL-11 is a member of the IL-6 cytokine family. A growing number of studies have revealed that IL-11 plays a crucial role in pathological processes such as inflammation and fibrosis. It is considered a potential drug development target for the treatment of cancer and pulmonary fibrosis, even surpassing transforming growth factor-β (TGF-β), long considered the primary culprit in cancer metastasis and pathological fibrosis.

[0003] The IL-11 gene consists of 5 exons and 4 introns, encoding a 23kDa protein. IL-11 was initially purified from the culture supernatant of the PU-34 stromal cell line and was found to be able to replace IL-6 in stimulating the proliferation of plasmacytoma cells. Subsequently, a series of in vitro studies found that IL-11 has a wide range of activities, including stimulating platelet production and erythropoiesis, regulating macrophage differentiation and maturation, and inducing CD4 + IL-11 can also regulate neurogenesis, increase osteoclast development, inhibit adipogenesis, and modulate epithelial cell proliferation and apoptosis. Based on this research evidence, the FDA approved recombinant human IL-11 (Neumega) in 2012 as a treatment for supporting platelet reconstitution after chemotherapy.

[0004] Evidence from human patient samples and genetically modified mouse models indicates that IL-11 and its signaling pathway also play an important role in the occurrence and progression of diseases such as rheumatoid arthritis, diabetes, asthma, chronic obstructive pulmonary disease, and pancreatitis. Summary of the Invention

[0005] The purpose of the present invention is to provide a method and application for constructing an IL-11 knock-in mouse model.

[0006] The invention provides a specific DNA molecule, which comprises the following elements in sequence from upstream to downstream: an upstream homology arm, a Cre recombinase encoding gene and a downstream homology arm.

[0007] Specifically, the specific DNA molecule includes the following elements from upstream to downstream: an upstream homology arm, a Cre recombinase encoding gene, WPRE-polyA and a downstream homology arm.

[0008] Specifically, the specific DNA molecule includes the following elements from upstream to downstream: an upstream homology arm, an mTFP1 encoding gene, a P2A self-cleavage peptide encoding gene, a Cre recombinase encoding gene, WPRE-polyA and a downstream homology arm.

[0009] Specifically, the specific DNA molecule is composed of the following elements from upstream to downstream: an upstream homology arm, an mTFP1 encoding gene, a P2A self-cleavage peptide encoding gene, a Cre recombinase encoding gene, WPRE-polyA and a downstream homology arm.

[0010] Specifically, the upstream homology arm is shown as positions 1-1756 in SEQ ID NO: 1.

[0011] Specifically, the downstream homology arm is shown as positions 4173-5897 in SEQ ID NO: 1.

[0012] Specifically, the Cre recombinase encoding gene is shown in positions 2531-3583 of SEQ ID NO: 1.

[0013] Specifically, the mTFP1 encoding gene is as shown in positions 1757-2464 of SEQ ID NO: 1.

[0014] Specifically, the P2A self-cleavage peptide encoding gene is shown in positions 2465-2530 of SEQ ID NO: 1.

[0015] Specifically, the WPRE-polyA is shown in positions 3584-4172 of SEQ ID NO: 1.

[0016] Specifically, the specific DNA molecule is shown in SEQ ID NO: 1.

[0017] The present invention also protects a kit for constructing a recombinant mouse, which comprises any of the above-mentioned specific DNA molecules.

[0018] Specifically, the kit also includes Cas9 protein, CrRNA and tracrRNA.

[0019] The crRNA is shown in SEQ ID NO: 4.

[0020] The tracrRNA is shown in SEQ ID NO: 5.

[0021] Specifically, the kit further comprises a primer pair consisting of a primer shown in SEQ ID NO: 6 and a primer shown in SEQ ID NO: 7.

[0022] Specifically, the kit further comprises a primer pair consisting of a primer shown in SEQ ID NO: 8 and a primer shown in SEQ ID NO: 9.

