Methods for modulating transcriptional activity of the pafah1b1 gene and uses thereof
By regulating the methylation level of the PAFAH1B1 gene, especially the CpG islands in its promoter region, the unclear regulation of PAFAH1B1 gene expression was resolved, and effective regulation of granulosa cell cycle and ovarian development was achieved, providing experimental evidence.
Patent Information
- Application Number
- CN202411826932.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-11
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2044-12-11
AI Technical Summary
In the existing technology, the regulatory mechanism of PAFAH1B1 gene expression is unclear, the role of DNA methylation in granulosa cell and follicle development has not been fully explored, and there is insufficient research on its impact on ovarian granulosa cell function and follicle development.
PAFAH1B1 gene expression can be regulated by influencing its methylation level, particularly the CpG islands in its promoter region, through the use of gRNA, RNA interference fragments of DNA methyltransferase, or DNA methyltransferase inhibitors.
The study clarified the effect of DNA methylation on the transcriptional activity of the PAFAH1B1 gene, providing a simple and effective pathway for the regulation of the PAFAH1B1 gene in granulosa cells. This pathway can regulate the cell cycle and ovarian development, providing important evidence for subsequent experiments.
Smart Images

Figure CN119614569B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of gene expression regulation, and in particular to a method for regulating the transcriptional activity of a PAFAH1B1 gene and application thereof. BACKGROUND
[0002] DNA methylation is an epigenetic marker that regulates gene expression by affecting chromatin structure, DNA-protein interaction, etc., without changing the nucleotide sequence of the gene. Studies have shown that during the development of mouse follicles, large-scale DNA demethylation occurs continuously in ovarian granulosa cells. The initial puberty of mammals is also a period highly sensitive to epigenetic changes. Lomniczi et al. found that treating female rats before puberty with a DNA methylation inhibitor (5-Aza-CdR) significantly delayed the initial puberty of the rats compared with the control group. In summary, DNA methylation may affect the function of ovarian granulosa cells and follicle development by regulating the expression of key genes in granulosa cells.
[0003] PAFAH1B1 (Platelet Activating Factor Acetylhydrolase 1b Regulatory Subunit 1) is a regulatory subunit of platelet activating factor acetylhydrolase 1B, which is involved in the regulation of cell proliferation, apoptosis, cycle and other cell activities.
[0004] At present, the mechanism of regulating the expression of the PAFAH1B1 gene is not clear, and there is no report on the correlation between the expression and methylation of the PAFAH1B1 gene in granulosa cells and follicle development. The present study aims to explore whether DNA methylation can affect the expression of the PAFAH1B1 gene by changing the chromatin structure in the promoter region of the PAFAH1B1 gene. This will have important application value for the regulation mechanism of the PAFAH1B1 gene in granulosa cells and the use of the PAFAH1B1 gene to affect the initial puberty of mammals. SUMMARY
[0005] In order to study the effect of DNA methylation on the transcriptional activity of the PAFAH1B1 gene in granulosa cells, the first object of the present application is to provide a method for regulating the transcriptional activity of the PAFAH1B1 gene.
[0006] The second object of the present application is to provide the application of the above-mentioned method for regulating the transcriptional activity of the PAFAH1B1 gene in granulosa cells.
[0007] In order to achieve the first object of the present application, the present application provides a method for regulating the transcriptional activity of the PAFAH1B1 gene, which adopts the following technical solution:
[0008] A method for regulating the transcriptional activity of PAFAH1B1 gene, comprising affecting the methylation level of the PAFAH1B1 gene using gRNA, affecting the expression of the PAFAH1B1 gene; or using the RNA interference fragment of DNA methyltransferase, affecting the methylation level of the PAFAH1B1 gene, affecting the expression of the PAFAH1B1 gene; or using the DNA methyltransferase inhibitor, affecting the methylation level of the PAFAH1B1 gene, affecting the expression of the PAFAH1B1 gene.
