Method for promoting porcine granular cell proliferation by circRNA (Ribonucleic Acid) from follicular fluid exosome and application

Abstract

The invention relates to the technical field of livestock breeding biology, and discloses a method for promoting porcine ovary granular cell proliferation, which comprises the following steps: adding a porcine follicular fluid exosome into a porcine ovary granular cell culture system, and acting for a certain time at an effective concentration, so as to improve the proliferation activity of granular cells. After the exosome treatment, the apoptosis rate of granular cells can be reduced, the cell survival rate can be improved, and the granular cells can be promoted to secrete steroid hormones, including the estradiol level and the expression of progesterone synthetase. Cell experiments prove that the follicular fluid exosome can effectively improve the activity of granular cells, promote the process of a cell cycle, inhibit cell apoptosis and remarkably enhance the synthesis capacity of steroid hormones such as estradiol and progesterone, and a new intervention strategy is provided for improving follicular development and reproductive performance of sows.

Description

Technical Field

[0001] This invention relates to the field of animal husbandry and reproductive biotechnology, and in particular to a method and application of circRNA derived from follicular fluid exosomes to promote the proliferation of porcine granulosa cells. Background Technology

[0002] During the growth and development of the ovary in pigs, over 90% of follicles undergo spontaneous atresia, with only a small percentage developing into dominant follicles and releasing an egg. This phenomenon severely limits sow fertility and the economic benefits of pig farming. Follicle growth, development, and atresia are regulated by multiple factors. Among these, granulosa cells in the pig ovary, as the core supporting cells of the ovary, are not only a key site for steroid hormone synthesis, but their proliferative activity also directly determines the growth potential and developmental fate of follicles. Therefore, research on the molecular mechanisms regulating the proliferation of granulosa cells in the pig ovary has significant practical implications.

[0003] Follicular fluid exosomes, as key carriers of cell communication within the follicular microenvironment, can carry bioactive molecules such as RNA and proteins, playing a regulatory role in physiological processes such as granulosa cell proliferation and hormone synthesis. Previous studies have confirmed that follicular fluid exosomes can affect granulosa cell function by transporting signaling molecules such as non-coding RNA. However, the specific molecular mechanisms by which porcine follicular fluid exosomes regulate granulosa cell proliferation, especially the non-coding RNA-mediated regulatory network, remain unclear.

[0004] Current research on the regulation of ovarian granulosa cell proliferation largely focuses on single genes or signaling pathways, lacking a systematic analysis of the multi-molecular synergistic regulatory mechanisms mediated by follicular fluid exosomes. Furthermore, key molecular axes and related biological agents that can efficiently regulate porcine ovarian granulosa cell proliferation have not yet been identified, making it difficult to improve granulosa cell function and follicle utilization through targeted interventions. Therefore, it is urgent to elucidate the molecular mechanisms by which porcine follicular fluid exosomes regulate granulosa cell proliferation, identify core regulatory factors, and provide theoretical support for developing technologies to improve sow reproductive performance.

[0005] Currently, while the potential role of follicular fluid exosomes in regulating porcine ovarian granulosa cell proliferation has been identified, several key technological gaps exist: First, there is a lack of standardized preparation and identification systems for porcine follicular fluid exosomes, and existing isolation methods struggle to balance purity and activity, failing to provide stable materials for subsequent applications. Second, the specific molecular mechanisms by which exosomes regulate granulosa cell proliferation are not fully understood, particularly regarding the insufficient analysis of non-coding RNA-mediated regulatory networks, hindering the development of targeted interventions. Third, there is a lack of biological agents based on clearly defined regulatory pathways; current technologies cannot achieve precise regulation of granulosa cell proliferation and steroid hormone synthesis, failing to meet the practical needs of improving sow reproductive performance. Summary of the Invention

[0006] To address the technical problems mentioned in the background section, this invention provides a method and application for promoting porcine granulosa cell proliferation using circRNA derived from follicular fluid exosomes.

[0007] This invention is achieved using the following technical solution: One objective of this invention is to provide a method for promoting the proliferation of porcine ovarian granulosa cells. Porcine follicular fluid exosomes are added to a porcine ovarian granulosa cell culture system and treated at an effective concentration for a certain period of time, thereby enhancing the proliferative activity of granulosa cells. Further, the exosome treatment concentration is 10-150 µg / mL protein, preferably about 120 µg / mL. Treatment at this concentration for 24 hours can achieve the maximum enhancement of granulosa cell proliferation. Furthermore, exosome treatment can reduce the apoptosis rate of granulosa cells, increase cell survival rate, and promote the secretion of steroid hormones by granulosa cells, including increasing estradiol levels and the expression of progesterone synthases (such as 3β-HSD).

[0008] The second objective of this invention is to propose a method for promoting the proliferation of porcine ovarian granulosa cells by regulating the competitive endogenous RNA (ceRNA) axis of circ-GPEM / ssc-miR-92b-5p / TIAM1. This method involves upregulating the expression of circ-GPEM circular RNA or the TIAM1 gene, or inhibiting the function of ssc-miR-92b-5p microRNA, thereby relieving the inhibition of TIAM1 expression by ssc-miR-92b-5p and enhancing the proliferation capacity and steroid hormone synthesis function of granulosa cells.

[0009] Furthermore, the method for upregulating circ-GPEM is to introduce a vector expressing circ-GPEM into granulosa cells or to synthesize circ-GPEM circular RNA molecules. The method for inhibiting ssc-miR-92b-5p is to introduce an antisense oligonucleotide, an antisense expression vector, or a chemically modified miR-92b-5p inhibitor that is complementary to miR-92b-5p into granulosa cells to reduce endogenous miR-92b-5p activity.