[0023] Specifically, the kit further comprises a primer pair consisting of a primer shown in SEQ ID NO: 10 and a primer shown in SEQ ID NO: 11.

[0024] The recombinant mouse is obtained by replacing a target segment in the mouse's genomic DNA with the specific DNA molecule. The target segment is the segment in the mouse's genomic DNA that begins at the upstream homology arm and ends at the downstream homology arm. The target segment is located on chromosome 7. The recombinant mouse can be a heterozygous recombinant mouse obtained by replacing the target segment in one of the mouse's chromosomes 7 with the specific DNA molecule. The recombinant mouse can also be a homozygous recombinant mouse obtained by replacing the target segments in both of the mouse's chromosomes 7 (a pair of homologous chromosomes) with the specific DNA molecule.

[0025] The present invention also provides a method for preparing a recombinant mouse, comprising the steps of replacing a target segment in the mouse genomic DNA with the specific DNA molecule to obtain a recombinant mouse. The target segment is the segment in the mouse genomic DNA starting from the upstream homology arm and ending at the downstream homology arm. The target segment is located on chromosome 7. The method comprises the steps of replacing the target segment in one chromosome 7 of the mouse with the specific DNA molecule to obtain a heterozygous recombinant mouse. The method comprises the steps of replacing the target segments in both chromosomes 7 (a pair of homologous chromosomes) of the mouse with the specific DNA molecule to obtain a homozygous recombinant mouse.

[0026] The target segment is located on chromosome 7. The recombinant mouse can be a heterozygous recombinant mouse obtained by replacing the target segment on one chromosome 7 with the specific DNA molecule. The recombinant mouse can be a homozygous recombinant mouse obtained by replacing the target segments on both chromosomes 7 (a pair of homologous chromosomes) with the specific DNA molecule.

[0027] Specifically, the method comprises the following steps: co-introducing the specific DNA molecule, Cas9 protein, crRNA and tracrRNA into mice, thereby replacing the target segment in the mouse genomic DNA with the specific DNA molecule. Specifically, the method comprises the following steps: co-introducing the specific DNA molecule, Cas9 protein, crRNA and tracrRNA into mice, and then screening recombinant mice in which the target segment in the genomic DNA is replaced with the specific DNA molecule.

[0028] Specifically, the method comprises the following steps: introducing the specific DNA molecule, Cas9 protein, crRNA and tracrRNA into a mouse fertilized egg, thereby replacing the target segment in the mouse genomic DNA with the specific DNA molecule. Specifically, the method comprises the following steps: introducing the specific DNA molecule, Cas9 protein, crRNA and tracrRNA into a mouse fertilized egg, and then screening the mice developed from the fertilized eggs for recombinant mice in which the target segment in the genomic DNA is replaced with the specific DNA molecule. Specifically, the method further comprises the following steps: screening homozygous recombinant mice from the offspring mice obtained by mating the heterozygous recombinant mice.

[0029] The screening specifically includes the following steps: using mouse genomic DNA as a template, and performing PCR amplification using primer pair 1 (a primer pair consisting of primers shown in SEQ ID NO: 6 and primers shown in SEQ ID NO: 7) and primer pair 2 (a primer pair consisting of primers shown in SEQ ID NO: 8 and primers shown in SEQ ID NO: 9), respectively; if an 1882 bp amplification product is obtained using primer pair 1 and an 823 bp amplification product is not obtained using primer pair 2, the mouse is a homozygous recombinant mouse; if an 1882 bp amplification product is obtained using primer pair 1 and an 823 bp amplification product is obtained using primer pair 2, the mouse is a heterozygous recombinant mouse.

[0030] Specifically, any of the above mice is a C57BL / 6N mouse.

[0031] The present invention also provides a method for preparing a modeling tool mouse, comprising the following steps:

[0032] Recombinant mice were prepared according to the above method;

[0033] The recombinant mice are mated with other mice to obtain offspring mice;

[0034] Screening of modeling tool mice from offspring mice.