[0009] Further, affecting the methylation level of the PAFAH1B1 gene comprises affecting the methylation level of the PAFAH1B1 gene promoter region, the PAFAH1B1 gene promoter region comprising CpG island (CGI), the CGI located in the range of -880bp~+170bp of the PAFAH1B1 gene. Further, the CGI comprises CGI1, CGI2, CGI3; the CGI1 is located in the range of -880bp~-592bp of the PAFAH1B1 gene, the CGI2 is located in the range of -506bp~-296bp of the PAFAH1B1 gene, and the CGI3 is located in the range of -7bp~+170bp of the PAFAH1B1 gene.
[0010] Further, the DNA methylation level of the CGI3 is inhibited using gRNA1, the sequence of the gRNA1 being 5'-GCCAACGGGACGCCGCGGUCGG-3'.
[0011] Further, the DNA methylation level of the CGI3 is inhibited using gRNA2, the sequence of the gRNA2 being 5'-GCGCUCAUGCGGCCGACCGCGG-3'.
[0012] Further, the RNA interference fragment of the DNA methyltransferase comprises si-DNMT1, si-DNMT3A or si-DNMT3B, the RNA interference fragment si-DNMT3A promoting the transcriptional activity of the CGI3 and the expression of the PAFAH1B1 gene; the RNA interference fragments si-DNMT1 and si-DNMT3B inhibiting the expression of the PAFAH1B1 gene.
[0013] Further, the DNA methyltransferase inhibitor comprises 5-Aza-CdR, the 5-Aza-CdR promoting the expression of the PAFAH1B1 gene.
[0014] In order to achieve the second object of the present application, the application provides an application of the method for regulating the transcriptional activity of PAFAH1B1 in granulosa cells, which adopts the technical scheme as follows:
[0015] According to the application of the method for regulating the transcriptional activity of PAFAH1B1 in granulosa cells, the methylation level of the promoter region of the PAFAH1B1 gene is regulated to regulate the cell cycle of the granulosa cells.
[0016] Further, the granulosa cells are human ovarian granulosa cell line COV434 with a cell confluence of 70%-80%.
[0017] Further, the use amount of the methylation inhibitor 5-Aza-CdR is 0.3-0.8 μM.
[0018] In summary, the application provides a method for regulating the transcriptional activity of PAFAH1B1 gene and its application, which has the following technical effects:
[0019] Firstly, the application firstly confirms that DNA methylation can obviously affect the transcriptional activity of PAFAH1B1 gene in granulosa cells, which provides a simpler and more effective new way for regulating the transcriptional activity of PAFAH1B1 in granulosa cells, and further regulating the cell cycle, function and ovarian development of the granulosa cells without genetic modification.
[0020] Secondly, the application explores the influence of DNA methylation on the promoter region of PAFAH1B1 gene, and confirms the specific positions of several CGIs of the promoter region of PAFAH1B1 gene affected by DNA methylation, which provides an experimental basis for the subsequent research on regulating the methylation of PAFAH1B1 gene by using CGI of PAFAH1B1 gene, so as to affect the transcriptional activity of PAFAH1B1 gene in cells.
[0021] Thirdly, the application confirms the specific influence of 5-Aza-CdR, si-DNMT3A, si-DNMT1, si-DNMT3B, gRNA1 and gRNA2 on the transcription and protein expression of PAFAH1B1 gene in granulosa cells through in vitro experiments, which provides a method and effect reference for the subsequent regulation of the transcriptional activity of PAFAH1B1 gene in granulosa cells by using DNA methylation, and provides an important experimental basis for the subsequent animal or human experiments. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 A is the influence of 5-Aza-CdR on the expression level of PAFAH1B1 mRNA detected by qRT-PCR.
[0023] Figure 1B is the effect of 5-Aza-CdR on the expression level of PAFAH1B1 protein detected by Western blot.