[0010] Furthermore, the opposing biological effects were verified by reducing circ-GPEM expression or overexpressing ssc-miR-92b-5p: reducing circ-GPEM or overexpressing miR-92b-5p downregulated TIAM1 gene expression and inhibited granulocyte proliferation and steroid synthesis, while upregulating TIAM1 gene expression could rescue or reverse the above inhibitory effects, thus demonstrating the mechanism of the circ-GPEM / miR-92b-5p / TIAM1 axis in the regulation of granulocyte proliferation.

[0011] The third objective of this invention is to provide a method for preparing porcine follicular fluid exosomes, comprising the following steps: collecting porcine follicular fluid and removing cells and debris sequentially by gradient centrifugation; filtering the fluid through a 0.22µm filter membrane to remove impurities; and then performing ultracentrifugation to precipitate the exosomes. The method also includes an identification step for the obtained exosomes: observing the morphology of the exosomes using transmission electron microscopy; determining the exosome particle size distribution to be within the range of 50-150nm using nanoparticle tracking analysis (NTA), with an average particle size of approximately 120nm; and detecting the expression of exosome marker proteins using Western blotting to confirm that the separated particles conform to the characteristics of exosomes.

[0012] The fourth objective of this invention is to provide a biological agent for promoting the proliferation of porcine ovarian granulosa cells, the biological agent comprising an effective dose of porcine follicular fluid exosomes and / or at least one functional nucleic acid molecule capable of regulating the function of target molecules in the circ-GPEM / ssc-miR-92b-5p / TIAM1 axis.

[0013] Furthermore, the functional nucleic acid molecule is selected from one or a combination of the following: circ-GPEM circular RNA molecules, expression vectors that can increase circ-GPEM expression, repressive oligonucleotides targeting ssc-miR-92b-5p, expression vectors that can decrease ssc-miR-92b-5p expression, expression vectors or mRNAs of the TIAM1 gene, and siRNA molecules targeting TIAM1 for inhibiting TIAM1 overexpression to reverse abnormal proliferation of granulocytes.

[0014] The fifth objective of this invention is to propose the use of the aforementioned biological agent for the preparation of in vitro culture additives, veterinary drugs, or reproductive regulation agents that promote the proliferation of ovarian granulosa cells and / or enhance the synthesis of steroid hormones.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention establishes an efficient and stable process for the isolation and purification of porcine follicular fluid exosomes by optimizing gradient centrifugation combined with ultracentrifugation, along with transmission electron microscopy, NTA particle size analysis, and Western blotting marker protein detection. The obtained exosomes are morphologically intact, have uniform particle size, and exhibit significant purity, providing a reliable material basis for subsequent functional studies and applications.

[0016] Cellular experiments have confirmed that follicular fluid exosomes can effectively enhance granulosa cell viability, promote cell cycle progression, inhibit apoptosis, and significantly enhance the synthesis of steroid hormones such as estradiol and progesterone, providing a new intervention strategy for improving follicular development and sow reproductive performance.

[0017] This invention screened a network of ceRNAs closely related to granulosa cell proliferation from whole transcriptome data, and through multiple methods such as dual-luciferase reporter assay, gene overexpression / interference, and rescue assay, it was confirmed that circ-GPEM relieves the inhibition of TIAM1 by adsorbing miR-92b-5p, thereby promoting granulosa cell proliferation and hormone synthesis. This invention is the first to systematically elucidate the specific molecular mechanism by which porcine follicular fluid exosomes regulate granulosa cell function.

[0018] This invention not only provides exosomes themselves as bioactive components, but also includes functional nucleic acid molecules such as circ-GPEM mimics, miR-92b-5p inhibitors, and TIAM1 expression vectors, forming a multi-target, tunable formulation system with good application flexibility and translational potential.

[0019] The biological agents developed in this invention can be used to prepare in vitro culture additives, veterinary drugs, or reproductive regulation products, providing new technical means and product support for improving sow reproductive efficiency and improving the in vitro maturation environment of oocytes. Attached Figure Description

[0020] Figure 1 Typical morphological image of porcine follicular fluid exosomes under a transmission electron microscope (showing that the isolated exosomes have a cup-shaped vesicle structure).

[0021] Figure 2 : Particle size distribution of porcine follicular fluid exosomes (distribution and average size of exosomes in the range of 50–150 nm determined by NTA).

[0022] Figure 3 Western blotting results of characteristic proteins of porcine follicular fluid exosomes (CD9 and CD63 proteins showed clear bands, indicating high purity of exosomes).

[0023] Figure 4 Image of porcine ovarian granulosa cells endocytosis and uptake of follicular fluid exosomes under a laser confollicular microscope (green fluorescently labeled exosomes can be seen entering the granulosa cells).

[0024] Figure 5 : Trend of granulosa cell viability under different concentrations of follicular fluid exosome treatment (CCK-8 assay showed that cell proliferation activity increased with increasing exosome concentration, reaching a maximum at 120 μg / mL).

[0025] Figure 6 The effect of follicular fluid exosome treatment on granulosa cell proliferation and steroid hormone secretion (showing that the exosome-treated group has increased cell proliferation activity, decreased apoptosis rate, and significantly increased estradiol and progesterone secretion).

[0026] Figure 7Effects of follicular fluid exosome treatment on granulosa cell proliferation and steroid synthesis-related gene expression (Bcl2, StAR, and 3β-HSD genes were upregulated and Bax gene was downregulated after exosome treatment).

[0027] Figure 8 The effect of follicular fluid exosome treatment on the expression of Bcl2 and 3β-HSD proteins in granulosa cells (Western Blot results showed that the levels of Bcl2 and 3β-HSD proteins were significantly increased in the treatment group).