[0035] The other mice are Cre recombinase reporter mice.

[0036] The other mice are mice having a Cre recombinase reporter element.

[0037] Specifically, the other mice are B6-ROSA26-CAG-LSL-tdTomato mice.

[0038] Screening modeling tool mice from offspring mice refers to: screening mice that have the specific DNA molecule and the Cre recombinase reporter element from offspring mice, namely, modeling tool mice.

[0039] The method for screening mice carrying the specific DNA molecule comprises: using mouse genomic DNA as a template, and performing PCR amplification using a primer pair consisting of a primer shown in SEQ ID NO: 6 and a primer shown in SEQ ID NO: 7; if an amplified product of 1882 bp is obtained, the mouse is a mouse carrying the specific DNA molecule.

[0040] A method for screening mice harboring a Cre recombinase reporter element comprises performing PCR amplification using mouse genomic DNA as a template and a primer set consisting of a primer represented by SEQ ID NO: 10 and a primer represented by SEQ ID NO: 11; if a 196 bp amplification product is obtained, the mouse harbors the Cre recombinase reporter element.

[0041] The present invention also provides a method for constructing a model mouse, comprising the following steps:

[0042] Modeling tool mice were prepared according to the above method;

[0043] Modeling tool mice are used to induce disease models to obtain mice with disease phenotypes, which are called model mice.

[0044] Specifically, the model mouse can be a colitis model mouse.

[0045] Specifically, the model mice may be inflammatory pathology model mice or fibrosis pathology model mice.

[0046] Specifically, "inducing a disease model in modeling tool mice to obtain mice with a disease phenotype" can be: using sodium dextran sulfate to induce modeling tool mice to obtain mice with a colitis phenotype.

[0047] The present invention also provides the use of recombinant mice prepared by any of the above methods, modeling tool mice prepared by any of the above methods, or model mice prepared by any of the above methods in studying the molecular mechanism of IL-11 regulation during disease occurrence and progression.

[0048] The present invention also provides a method for studying whether IL-11 is involved in the occurrence and development of a disease, comprising the following steps:

[0049] Modeling tool mice were prepared according to the above method;

[0050] The modeling tool mice were divided into two groups. The experimental group was induced to produce a disease phenotype, and the control group was not induced. The difference in fluorescence signals between the control group and the experimental group was compared. If the fluorescence signal of the experimental group was significantly enhanced compared with the control group, it indicated that IL-11 was involved in the occurrence and development of the disease.

[0051] Specifically, the fluorescent signal is a red fluorescent signal.

[0052] Specifically, the fluorescent signal is a cyan fluorescent signal.

[0053] Specifically, the mouse can be a BALB / c mouse, an NCG mouse, an FVB mouse, a C3H mouse, a DBA mouse or a C57BL / 6 mouse.

[0054] The model mice can be used to study IL-11 + The genetic lineage of cells in development and disease provides further insights into IL-11 + Lays the foundation for the role of cells in disease and trauma.

[0055] This invention constructs an IL-11-Cre tool mouse based on the Cre-LoxP recombination system, which can be used to address scientific questions about the molecular mechanisms of IL-11+ regulation during the development and progression of important diseases. This invention will facilitate further exploration of the mechanisms of IL-11 in disease development and progression, identify new therapeutic targets, and develop more effective treatment strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 Schematic diagram of the components and working principle of TFP1-2A-Cre-WPRE-polyA.

[0057] Figure 2 This is a photo after immunofluorescence staining in Example 4. DETAILED DESCRIPTION

[0058] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0059] Unless otherwise noted, the experimental methods in the following examples are conventional methods and were performed according to the techniques and conditions described in literature in the field or according to product specifications. Materials and reagents used in the following examples are commercially available unless otherwise noted. Unless otherwise noted, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0060] Example 1: Preparation of functional DNA molecules

[0061] The functional DNA molecule is a linear double-stranded DNA molecule, as shown in SEQ ID NO: 1.