[0024] Figure 2 A is the effect of interfering DNMT1, DNMT3A on the expression level of PAFAH1B1 mRNA detected by qRT-PCR.
[0025] Figure 2 B is the effect of interfering DNMT1, DNMT3A on the expression level of PAFAH1B1 protein detected by Western blot.
[0026] Figure 3 is the distribution diagram of CGI and NCGI in PAFAH1B1 promoter region.
[0027] Figure 4 is the effect of interfering DNMT3A on the activity of PAFAH1B1 promoter region detected by dual-luciferase activity assay.
[0028] Figure 5 is the effect of interfering DNMT3A on the chromatin accessibility of PAFAH1B1 promoter region detected by chromatin accessibility assay.
[0029] Figure 6 A is the effect of dCas9-TET1-gRNA1 and dCas9-TET1-gRNA2 on the expression level of PAFAH1B1 mRNA detected by qRT-PCR.
[0030] Figure 6 B is the effect of dCas9-TET1-gRNA1 and dCas9-TET1-gRNA2 on the expression level of PAFAH1B1 protein detected by Western blot.
[0031] Figure 7 is the effect of dCas9-TET1-gRNA1 on the methylation level of CGI3 in PAFAH1B1 promoter region detected by BSP. DETAILED DESCRIPTION
[0032] The method for regulating the transcriptional activity of PAFAH1B1 and the application thereof disclosed in the present application are carried out in vitro environment, using human ovarian granulosa cell line COV434 as experimental cells.
[0033] The human ovarian granulosa cell line COV434 used in the present application is purchased from Wuhan Ponsay Life Technology Co., Ltd., and is resuscitated, fed and frozen in the cell laboratory of South China Agricultural University.
[0034] The present application will be further described by the following examples and figures, and other advantages and effects of the present application can be easily understood by those skilled in the art from the disclosure of the present application. It should be noted that numerous specific details are set forth in the following description in order to provide a thorough understanding of the present application. However, the present application can be practiced according to other embodiments that are not specifically described herein. Therefore, the scope of the present application is not limited to the specific embodiments disclosed in the following description. When specific conditions are not indicated in the examples, the conventional conditions or the conditions recommended by the manufacturer are used. When the manufacturers of the reagents or instruments are not indicated, the conventional products available on the market are used.
[0035] In the present application, statistical methods are used to analyze the results of three independent experiments in each example, and the "average value ± standard deviation" is calculated. Single factor variance analysis is used for significant difference analysis (in the figure, "*" represents P < 0.05, and "**" represents P < 0.01).
[0036] Example 1: Culture of human ovarian granulosa cell line COV434
[0037] COV434 recovery: Thaw the frozen cells in a 37°C water bath, centrifuge at 1000 rpm for 5 min, discard the supernatant, resuspend the cells with DMEM complete medium, inoculate into a 25 mL cell culture flask (Thermo, USA), and the medium composition is 4.45 mL DMEM high glucose medium (Hyclone, USA), 500 μL calf serum (Hyclone, USA), and 50 μL penicillin-streptomycin double antibody (Hyclone, USA), and place in a 37°C 5% CO2 incubator.
[0038] COV434 plating: observe the state of COV434 cells, when the cell confluence reaches about 80%, discard the culture medium, wash the cells twice with 37°C preheated PBS (containing 1% (v / v) penicillin-streptomycin double antibody). Digest the cells with 37°C preheated 0.25% trypsin for 5 min, terminate the digestion with DMEM complete medium, and wash the cells twice with 37°C preheated PBS (containing 1% (v / v) penicillin-streptomycin double antibody). Resuspend the cells with DMEM complete medium, evenly add the cell suspension to the cell culture plate, supplement the volume with DMEM complete medium, and gently shake to mix. Place in a 37°C, 5% CO2 incubator, and observe KGN growth after 24 h. The cell confluence in the cell culture plate reaches about 80%, and subsequent experiments are performed.