[0028] Figure 9 : RT-qPCR detection of expression trends of circ-GPEM, miR-92b-5p and TIAM1 in different treatment groups (circ-GPEM and TIAM1 were highly expressed in exosome treatment groups and exosome samples, while miR-92b-5p was highly expressed in control group cells).

[0029] Figure 10 : Circular structure verification results of circ-GPEM (PCR amplification and sequencing confirmed the circular ligation of circ-GPEM exon sequence).

[0030] Figure 11 Stability test of circ-GPEM after RNaseR enzyme treatment (circ-GPEM was not significantly degraded after enzyme digestion, while the linear control GAPDH mRNA was basically degraded).

[0031] Figure 12 : Detection map of circ-GPEM distribution in granulocyte nucleoplasm (circ-GPEM is mainly found in the cytoplasm).

[0032] Figure 13 The effect of miR-92b-5p on granulocyte proliferation (overexpression of miR-92b-5p inhibits granulocyte proliferation, while inhibition of miR-92b-5p promotes cell proliferation).

[0033] Figure 14 : Effect of miR-92b-5p on steroid hormone secretion in granulosa cells (Inhibition of miR-92b-5p increases estradiol and progesterone secretion levels and upregulates 3β-HSD and StAR gene expression, while overexpression of miR-92b-5p has the opposite effect).

[0034] Figure 15 : Effect of TIAM1 on granulocyte proliferation (silencing TIAM1 inhibits granulocyte proliferation, while overexpression of TIAM1 promotes cell proliferation).

[0035] Figure 16Effect of TIAM1 on steroid hormone secretion in granulocytes (interference with TIAM1 reduces E2 and P4 secretion, while overexpression of TIAM1 increases hormone secretion and correspondingly downregulates or upregulates 3β-HSD and StAR genes).

[0036] Figure 17 : Effect of TIAM1 on the expression levels of genes related to granulocyte proliferation / apoptosis (TIAM1 overexpression upregulates Bcl2 and downregulates Bax expression, while TIAM1 deficiency has the opposite effect).

[0037] Figure 18 The results of the dual-luciferase reporter assay verifying the direct targeting relationship between miR-92b-5p and TIAM1 (miR-92b-5p significantly reduced the fluorescence activity of the reporter gene containing the wild-type 3'UTR of TIAM1, while having no significant effect on the mutant).

[0038] Figure 19 Effect of miR-92b-5p targeting the TIAM1 gene on granulocyte proliferation (transfection with miR-92b-5p inhibitors can promote cell proliferation, but this proliferative effect is reversed after combined interference with TIAM1).

[0039] Figure 20 The effect of miR-92b-5p targeting the TIAM1 gene on steroid hormone synthesis in granulosa cells (inhibition of miR-92b-5p increases E2 and P4 secretion, while interference with TIAM1 weakens this hormone-synthesizing effect).

[0040] Figure 21 : Effect of circ-GPEM on steroid synthesis in porcine ovarian granulosa cells (overexpression of circ-GPEM can increase the secretion levels of estradiol and progesterone in granulosa cells).

[0041] Figure 22 : Effect of circ-GPEM on the proliferation of porcine ovarian granulosa cells (overexpression of circ-GPEM can promote granulosa cell proliferation, increase the Bcl2 / Bax ratio, and inhibit apoptosis).

[0042] Figure 23 The results of the dual-luciferase reporter assay verifying the direct targeting and binding relationship between circ-GPEM and miR-92b-5p (miR-92b-5p can specifically inhibit the fluorescence activity of reporter genes containing the circ-GPEM sequence).

[0043] Figure 24 The effect of circ-GPEM on TIAM1 expression by adsorbing miR-92b-5p through a "sponge" (the effect of circ-GPEM on TIAM1 upregulation was weakened after co-transfection with miR-92b-5p).

[0044] Figure 25 : The role of circ-GPEM as a ceRNA of miR-92b-5p in regulating granulocyte proliferation (the effect of circ-GPEM overexpression in promoting cell proliferation was significantly weakened after co-transfection with miR-92b-5p).

[0045] Figure 26 : The role of circ-GPEM as a ceRNA of miR-92b-5p in regulating steroid hormone secretion in granulosa cells (the effect of circ-GPEM overexpression in promoting estradiol and progesterone secretion was significantly reduced after co-transfection with miR-92b-5p). Detailed Implementation

[0046] The present invention will now be further described in conjunction with the accompanying drawings and specific embodiments. It should be noted that, without conflict, the various embodiments or technical features described below can be arbitrarily combined to form new embodiments.

[0047] The following examples further illustrate various aspects of the present invention. The essence of the present invention lies in revealing the mechanism by which exosomes derived from follicular fluid promote the proliferation and function of porcine ovarian granulosa cells, and providing corresponding preparation methods, uses, and specific means.