[0062] In SEQ ID NO: 1, nucleotides 1-1756 constitute the upstream homology arm (1756 bp), nucleotides 1757-2464 encode mTFP1, nucleotides 2465-2530 encode the P2A self-cleavage peptide, nucleotides 2531-3583 encode the Cre recombinase, nucleotides 3584-4172 constitute WPRE-polyA, and nucleotides 4173-5897 constitute the downstream homology arm (1725 bp).

[0063] mTFP1, or monomeric teal fluorescent protein 1, is a fluorescent protein derived from marine organisms that can be excited to emit bright cyan fluorescence in the 450-512 nm range. The porcine teschovirus-1 2A peptide, derived from porcine teschovirus, exhibits self-cleavage properties, enabling the protein chain to be cleaved at the 2A sequence, producing two separate proteins. Cre recombinase, a type I topoisomerase from bacteriophage P1, catalyzes site-specific recombination of DNA between loxP sites. WPRE, or woodchuck hepatitis virus posttranscriptional regulatory element, is a commonly used transcription enhancer element that enhances exogenous gene expression. The polyA signal, or polyadenylation signal, triggers 3'-end cleavage of mRNA and the addition of a polyadenylic acid tail to form a mature mRNA molecule.

[0064] A double-stranded DNA molecule represented by SEQ ID NO: 1 was artificially synthesized and designated mTFP1-2A-Cre-WPRE-polyA. The upstream homology arm corresponds to the upstream coding region of the Il11 gene in mouse genomic DNA (1756 bp upstream of the start codon), and the downstream homology arm corresponds to the coding region of the Il11 gene in mouse genomic DNA (the start codon ATG is counted as positions 1-3 of the coding region, and the downstream homology arm corresponds to positions 5 to 1729 of the coding region). Upon homologous recombination with mouse genomic DNA, mTFP1-2A-Cre-WPRE-polyA replaced the segment of mouse genomic DNA from the upstream homology arm to the end of the downstream homology arm (the replaced segments, from upstream to downstream, are: upstream homology arm, atga, downstream homology arm), thereby disrupting endogenous Il11 gene expression and allowing expression of mTFP1 and Cre to be driven by endogenous Il11 gene transcriptional regulatory elements.

[0065] The Il11 gene in mouse cDNA is set forth in SEQ ID NO: 2, with the start codon corresponding to positions 156-158 of SEQ ID NO: 2, and the stop codon corresponding to positions 753-755 of SEQ ID NO: 2. The Il11 gene in mouse genomic DNA (located on chromosome 7) is set forth in SEQ ID NO: 3, with the start codon corresponding to positions 4893-4895 of SEQ ID NO: 3, and the stop codon corresponding to positions 9310-9312 of SEQ ID NO: 3.

[0066] Example 2: Obtaining recombinant mice

[0067] Cas9 protein solution (EnGen Spy Cas9 NLS nuclease): NEB, catalog number M0646M. Target sequence: CTTACAGTTCATGTCCCCAC AGG CRISPR-Cas9 technology was used to integrate mTFP1-2A-Cre-WPRE-polyA into the target site in genomic DNA to obtain recombinant mice.

[0068] 1. Preparation of RNP Complex

[0069] Artificially synthesized crRNA (single-stranded RNA molecule, as shown in SEQ ID NO: 4) and tracrRNA (single-stranded RNA molecule, as shown in SEQ ID NO: 5).

[0070] CrRNA: 5'-CUUACAGUUCAUGUCCCCACGUUUUAGA GCUAUGCUGUUU UG-3';

[0071] tracrRNA: 5'- AAACAGCAUAGC AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAGUGGCACCGAGUCCGGUGCU-3'.

[0072] Prepare solution in tube 1: Add 0.8 µL of 100 pmol / µL crRNA to 5.2 µL of RNase-free water, then add 0.6 µL of 100 pmol / µL tracrRNA, mix well and incubate for 5 minutes, then add 0.2 µL of 20 µM Cas9 protein solution, mix well and incubate for 10 minutes to prepare solution in tube 1.