[0039] Example 2: 5-Aza-CdR treatment of COV434 cells
[0040] Treatment: Take the COV434 cells in Example 1 that the cell confluence reaches 80%, discard the culture medium, wash the cells twice with 37℃ preheated PBS (containing 1% (v / v) of penicillin-streptomycin); use 0.5 μM DNA methylase inhibitor (5-Aza-CdR, HY-A0004, MCE, USA) to treat the PBS washed cells, and the control group is to use 0.5 μM DMSO solution to treat the PBS washed cells in S1. The cell culture plate treated with 0.5 μM 5-Aza-CdR is placed in a 37℃, 5% CO2 incubator, and the cell growth is observed after 24h.
[0041] qRT-PCR: Take the test cells with good growth condition after the above treatment, use Trizol to extract total RNA from the cells (Takara, Japan), use PrimeScriptTM RT Master Mix cDNA reverse transcription kit (Takara, Japan) to reverse transcribe the extracted total RNA from the cells into cDNA. Use the cDNA as a template, use Maxima SYBR Green qPCR Master Mix (2X) kit (Thermo Scientific, USA) to carry out qRT-PCR detection, and use the comparative Ct value method to detect the relative expression amount of the gene in the sample. The detection gene uses GAPDH as an internal reference, and the specific calculation formula is: gene relative expression amount = 2-{〈(experimental group target gene Ct value)-(experimental group internal reference gene Ct value)〉-〈(control group target gene Ct value)-(control group internal reference gene Ct value)〉}. The qRT-PCR primers used in the present application are shown in Table 1.
[0042] Table 1 qRT-PCR primer sequence
[0043]
[0044]
[0045] Western Blot: Refer to the total protein extraction kit (Thermo, USA), extract the total protein of the COV434 cells treated by 5-Aza-CdR in this example, use the BCA protein quantification kit for protein quantification, SDS-PAGE, Western Blot, use the Image Plus software to analyze the protein bands in the Western Blot film, and study the effect of 5-Aza-CdR treatment on the protein expression level of PAFAH1B1 gene in COV434. The antibodies include Anti-PAFAH1B1 (Santacruz, China, sc-374586) and Anti-alpha Tubulin (Bioss, China, bs-20496R).
[0046] qRT-PCR to study the effect of 5-Aza-CdR treatment on the mRNA level of PAFAH1B1 in cells. The results are shown in Figure 1 A. Compared with the control group, 5-Aza-CdR significantly promoted the mRNA level of PAFAH1B1. The results of Western Blot are shown in Figure 1 B. The results showed that compared with the control group, 5-Aza-CdR significantly promoted the protein expression level of PAFAH1B1.
[0047] Example 3: si-DNMT1, si-DNMT3A and si-DNMT3B treatment of COV434 cells
[0048] Using Lipofectamine TM 3000 kit (Thermofisher, USA) liposome transfection method, using interference RNA si-DNMT1, si-DNMT3A, si-DNMT3B (sequences are shown in Table 2, represented by "t" for "U" in the sequence listing) and control si-NC (non-interference DNA methyltransferase RNA fragment, Guangzhou Dongze Biological Technology Co., Ltd., China) to transfect COV434 cells in Example 1 with a confluence of 80%. After transfection, COV434 was used as a sample, and the qRT-PCR method described in Example 2 was used to perform qRT-PCR on COV434 transfected with si-DNMT1, si-DNMT3A, si-DNMT3B and control si-NC. Refer to the Western Blot method described in Example 2 to perform Western Blot on COV434 transfected with si-DNMT1, si-DNMT3A, si-DNMT3B and control si-NC.