[0048] The sequence appendix is ​​as follows: Complete circular RNA sequence of porcine circ-GPEM (SEQ ID NO: 1): AGGGACGGGACGCGGUGCAGUGUUGGCAACGCTTACGGTGCACCTTGCGGAGAGGTGTAGGCAACCCATCCAGATGAAAACGACGGGAGGCTTGATGTGCTGAGAGTACTTCTTCAACAGGACCGAAGATGGATGCTTTCTTCAGACTGAAACCCATCCAGATGAAAACGACGGGAGGCTTGATGTGCT mature porcine ssc-miR-92b-5p sequence (SEQ ID NO:2): AGGGACGGGACGCGGUGCAGUGUU Porcine TIAM1 gene ORF sequence (SEQ ID NO:3): ATGGCCTTTCTGCGTGGCGGCGGCCATCGCCGCCCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG The 3' UTR sequence of the porcine TIAM1 gene (containing the miR-92b-5p binding site, SEQ ID NO:4): AGTCCCTTGCCGGCAGGCAAAAATTCCACAAGATGGACGGGCGGUGCAGUGUUAGAGGAACGGGCCAGGCAAAAATTCGTGTTGA circ-GPEMRT-qPCR upstream primer (SEQ ID NO:5): GCTGAGAGTACTTCTTCAACAGGACC circ-GPEMRT-qPCR downstream primer (SEQ ID NO:6): GAAGATGGATGCTTTCTTCAGACT Circ-GPEM loop structure verification of divergent upstream primer (SEQ ID NO:7): CTGAGAGTACTTCTTCAACAGGACC miR-92b-5p inhibitor sequence (SEQ ID NO:8): AACACUGCACCGAUCGCCCAGCCU TIAM1 siRNA positive strand (SEQ ID NO:9): GGACUUGUACGCUCAGAAATT TIAM1siRNA antisense strand (SEQ ID NO:10): UUUCUGAGCGUACAAGUCCTT upstream primer of internal reference gene GAPDH (SEQ ID NO: 11): ATCACTGCCACCCAGAAGACTG Internal reference gene GAPDH downstream primer (SEQ ID NO:12): GCCAGTGAGCTTCCCGTTG upstream primer of internal reference gene U6 (SEQ ID NO:13): GCTCGCTTCGGCAGCACATATAC Internal reference gene U6 downstream primer (SEQ ID NO:14): AGTGCAGGGTCCGAGGTATT List of key experimental primers

[0049] Example 1: The specific implementation steps for the isolation, purification, and identification of follicular fluid exosomes proposed in this embodiment are as follows: Ovaries from healthy adult sows were harvested and transported back to the laboratory within one hour of collection. The ovarian surface was rinsed three times with preheated (37°C) sterile saline (containing 1% penicillin-streptomycin), followed by three more rinses with preheated (37°C) 1×PBS buffer to remove blood and impurities. Medium-sized follicles (3–5 mm in diameter, pink in appearance, and with intact follicular walls) were selected. The follicles were punctured with a sterile disposable syringe, and follicular fluid was slowly aspirated. The obtained follicular fluid was collected in centrifuge tubes and centrifuged at 4°C, 500×g for 10 min to remove contaminated follicular granulosa cells. The supernatant was transferred to a new tube and centrifuged again at 4°C, 1200×g for 10 min to remove cell debris. The resulting supernatant was further centrifuged at 4°C, 10000×g for 30 min to precipitate and remove larger microvesicles and other extracellular vesicles. The supernatant from this step was collected and sterilely filtered through a 0.22 μm pore size filter membrane to further remove residual impurities and large extracellular vesicles. The filtrate was transferred to an ultracentrifuge tube and centrifuged at 120,000 × g for 60 min at 4 °C to enrich the precipitate. The supernatant was carefully discarded. The precipitate was resuspended in 10 mL of sterile 1×PBS, gently pipetted to mix, and then centrifuged again at 120,000 × g for 60 min at 4 °C. After discarding the supernatant, the final precipitate was resuspended in approximately 1 mL of sterile PBS, which is the purified follicular fluid exosome suspension. The obtained exosome sample can be used directly for subsequent cell experiments, or aliquoted and stored at -80 °C for later use.

[0050] The exosomes isolated above were identified using various methods. Transmission electron microscopy (TEM) showed that the exosomes exhibited a typical spherical membrane vesicle structure with uniform diameter, displaying a typical cup-shaped vesicle structure. The clean background indicated that the isolated exosomes were of good integrity and met the requirements for subsequent experiments (see [link to TEM]). Figure 1 Nanoparticle tracking analysis (NTA) revealed that the exosome particle size was mainly distributed in the range of 50–150 nm, with an average particle size of approximately 120.5 nm (consistent with the typical exosome size range of 30–150 nm). The exosome concentration was approximately 2.0 mg / mL (see [link to relevant documentation]). Figure 2BCA protein quantification results showed that the exosome protein concentration was approximately 2 mg / mL. Further Western blotting was used to detect exosome marker proteins. The results showed characteristic bands of typical exosome marker proteins such as CD9 and TSG101 in the isolated products. CD9 and CD63 showed clear and specific bands at approximately 25 kDa. No intracellular component Calnexin band was detected, indicating high purity of the isolated exosomes. The absence of intracellular organelle marker protein bands (such as Calnexin) confirms that the extract is a high-purity exosome (see...). Figure 3 The above results confirm that this embodiment successfully isolated characteristic exosome particles from porcine follicular fluid, providing basic materials for subsequent experiments.