[0073] Prepare solution in tube 2: Take mTFP1-2A-Cre-WPRE-polyA (linear double-stranded DNA molecule) prepared in Example 1 and adjust the DNA concentration to 15 ng / µL with RNase-free water.

[0074] Mix 2 volumes of the solution in tube 1 and 3 volumes of the solution in tube 2 to obtain the RNP complex.

[0075] 2. Preparation of F0 mice

[0076] 1. Take 3-4 week old female C57BL / 6N mice and inject 10 IU pregnant mare serum (PMSG) into each mouse intraperitoneally. 46-48 hours later, inject 10 IU human chorionic gonadotropin (HCG) into each mouse intraperitoneally. Then, mate them with adult fertile male C57BL / 6N mice. The fertilized female mice are the donor mice.

[0077] 2. Take adult, fertile female C57BL / 6N mice and mate them with vasectomized male mice. The female mice that become pregnant (pseudo-pregnant female mice) are used as surrogate mice. Vasectomized male mice: Adult, fertile male C57BL / 6N mice that have undergone vasectomy.

[0078] 3. On the second day after step 1, the donor mice were killed and fertilized eggs were collected from the oviduct.

[0079] 4. Take the fertilized egg obtained in step 3, inject it with the RNP complex prepared in step 1 (inject until the nuclear region swells significantly), and then culture the fertilized egg in M16 medium (Sigma, product catalog number M7292) for 0.5-1 hour.

[0080] 5. After completing step 4, transplant the fertilized eggs into the oviduct of the surrogate mouse obtained in step 2 (25 fertilized eggs are transplanted into each surrogate mouse), and then raise the surrogate mouse normally. Offspring mice will be born after 19-20 days.

[0081] 6. Clip the paws of the offspring mice obtained in step 5 and number them one week after birth. Perform PCR analysis at 1-2 weeks of age. Mice that show a positive PCR result are designated as founder mice (also known as F0 mice).

[0082] PCR identification method: Take tail tissue, extract genomic DNA, and use the primer pair consisting of IL-11-cre-F1 and IL-11-cre-R1 for PCR amplification. If an amplified product of approximately 1882 bp is displayed, the PCR identification is positive.

[0083] IL-11-cre-F1 (SEQ ID NO: 6): 5'-TACCCATCCACTCACCACT-3';

[0084] IL-11-cre-R1 (SEQ ID NO: 7): 5'-TTCACGATGCCCTTGTCC-3'.

[0085] 7. Identify whether the founder mouse is homozygous or heterozygous

[0086] The tail tissue was collected and genomic DNA was extracted. PCR amplification was performed using the primer pair consisting of F1 and R1. If the amplified product showed a marked band (823 bp) by electrophoresis, the founder mouse was heterozygous. If the amplified product did not show the marked band, the founder mouse was homozygous.

[0087] F1 (SEQ ID NO: 8): 5'-GGGTGAGTCAGGATGTGTCAGGC-3';

[0088] R1 (SEQ ID NO: 9): 5'-GCCACCAAGCTCAAGTATCACAC-3'.

[0089] The identification results showed that many of the founder mice obtained were heterozygous.

[0090] 3. Obtaining Offspring Mice

[0091] The offspring mice (F1 generation mice) obtained by mating male F0 mice with female C57BL / 6N mice were 50% heterozygous recombinant mice.

[0092] The offspring mice (F1 generation mice) obtained by mating female F0 mice with male C57BL / 6N mice were 50% heterozygous recombinant mice.

[0093] Of the offspring mice (F2 generation mice) obtained by mating F1 generation recombinant male mice with F1 generation recombinant female mice of the same litter, 25% were homozygous recombinant mice and 50% were heterozygous recombinant mice.