[0049] Table 2 si-DNMT1, si-DNMT3A, si-DNMT3B sequences
[0050] Si-RNA name Sequence (5'-3') si-DNMT1 UACAGUUGUUGACAAACGAG (SEQ ID NO. 5) si-DNMT3A ACCCUUACAAAGAAGUUUACA (SEQ ID NO. 6) si-DNMT3B CUCAUUUUAUCUUCUAAAACU (SEQ ID NO. 7)
[0051] qRT-PCR results are shown in Figure 2 A, the results show that, compared with the control group, si-DNMT3A significantly promotes the mRNA level of PAFAH1B1, si-DNMT1 and si-DNMT3B significantly inhibit the mRNA level of PAFAH1B1.
[0052] Western Blot results are shown in Figure 2 B, the results show that, compared with the control group, si-DNMT3A significantly promotes the protein expression level of PAFAH1B1, si-DNMT3B significantly inhibits the protein expression level of PAFAH1B1.
[0053] Example 4: Analysis of PAFAH1B1 promoter CpG island (CGI)
[0054] The CGI of the PAFAH1B1 promoter region (-2000 / +200, +1 is the transcription start site) was predicted by bioinformatics website http: / / www.urogene.org / cgi-bin / methprimer / methprimer.cgi The CGI of the PAFAH1B1 promoter region (-2000 / +200, +1 is the transcription start site) was predicted by bioinformatics website Figure 3 The results show that there are three CGIs in the PAFAH1B1 promoter region, namely CGI1 (-880 / -592), CGI2 (-506 / -296) and CGI3 (-7 / +170), and two non-CpG islands (NCGI), NCGI1 (-1135 / -930) and NCGI2 (-318 / -51bp).
[0055] Example 5: Dual fluorescence activity analysis
[0056] Construction of CGI and NCGI overexpression vectors: Primers were designed using primer design software Primer5, and the primer sequences are shown in Table 3 below. The amplified sequences of each CGI and NCGI in Example 4 were used as the target fragments. After purification, recovery, ligation with pMD18T vector (purchased from Takara), transformation, screening, and correct sequencing, the ordinary plasmid was extracted. Using BioEdit software analysis, the enzyme cutting sites of the upstream and downstream primers were MIu I and Xho I, respectively. The pMD18T recombinant plasmid was used as a template, and the primers were subjected to PCR amplification; the fragments were purified, double-digested, ligated with pGL3-basic vector, transformed, screened, and correctly sequenced to extract endotoxin-free plasmid (Magen, USA), named pGL3-CGI1, pGL3-CGI2, pGL3-CGI3, pGL3-NCGI1 and pGL3-NCGI2.
[0057] Table 3 Primer sequences for constructing CGI and NCGI overexpression vectors in Example 5.
[0058]
[0059] Note: The bold black text indicates protected bases, and the underlined text indicates enzyme cleavage sites.
[0060] Transfection: An experimental group was set up using COV434 cells that had reached 80% confluence as described in Example 1. The plasmids pGL3-CGI1, pGL3-CGI2, pGL3-CGI3, pGL3-NCGI1, pGL3-NCGI2, pGL3-basic, pGL3-control, and si-DNMT3A were transfected into COV434 cells using a 3000 kit (Invitrogen, USA). pGL3-basic served as a negative control (Guangzhou Dongze Biotechnology Co., Ltd., China), and pGL3-control served as a positive control (Guangzhou Dongze Biotechnology Co., Ltd., China). A corresponding control group was also set up. COV434 cells with 80% confluence as described in Example 1 were used... COV434 cells were transfected with the above plasmids pGL3-CGI1, pGL3-CGI2, pGL3-CGI3, pGL3-NCGI1, pGL3-NCGI2, pGL3-basic, pGL3-control, and si-NC using the 3000 kit (Invitrogen, USA). Each group was configured with three replicates. The transfected plates were incubated at 37°C in a 5% CO2 incubator. Cell status was observed 24 h post-transfection; cells were harvested when growth was good.