[0051] Example 2: The experiment on the role of follicular fluid exosomes in promoting granulosa cell proliferation and function proposed in this embodiment is specifically implemented as follows: Fresh adult sow ovaries were transported in 37°C physiological saline containing 1% penicillin / streptomycin. In the laboratory, the ovaries were washed again, and healthy follicles (3–5 mm) were selected. Free granulosa cells were obtained from the follicular fluid using a syringe aspiration. The collected granulosa cell suspension was centrifuged at 1000 rpm for 5 min at room temperature to precipitate the cells. The supernatant was discarded, and the cells were resuspended in DMEM / F-12 medium and washed again by centrifugation. This process was repeated twice to remove blood and impurities. Finally, the purified granulosa cells were resuspended in DMEM / F-12 complete medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin and cultured in a 37°C, 5% CO2 incubator. After 48 h, the medium was replaced with fresh medium to ensure the cells were in good condition for use. Cell identification showed that the purity of POGCs obtained by this method was approximately 92% or higher, meeting the experimental requirements. Exosome treatment and proliferation assay: The cultured granulosa cells were seeded into suitable culture plates. When the cells reached approximately 70% confluence, the medium was replaced with fresh basal medium. Subsequently, a certain amount of follicular fluid exosome working solution was added to the culture medium according to different experimental groups to achieve the final exosome concentration at predetermined values ​​(e.g., 10, 20, 40, 60, 100, 120, 150, 200 µg / mL). After 24 h of treatment and culture, cell viability and proliferation levels were detected using a cell counting kit (CCK-8): 10 μL CCK-8 reagent was added to each well of culture medium, and after incubation at 37°C in the dark for 2 h, the absorbance (OD) at 450 nm was measured to reflect the number of viable cells. The results showed that compared with the control group without exosomes (GC group), the granulosa cell group (GCE group) with added exosomes showed significantly increased cell proliferation and viability, exhibiting a dose-dependent increasing trend. As the amount of exosomes added increased, granulosa cell viability significantly increased, and this increase was concentration-dependent, reaching its highest level at 120 μg / mL. When the exosome concentration increased to 150 and 200 μg / mL, the increase in cell viability tended to level off (see [reference needed]). Figure 5 The cell viability enhancement was most significant at an exosome concentration of approximately 120 µg / mL. Further increasing the concentration to 150–200 µg / mL did not further enhance the cell proliferation-promoting effect, suggesting that 120 µg / mL is the optimal concentration.

[0052] In this embodiment, a series of subsequent treatments all used 120 µg / mL as the optimal concentration for exosome activity. Furthermore, the uptake of exosomes by granulosa cells was observed using laser confocal microscopy: exosomes were labeled with the green fluorescent dye PKH67 and co-cultured with granulosa cells for 2 h. DAPI stained the nuclei blue; against the background of blue DAPI-stained nuclei, numerous exosomes with green fluorescent signals were visible distributed within and around the granulosa cells. The results showed green fluorescent signals around and inside the cells, demonstrating that POGCs can take up exosomes in vitro via endocytosis (see [link to documentation]). Figure 4Effects on cell proliferation and function: Flow cytometry was used to detect cell cycle distribution and apoptosis. Results showed that the proportion of cells in S phase increased and the proportion of cells in G0 / G1 phase decreased in the exosome-treated group, indicating accelerated cell cycle progression. Simultaneously, exosomes significantly reduced the early and late apoptosis rates of granulosa cells, resulting in a significantly increased number of surviving cells compared to the control group. CCK-8 assays showed that the exosome-treated group (GCE) exhibited significantly increased granulosa cell proliferation compared to the untreated control group (GC). Flow cytometry Annexin V-FITC / PI double staining results showed a significantly reduced apoptosis rate. Enzyme-linked immunosorbent assays showed that the concentrations of estradiol (E2) and progesterone (P4) in the cell culture supernatant of the treated group were significantly higher than those in the control group (see [link to relevant data]). Figure 6 At the molecular level, exosome treatment promoted the upregulation of expression of cell proliferation-related genes, such as significantly increased mRNA and protein levels of the anti-apoptotic gene Bcl-2, while downregulating the expression of the pro-apoptotic gene Bax, reflecting the molecular mechanism of improved cell survival. RT-qPCR results showed that, compared with the control group (GC), the exosome-treated group (GCE) showed significantly upregulated expression of the anti-apoptotic gene Bcl-2 and significantly downregulated expression of the pro-apoptotic gene Bax; at the same time, the expression of key steroid hormone synthesis genes StAR and 3β-HSD was also significantly increased (see [link to relevant documentation]). Figure 7 ).

[0053] On the other hand, exosome treatment also enhanced the endocrine function of granulosa cells: ELISA analysis of the culture supernatant revealed that the concentration of estradiol (E2) secreted by cells in the treated group was higher than that in the control group, indicating increased steroid hormone synthesis. Simultaneously, the transcription and translation levels of the key steroid-producing enzyme gene 3β-HSD (encoding 3β-hydroxysteroid dehydrogenase required for progesterone synthesis) were upregulated in the treated group. Western blotting protein analysis also confirmed that the expression levels of Bcl2 protein and 3β-HSD enzyme (the product of the HSD3B1 gene) in granulosa cells were significantly increased after exosome treatment (see [link to relevant documentation]). Figure 8 This demonstrates that follicular fluid exosomes not only promote granulosa cell proliferation but also enhance their anti-apoptotic capacity and steroid hormone synthesis function. These effects collectively provide favorable conditions for follicular development.