[0094] F1 generation heterozygous recombinant mice can be used directly as experimental mice or further subcultured to establish strains. F2 generation heterozygous recombinant mice can be used directly as experimental mice or further subcultured to establish strains. F2 generation homozygous recombinant mice can be used directly as experimental mice or further subcultured to establish strains.

[0095] Method for identifying homozygous and heterozygous recombinant mice: Remove tail tissue, extract genomic DNA, and perform PCR amplification using primer pair 1 (primer pair consisting of IL-11-cre-F1 and IL-11-cre-R1, primer sequence see step 2, 6) and primer pair 2 (primer pair consisting of F1 and R1, primer sequence see step 2, 7), respectively. If electrophoresis of the amplified product using primer pair 1 shows a 1882 bp marker band and electrophoresis of the amplified product using primer pair 2 does not show an 823 bp marker band, the mouse is a homozygous recombinant mouse; if electrophoresis of the amplified product using primer pair 1 shows a 1882 bp marker band and electrophoresis of the amplified product using primer pair 2 shows an 823 bp marker band, the mouse is a heterozygous recombinant mouse.

[0096] Homozygous recombinant mice are also known as IL-11-mTFP1-Cre KI / KI homozygous mice. IL-11-mTFP1-Cre KI / KI homozygous mice develop and reproduce normally, with no obvious growth defects.

[0097] Example 3: Obtaining hybrid mice

[0098] B6-ROSA26-CAG-LSL-tdTomato mice: Strain name: B6.Cg- Gt(ROSA)26Sor tm9(CAG -tdTomato)Hze Common name: Ai9 or Ai9(RCL-tdT); Background: C57BL / 6NCrl. This mouse is a commercially available mouse strain from Beijing Weitongda Biotechnology Co., Ltd., sold as a fertile heterozygous mouse. The following DNA segments are integrated into the Rosa26 locus of one chromosome 6: a STOP element flanked by loxP upstream and a red fluorescent protein variant (tdTomato) downstream. The STOP element blocks tdTomato transcription (no red fluorescence). In the presence of Cre recombinase, the DNA between the loxP sites undergoes site-specific recombination, excising the STOP element and resulting in tdTomato expression (red fluorescence).

[0099] 1. F2 generation IL-11-mTFP1-Cre KI / KI homozygous mice (female mice) obtained in Example 2 were mated with B6-ROSA26-CAG-LSL-tdTomato mice (male mice) to obtain offspring mice.

[0100] 2. Screen the offspring mice obtained in step 1 for mice with mTFP1-2A-Cre-WPRE-polyA and tdTomato, which are IL-11-mTFP1-Cre-Rosa26 LSL-tdTomato Mouse, referred to as IL-11 tdTomato mouse.

[0101] Method for screening mice harboring mTFP1-2A-Cre-WPRE-polyA: genomic DNA was extracted from tail tissue and PCR amplified using a primer pair consisting of IL-11-cre-F1 and IL-11-cre-R1 (primer sequences are shown in step 6 of Example 2). If electrophoresis of the amplified product shows a signature band of 1882 bp, the mouse is identified as harboring mTFP1-2A-Cre-WPRE-polyA.

[0102] Method for screening mice with tdTomato: Take tail tissue, extract genomic DNA, and use primer pair F2 and R2 for PCR amplification; if electrophoresis of the amplified product shows a 196bp signature band, the mouse is a tdTomato-bearing mouse.

[0103] R2 (SEQ ID NO: 10): 5'-GGCATTAAAGCAGCGTATCC-3';

[0104] F2 (SEQ ID NO: 11): 5'-CTGTTCCTGTACGGCATGG-3'.

[0105] IL-11 tdTomato Mice can be used as tool mice to verify whether the Il11 gene is involved in the development and progression of diseases. The principle is as follows: Under the influence of regulatory elements upstream of the coding region of the endogenous Il11 gene on chromosome 7, Cre recombinase is expressed. Cre recombinase catalyzes site-specific recombination of DNA between loxP sites on chromosome 6, excising the STOP element and thereby expressing tdTomato (displaying red fluorescence). Therefore, the number and signal intensity of cells exhibiting red fluorescence can reflect whether the endogenous Il11 gene (the regulatory elements upstream of the endogenous Il11 gene coding region) is induced by disease or other substances, thereby determining whether the endogenous Il11 gene is involved in the development and progression of the disease or in the body's response to other substances.