[0061] Dual-fluorescence activity assay: A dual-luciferase assay kit (Promega, USA) was used, following the manufacturer's instructions. Cells were washed twice with pre-warmed PBS (37°C), digested with 0.25% trypsin at 37°C for 5 min, and finally digested with complete culture medium. Cells were washed twice with pre-warmed PBS (37°C). Cells were resuspended in 75 μL of pre-ice-baked PBS, transferred to a dual-fluorescence assay plate, and then 75 μL of Luciferase Assay Reagent was added. The plate was incubated at 25°C for 20 min. The fluorescence value detected by the microplate reader represents the expression level of the corresponding firefly luciferase. Then, 75 μL of Stop& Reagent, mix well, and react at 25℃ for 20 min. The luminescence value detected by the microplate reader is the expression level of the corresponding Renida luciferase. The expression level of firefly luciferase compared to that of Renida luciferase is the relative activity of firefly luciferase.
[0062] The results of the dual fluorescence activity analysis are shown inFigure 4 The results show that, compared with the control group, si-DNMT3A significantly promotes the pGL3-CGI3 dual luciferase activity, indicating that si-DNMT3A mainly affects the methylation level of the CGI3 in the PAFAH1B1 gene promoter region, promotes the transcription of CGI3, and promotes the expression of the PAFAH1B1 gene. si-DNMT3A also has an effect on pGL3-CGI1, pGL3-CGI2, pGL3-NCGI1 and pGL3-NCGI2, but the effect is not significant.
[0063] Example 6: Chromatin accessibility analysis
[0064] Transfection: Take the COV434 cells with a confluence of 80% in Example 1, and transfect si-DNMT3A and its control si-NC into the COV434 cells. Set 3 replicates for each group, and place the well plate after transfection in a 37°C, 5% CO2 incubator for culture. 24 hours after transfection, observe the cell state, and collect the cells if the growth is good.
[0065] Use EpiQuik TM Chromatin Accessibility Assay Kit (EPIGENTEK, USA), and the specific steps refer to the instruction manual. Sample chromatin extraction: cell chromatin extraction, collect cells, add 400 μL 1×Lysis Buffer, and transfer 200 μL of cell suspension to a new RNase-free tube (sample). Transfer 200 μL of suspension to a new RNase-free tube (no-Nuclease Mix control). Incubate on ice for 10 min, spin for 10 s, and centrifuge at 5000 rpm for 5 min, and discard the supernatant. Wash once with 1 mL of 1×Wash Buffer, and centrifuge at 3000 rpm for 5 min at 4°C. Ovary tissue chromatin extraction: take 200 mg of tissue, add 400 μL of 1×Lysis Buffer, and grind the tissue using a homogenizer. Transfer 200 μL of the mixture to a new RNase-free tube (sample), and transfer 200 μL of the mixture to another new RNase-free tube (no-Nuclease Mix control). Centrifuge at 5000 rpm for 5 min at 4°C. Discard the supernatant, and wash again with 1 mL of 1×Wash Buffer.
[0066] Chromatin Digestion: Wash the chromatin pellets with 0.5 mL 1x Wash Buffer, centrifuge at 3000 rpm for 5 min at 4°C, and discard the supernatant. Add 48 μL Nuclear Digestion Buffer and 2 μL Nuclease Mix to the Nuclease Mix reaction mixture sample. Add 50 μL Nuclear Digestion Buffer to the no-Nuclease Mix reaction mixture sample. Mix well and incubate at 37°C for 4 min. Add 10 μL Reaction Stop Solution and incubate at 37°C for 10 min. Add 2 μL Proteinase K and incubate at 60°C for 15 min.
[0067] DNA Purification: Add 250 μL DNA Binding Solution to each column, add the sample, centrifuge at 12000 rpm for 30 s, and discard the flow-through. Add 200 μL 1x DNA Washing Solution to each column, centrifuge at 12000 rpm for 30 s, discard the flow-through, and repeat this step two times. Place the columns in new RNase-free tubes, add 20 μL Elution Solution, and centrifuge at 12000 rpm for 45 s to elute the DNA.