[0054] Example 3: This embodiment performed a full transcriptome analysis on granulosa cells before and after exosome treatment. By comparing the differences in transcriptional expression between the exosome-treated group (GCE) and the control group (GC), key functional molecules were screened and a regulatory network was constructed. RNA extraction and sequencing: Total RNA was extracted from granulosa cells in the control and exosome-treated groups obtained in Example 2. Specifically, a one-step extraction method using TRIzol reagent was employed: after cell collection, TRIzol lysis buffer was added, and the supernatant was purified by isopropanol precipitation and washing with 75% ethanol. The purity and integrity of RNA were detected using NanoDrop and agarose gel electrophoresis to ensure that RNA was purified. 260 / A 280 The ratios were between 1.8 and 2.0, with no genomic DNA contamination and RNA integrity RIN values ​​≥7.0, meeting the requirements for subsequent library construction. Three biological replicates were selected from each group for testing. During the construction of the whole transcriptome library, 3 μg of total RNA from each sample was used for different sub-libraries: after removing ribosomal RNA, a strand-specific library was constructed to capture mRNA and lncRNA; another portion of the sample was used to construct a small RNA library for detecting miRNA and other short fragments. During library construction, adapters were added, reverse transcription was performed, and specific RNA fragments were enriched through amplification. Finally, the library was sequenced using a high-throughput paired-end sequencing platform with Illumina. The raw read data obtained from sequencing were filtered for quality control, removing adapter sequences and low-quality reads to obtain clean reads for downstream bioinformatics analysis. Differential expression analysis: Cleanreads were aligned to the porcine reference genome Susscrofa 11.1 (Ensembl database). mRNA and lncRNA alignments were quantified using Hisat2 and StringTie, while miRNA sequence alignment used Bowtie and sequence alignment algorithms. circRNA identification was performed by scanning inverted repeat fragments using tools such as Find_circ to determine the exon splicing pattern of circular RNAs. For each transcript, its expression level in each sample was calculated (TPM values ​​for mRNA and lncRNA, RPM for miRNA, and circularization counts for circRNA). Subsequently, differential expression analysis was performed on the data from the two groups of samples using the bioinformatics software edgeR. A screening criterion of |foldchange|≥2 and a significance level of P<0.05 was used to identify the list of genes and non-coding RNAs upregulated or downregulated by exosome treatment.

[0055] The analysis showed that, compared with the control group, 3820 genes (mRNAs) were significantly differentially expressed in the exosome-treated group, a significant portion of which were related to cell proliferation and metabolic pathways. Several differentially expressed non-coding RNAs were also identified, including approximately 35 differentially expressed long non-coding RNAs (DELs), 5 differentially expressed circular RNAs (DECs), and 49 differentially expressed microRNAs (DEMis). The presence of these differentially expressed molecules indicates that exosomes have a broad impact on the transcriptional program of granulosa cells. Functional enrichment and network construction: Gene function annotation and pathway enrichment analysis were performed on the selected differentially expressed genes and non-coding RNA sets. The results showed that exosome-induced upregulated genes were significantly enriched in pathways such as cell cycle regulation, DNA replication, and cell proliferation; downregulated genes were enriched in pathways such as apoptosis and stress response, indicating that exosomes generally activated proliferation-related molecular networks and inhibited apoptosis pathways. This is consistent with the biological effects observed in Example 2. Furthermore, the potential target genes of differentially expressed lncRNAs were enriched in pathways related to granulosa cell proliferation, endocrine function, and energy metabolism; the host genes of differentially expressed circRNAs were significantly enriched in hormone-mediated signaling pathways; and the target genes regulated by differentially expressed miRNAs were involved in processes such as cell cycle, proliferation, and ovarian steroid synthesis. These findings suggest that exosome-carried or induced non-coding RNAs may regulate granulosa cell growth and function through extensive upstream and downstream interactions.

[0056] Based on the above analysis results, this invention further constructs a regulatory network of non-coding RNA and mRNA to explore key molecular regulatory axes: (1) Establishing a lncRNA–mRNA interaction network: Selecting differential lncRNAs related to granulocyte proliferation and metabolism, and their targeted differential mRNAs (determined based on functional annotation and co-expression relationship) to construct a network diagram together; (2) Establishing a miRNA–mRNA interaction network: Predicting the targeting relationship between differential miRNAs and differential mRNAs through databases, pairing and connecting downregulated mRNAs that may be inhibited by upregulated miRNAs and upregulated mRNAs that are regulated by downregulated miRNAs to construct a network for miRNA to regulate gene expression; (3) Establishing a circRNA–miRNA interaction network: Using bioinformatics software to predict miRNA binding sites on differential circRNA sequences, pairing and connecting differential miRNAs that may be bound by differential circRNAs to form a network in which circular RNA acts as a competitive binding sponge for miRNAs.

[0057] Combining the above three sub-networks, a comprehensive ceRNA regulatory network model is constructed: In this network, lncRNA or circRNA can act as ceRNA (competitive endogenous RNA), binding to miRNAs through common miRNA response elements, affecting the miRNA's inhibition of its target mRNA, thereby upregulating gene expression. Through analysis of this ceRNA network model, this invention screened a key regulatory axis highly correlated with the follicular fluid exosome-induced granulosa cell proliferation effect from numerous candidates—circ-GPEM~ssc-miR-92b-5p~TIAM1.

[0058] Among them, circ-GPEM is a newly identified circular RNA molecule in this study, ssc-miR-92b-5p is a significantly different porcine miR-92b homologous miRNA, and TIAM1 is a gene encoding T-cell lymphoma invasion and transfer factor 1 protein. Experiments of this invention demonstrate that the ceRNA axis formed by these three molecules plays a central role in the regulation of granulosa cell proliferation. The following examples will specifically describe the verification process of this regulatory mechanism.