[0106] Example 4: Construction of Colitis Model Animals

[0107] 1. Group processing

[0108] The IL-11 obtained in Example 3 tdTomato Mice (8 weeks old) were divided into two groups, with 2 mice in each group.

[0109] Experimental group: From day 1 to day 15, 1.5 g / 100 mL dextran sulfate sodium aqueous solution was used as drinking water; from day 16 to day 17, distilled water was used as drinking water;

[0110] Control group: distilled water was used as drinking water from day 1 to day 17;

[0111] Mice had free access to drinking water.

[0112] 2. Testing

[0113] After completing the grouping process in step 1, mice were sacrificed, colon tissues were removed, paraffin sections were prepared, and in situ immunofluorescence staining was performed using an antibody against tdTomato (RFP Antibody Pre-adsorbed, Rockland Immunochemicals, catalog number 600-401-379).

[0114] See the results Figure 2 (Scale bar: 500μm). Compared with the control group, the number of cells with red fluorescence in the colon of the experimental group animals increased significantly, indicating that the expression of the Il11 gene is involved in the occurrence and development of colitis, indicating that IL-11 Gene expression plays a key role in maintaining colonic homeostasis and colonic disease.

[0115] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. A specific DNA molecule, characterized in that: It includes the following elements from upstream to downstream: upstream homology arm, mTFP1 encoding gene, P2A self-cleavage peptide encoding gene, Cre recombinase encoding gene, WPRE-polyA and downstream homology arm; The upstream homology arm is shown at positions 1-1756 in SEQ ID NO: 1, the mTFP1 encoding gene is shown at positions 1757-2464 in SEQ ID NO: 1, the P2A self-cleavage peptide encoding gene is shown at positions 2465-2530 in SEQ ID NO: 1, the Cre recombinase encoding gene is shown at positions 2531-3583 in SEQ ID NO: 1, the WPRE-polyA is shown at positions 3584-4172 in SEQ ID NO: 1, and the downstream homology arm is shown at positions 4173-5897 in SEQ ID NO:

1.

2. A kit for constructing recombinant mice, comprising the specific DNA molecule according to claim 1.

3. The kit according to claim 2, wherein: The kit also includes Cas9 protein, CrRNA and TracrRNA; the CrRNA is shown in SEQ ID NO: 4, and the TracrRNA is shown in SEQ ID NO:

5.

4. A method for preparing a recombinant mouse, comprising the following steps: replacing a target segment in the mouse genomic DNA with the specific DNA molecule according to claim 1 to obtain a recombinant mouse; the target segment is a segment in the mouse genomic DNA starting from an upstream homology arm and ending at a downstream homology arm; the upstream homology arm is as described in claim 1, and the downstream homology arm is as described in claim 1.

5. The method according to claim 4, wherein: The method comprises the following steps: co-introducing a specific DNA molecule, a Cas9 protein, crRNA, and tracrRNA into a mouse, thereby replacing the target segment in the mouse genomic DNA with the specific DNA molecule to obtain a recombinant mouse; the specific DNA molecule is as described in claim 1; the crRNA is shown in SEQ ID NO: 4, and the tracrRNA is shown in SEQ ID NO:

5.

6. A method for preparing a modeling tool mouse, comprising the following steps: Prepare recombinant mice according to the method of claim 4 or 5; The recombinant mice are mated with other mice to obtain offspring mice; Screening of modeling tool mice from offspring mice.

7. A method for constructing a model mouse, comprising the following steps: Prepare a modeling tool mouse according to the method of claim 6; Modeling tool mice are used to induce disease models to obtain mice with disease phenotypes, which are called model mice.

Images