[0068] The purified si-DNMT3A and its control si-NC DNA were subjected to the EpiQuik TM Chromatin Accessibility Assay Kit (EPIGENTEK, USA) according to the instructions, and the results are shown in FIG. 6. Figure 5 The results show that, compared with the control group, the expression of DNMT3A in the interference cells significantly improves the chromatin accessibility of the CGI3 region of the PAFAH1B1 promoter, indicating that si-DNMT3A mainly affects the methylation of the CGI3 region by changing the chromatin structure of the CGI3 region, and has a promoting effect on the expression of the PAFAH1B1 gene.
[0069] Example 7: Construction of dCas9-TET1 system
[0070] To promote the low methylation level of CGI3, two pairs of gRNAs corresponding to the CGI3 (-7 / +170) region were designed, namely dCas9-TET1-gRNA1 (gRNA 1) and dCas9-TET1-gRNA2 (gRNA 2), and the sequences are shown in Table 4. The cells of Example 1 were treated with dCas9-TET1 fusion vector and gRNA1, and dCas9-TET1 fusion vector and gRNA2, respectively.
[0071] qRT-PCR results are shown in FIG. 2A, and the results show that dCas9-TET1-gRNA1 or dCas9-TET1-gRNA2 treatment significantly promotes the mRNA level of PAFAH1B1 gene compared with the control group. Figure 6 As shown in FIG. 2B, the results show that dCas9-TET1-gRNA1 or dCas9-TET1-gRNA2 treatment significantly promotes the protein expression level of PAFAH1B1 gene compared with the control group. Figure 6 As shown in FIG. 2B, the results show that dCas9-TET1-gRNA1 or dCas9-TET1-gRNA2 treatment significantly promotes the protein expression level of PAFAH1B1 gene compared with the control group.
[0072] Table 4 gRNA sequences
[0073] gRNA name Sequence (5'-3') dCas9-TET1-gRNA1 GCCAACGGGACGCCGCGGUCGG (SEQ ID NO. 18) dCas9-TET1-gRNA2 GCGCUCAUGCGGCCGACCGCGG (SEQ ID NO. 19)
[0074] Example 8: Bisulfite sequencing PCR (BSP)
[0075] Based on the results of Example 7, the BSP experiment selected dCas9-TET1 fusion vector carrying gRNA1 and its blank control to treat the cells of Example 1, and genomic DNA was extracted by using a tissue DNA kit (Omega Bio-tek, USA). According to the steps of EZ DNA methylation gold standard kit (ZYMO RESEARCH, California, USA), the purified DNA was subjected to bisulfite conversion. The bisulfite-converted DNA was used as a template to amplify CGI3 using BSP primers, and the BSP primer sequences are shown in Table 5. Finally, the sequencing results were compared with the original sequence by QUMA website (http: / / quma.cdb.riken.jp / ), and a dot plot was drawn, and 10 clones were needed for each sample to calculate the methylation rate.
[0076] The BSP detection methylation level results are shown in FIG. 3. Figure 7 As shown in FIG. 3, the results show that dCas9-TET1-gRNA1 significantly inhibits the methylation level of PAFAH1B1 promoter region CGI3 (-7 / +170) compared with the blank control.
[0077] Table 5 BSP primer sequences
[0078]
[0079] The application discloses the essence that DNA methylation level influences the transcriptional activity of PAFAH1B1 gene, and researches a new targeted method for effectively regulating the transcriptional activity of PAFAH1B1 gene. The method is applied to granulosa cells in vitro, and the results show that the method can effectively regulate the transcriptional activity of PAFAH1B1 gene in the granulosa cells, so that the granulosa cell cycle can be regulated by regulating the methylation level of PAFAH1B1 gene, which provides an effective new way for the research on the transcriptional activity of PAFAH1B1 gene and the regulation of the granulosa cell cycle, and can be directly used as a reference method for subsequent animal experiments.