[0059] Example 4: This embodiment focuses on circ-GPEM, miR-92b-5p, and TIAM1, which were screened in Example 3, and conducts a series of cell function experiments to confirm their regulatory relationship and their effects on granulocyte proliferation. The steps include the following: In this embodiment, a novel circular RNA molecule was discovered in granulosa cells of the exosome-treated group through whole transcriptome sequencing alignment. This circRNA was upregulated in the treated group and may have an important function. Sequence analysis revealed that this circRNA was formed by backsplicing of a specific genomic fragment and was approximately several hundred bases in length. Due to its significant association with granulosa cell proliferation, metabolism, and endocrine function, the applicant named it circ-GPEM (Granulosacell Proliferation, Endocrine and Metabolism-related circRNA). Specific primers were designed for RT-qPCR validation of circ-GPEM, and the expression level of circ-GPEM in exosome-treated POGCs was significantly increased compared to the untreated control. Further nuclease digestion and sequencing confirmed its circular structure: circ-GPEM was amplified using divergent primers to obtain the expected product, while no amplification was observed in genomic DNA, proving that circ-GPEM possesses a backsplicing site; after treatment of linear RNA with RNase R, circ-GPEM remained stably detectable, while the control linear β-actin mRNA was significantly degraded, indicating that circ-GPEM is a closed circular RNA molecule without a free 3' end. The specific circular linker sequence of circ-GPEM was amplified using polymerase chain reaction, and agarose gel electrophoresis detected an amplified band of the expected size. Sequencing confirmed the circularization of the exon sequence (see [link to relevant documentation]). Figure 10 Total RNA was digested with RNase R exonuclease and then analyzed. The results showed that circ-GPEM exhibited anti-degradation properties against RNase R, with no significant decrease in its relative copy number before and after treatment, while the straight-chain control GAPDH mRNA was significantly degraded after enzyme treatment (see [link to relevant documentation]). Figure 11 Furthermore, through separation experiments of the nucleus and cytoplasmic components, it was found that circ-GPEM was mainly present in the cytoplasmic components of granulocytes (see [link to study]). Figure 12 This suggests that it may exert a regulatory role in the cytoplasm by acting as a competitive endogenous RNA. In summary, the existence and circular form of circ-GPEM were confirmed, and its high expression characteristics as a candidate ceRNA were recorded.

[0060] In this embodiment, bioinformatics prediction revealed that the circ-GPEM sequence is rich in multiple miRNA binding sites, among which ssc-miR-92b-5p is a microRNA closely related to granulosa cell function. miR-92b-5p was significantly downregulated in exosome-treated cells (relative to the control group) and was suspected as a functional binding target of circ-GPEM. On the other hand, analysis using a miRNA target gene prediction database revealed that the 3'UTR region of the TIAM1 gene contains a highly conserved binding sequence for miR-92b-5p, suggesting that miR-92b may directly target and negatively regulate TIAM1 expression. The protein encoded by the TIAM1 gene is a signaling molecule that promotes cell proliferation and survival, and in the RNA sequencing of this study, it was one of the genes upregulated in the exosome-treated group. Therefore, it is speculated that circ-GPEM may adsorb miR-92b-5p through a "sponge" mechanism, relieving its inhibitory effect on TIAM1, thereby upregulating TIAM1 expression and promoting granulosa cell proliferation. To verify this hypothesis, functional experiments were conducted using miR-92b-5p and TIAM1 in this embodiment.

[0061] In this embodiment, RT-qPCR analysis revealed that circ-GPEM and TIAM1 were upregulated after treatment with follicular fluid exosomes, while miR-92b-5p expression decreased, with the three showing opposite trends. RT-qPCR results showed that the expression levels of circ-GPEM and TIAM1 in the exosome treatment group (GCE) and follicular fluid exosome samples (Exo) were significantly higher than those in the control granulosa cells (GC), while miR-92b-5p expression was downregulated in the treatment group and relatively high in the control group cells (see [link to relevant documentation]). Figure 9 This result supports the inference that circ-GPEM may act as a ceRNA to adsorb miR-92b-5p, thereby leading to the upregulation of TIAM1. Combined with the aforementioned exosome function assay results, it is speculated that circ-GPEM is likely carried into granulosa cells by follicular fluid exosomes and plays a role in regulating cell proliferation and function.

[0062] Furthermore, to directly demonstrate the role of the circ-GPEM / miR-92b-5p / TIAM1 axis in cell proliferation and steroid synthesis, this invention conducted gene overexpression and interference experiments: • miR-92b-5p overexpression and inhibition: Granulosa cells were transfected with chemically synthesized miR-92b-5p mimics and an inhibitor to upregulate or inhibit miR-92b function. Transfection efficiency assays confirmed that miR-92b-5p expression levels significantly increased after mimics transfection, while inhibitor transfection significantly decreased miR-92b-5p expression. CCK-8 proliferation assays and ELISA hormone assays showed that overexpression of miR-92b-5p (mimics group) significantly reduced granulosa cell proliferation activity, with cell OD values ​​decreasing compared to the control group. Conversely, transfection with miR-92b-5p inhibitor significantly promoted granulosa cell proliferation, increasing the proportion of proliferation-positive cells; simultaneously, the E2 hormone content in the culture supernatant decreased. In contrast, inhibition of endogenous miR-92b-5p (inhibitor group) resulted in a higher cell proliferation rate and increased hormone secretion levels than the control (see [link to relevant documentation]). Figure 13 Further examination of steroid hormone secretion function revealed that the levels of E2 and P4 in the cell culture supernatant of the miR-92b-5p imics transfection group were significantly lower than those of the control group, while the hormone secretion of the miR-92b-5p pinhibitor transfection group was significantly increased. Simultaneously, qPCR showed that inhibition of miR-92b-5p upregulated the expression of intracellular 3β-HSD and StAR genes, while overexpression of miR-92b-5p decreased the transcriptional levels of these synthase genes (see [link to study]). Figure 14 This indicates that miR-92b-5p plays a negative regulatory role in granulosa cells, and its high expression inhibits cell proliferation and steroid synthesis. In this embodiment, an expression vector was constructed to efficiently express the porcine TIAM1 gene ORF in granulosa cells, serving as the TIAM1 overexpression group; a small interfering RNA (siRNA) was designed to target and silence the TIAM1 gene, serving as the TIAM1 interference group. After transfection with the TIAM1-specific siRNA, the expression levels of TIAM1 mRNA and protein in granulosa cells were significantly reduced; however, transfection with the TIAM1 overexpression plasmid (OE-TIAM1) resulted in a significantly higher TIAM1 expression level than the empty vector control group (NC), demonstrating the effects of interference and overexpression. The experimental results were contrary to those of miR-92b: overexpression of TIAM1 significantly increased granulosa cell proliferation and E2 secretion levels; CCK-8 assays showed that silencing TIAM1 inhibited granulosa cell proliferation, while overexpression of TIAM1 significantly promoted cell proliferation (see [link to relevant documentation]). Figure 15 Interference with TIAM1 inhibits cell proliferation and reduces hormone synthesis.