[0080] The above description of the specific embodiments of the application discloses the technical details of the application in detail and illustrates the technical ideas of the application, and is intended to meet the authorization requirements of the Patent Law, but should not be considered as a limitation on the protection scope of the application. Researchers in the field can make various changes or modifications according to the application combined with their knowledge and technology at that time, as long as they do not deviate from the core ideas and spirits of the application, and all should belong to the protection scope of the claims attached to the application.
Claims
1. A method for enhancing human ovarian granulosa cells PAFAH1B1 The method for gene transcription activity is characterized by, In vitro, the dCas9-TET1 system was used to reduce the number of human ovarian granulosa cells. PAFAH1B1 The level of gene methylation promotes the aforementioned PAFAH1B1 Gene expression; Reduce the PAFAH1B1 Gene methylation levels include reducing the PAFAH1B1 The methylation level of the gene promoter region, the PAFAH1B1 The gene promoter region includes CpG islands, which are located in the gene promoter region. PAFAH1B1 The gene range is from -880bp to +170bp. The CpG island includes CGI1, CGI2, and CGI3, with CGI1 located in the... PAFAH1B1 Within the gene range of -880bp to -592bp, CGI2 is located in the... PAFAH1B1 Within the gene range of -506bp to -296bp, CGI3 is located in the... PAFAH1B1 Within the gene range of -7bp to +170bp; gRNAs, namely gRNA1 and gRNA2, were designed for the CGI3 region. Cells were treated with dCas9-TET1 fusion vector and gRNA1 or dCas9-TET1 fusion vector and gRNA2, respectively. The sequence of gRNA1 is shown in SEQ ID NO.18, and the sequence of gRNA2 is shown in SEQ ID NO.
19.
2. A method to enhance the function of human ovarian granulosa cells PAFAH1B1 The method for gene transcription activity is characterized by, In vitro, RNA interference fragments of DNA methyltransferases were used to promote the growth of human ovarian granulosa cells. PAFAH1B1 Gene expression; the RNA interference fragment of the DNA methyltransferase is si-DNMT3A, the sequence of which is shown in SEQ ID NO.
6.
3. A method to enhance the function of human ovarian granulosa cells PAFAH1B1 The method for gene transcription activity is characterized by, In vitro, DNA methyltransferase inhibitors were used to promote the growth of human ovarian granulosa cells. PAFAH1B1 Gene expression, wherein the DNA methyltransferase inhibitor is 5-Aza-CdR.
4. A method for reducing human ovarian granulosa cells PAFAH1B1 The method for gene transcription activity is characterized by, In vitro, RNA interference fragments of DNA methyltransferases were used to inhibit human ovarian granulosa cells. PAFAH1B1 Gene expression, wherein the RNA interference fragment of the DNA methyltransferase is si-DNMT3B, the sequence of which is shown in SEQ ID NO.
7.
5. A method for enhancing human ovarian granulosa cells according to any one of claims 1-3 PAFAH1B1 The method for gene transcription activity is characterized by, The human ovarian granulosa cells mentioned are the human ovarian granulosa cancer cell line COV434 with a cell confluence of 70%-80%.
6. The method for reducing human ovarian granulosa cells according to claim 4 PAFAH1B1 The method for gene transcription activity is characterized by, The human ovarian granulosa cells mentioned are the human ovarian granulosa cancer cell line COV434 with a cell confluence of 70%-80%.
7. The method for enhancing human ovarian granulosa cells according to claim 3 PAFAH1B1 The method for gene transcription activity is characterized by, In the human ovarian granulosa cells, the amount of the methyltransferase inhibitor 5-Aza-CdR used was 0.3-0.8 µM.
Citation Information
Patent Citations
Method for regulating and controlling transcriptional activity of PLPP3 in human ovarian granular cells
CN116790595A
Method for inducing synergistic expression of specific gene using demethylase and transcription-associated factor or chromatin-associated factor
WO2021167101A1