[0063] ELISA results showed that knockdown of TIAM1 significantly reduced the levels of E2 and P4 in the culture supernatant, while overexpression of TIAM1 significantly increased the secretion of both hormones. qPCR analysis revealed that TIAM1 deletion downregulated the expression of 3β-HSD and StAR genes, while TIAM1 overexpression upregulated genes related to the synthesis of these hormones (see [link to ELISA]). Figure 16 ).

[0064] Furthermore, the effects of TIAM1 on apoptosis regulators have been confirmed: interference with TIAM1 reduces Bcl2 gene expression and increases Bax gene expression, while overexpression of TIAM1 exhibits the opposite regulatory pattern (see [link to relevant documentation]). Figure 17 In particular, TIAM1 overexpression partially counteracted the inhibitory effect of miR-92b-5p overexpression; that is, when both were present, cell proliferation and hormone synthesis levels were restored compared to miR-92b overexpression alone. This suggests that TIAM1 is one of the main targets of miR-92b in inhibiting granulocyte function. In this embodiment, siRNA was used to mediate the knockdown of circ-GPEM circular RNA, and an overexpression vector containing the reverse splicing sequence of the circ-GPEM gene was constructed. Transfection efficiency verification showed that siRNA could reduce endogenous circ-GPEM expression by approximately 80%, while vector transfection could increase circ-GPEM levels by tens of times. Functional assays showed that knockdown of circ-GPEM resulted in decreased granulosa cell proliferation and reduced E2 secretion, with phenotypes similar to those of miR-92b-5p overexpression or TIAM1 inhibition; conversely, overexpression of circ-GPEM promoted cell proliferation and increased steroid hormone levels, mimicking the cell-promoting effects of exosome treatment.

[0065] After transfection of granulosa cells with the circ-GPEM overexpression vector (OE-circGPEM), significant changes occurred in the cell's functional parameters: compared with the control group, the levels of E2 and P4 in the cell culture supernatant of the OE-circGPEM group were significantly increased (see [link to original text]). Figure 21 CCK-8 assays showed that circ-GPEM overexpression significantly improved granulocyte proliferation, and flow cytometry analysis revealed a decrease in apoptosis rate (upregulation of Bcl2 gene expression and downregulation of Bax expression), leading to an increase in the Bcl2 / Bax ratio (see [link to relevant documentation]). Figure 22 ).

[0066] This indicates that circ-GPEM itself enhances the proliferation and function of granulosa cells, and has the effects of promoting proliferation, inhibiting apoptosis, and enhancing the synthesis of steroid hormones in granulosa cells.

[0067] To further confirm circ-GPEM as a molecular sponge for miR-92b-5p and the molecular mechanism by which miR-92b-5p directly targets TIAM1, this invention designed a dual-luciferase reporter gene assay and a cell co-transfection rescue assay. The specific implementation steps of the experiments are as follows: Fragments containing the miR-92b-5p recognition sequence were cloned downstream of the reporter vector to verify direct binding between molecules.

[0068] First, a dual-fluorescent reporter vector for TIAM1-3'UTR was constructed; the predicted miR-92b target site sequence in the TIAM1 gene 3'UTR was inserted; the control vector was mutated at this site to disrupt miRNA binding. The above vectors were co-transfected with the ssc-miR-92b-5p mimic into HEK293 cells, and the luciferase activity ratio was measured. The results showed that co-transfection with miR-92b-5p significantly reduced wild-type TIAM1-UTR reporter activity, while the mutant was unaffected. miR-92b-5p significantly reduced the fluorescence activity of the reporter gene containing the wild-type TIAM1 3'UTR, but had no significant effect on the mutant, demonstrating that miR-92b-5p can directly bind to and inhibit the TIAM1 gene 3'UTR (see [link to documentation]). Figure 18 ).

[0069] Secondly, a circ-GPEM dual-fluorescent reporter vector was constructed: a fragment containing the miR-92b-5p binding site in the circ-GPEM sequence was selected and ligated into the reporter vector, with a mutation control also included. The miR-92b-5p mimic was co-transfected with wild-type or mutant circ-GPEM reporter vectors. The results showed that miR-92b-5p significantly reduced the fluorescence intensity of the wild-type reporter, while having no significant effect on the mutant. miR-92b-5p specifically inhibited the fluorescence activity of reporter genes containing the circ-GPEM sequence (see [link to relevant documentation]). Figure 23 ).

[0070] The results showed that there are direct binding sites for miR-92b-5p on circ-GPEM, and circ-GPEM can specifically "adsorb" miR-92b-5p. The existence and role of the ceRNA axis were further verified from both positive and negative perspectives: On the one hand, a miR-92b-5p inhibitor was added to circ-GPEM knockdown granulosa cells to observe whether it could salvage function. The results showed that cell proliferation and hormone levels decreased significantly in the circ-GPEM knockdown group alone; however, when miR-92b-5p was inhibited simultaneously, the above functional indicators partially recovered to near normal. This indicates that the adverse effects caused by circ-GPEM knockdown are largely due to the overactivity of miR-92b-5p, and inhibiting miR-92b-5p can counteract the effect of circ-GPEM deficiency. On the other hand, circ-GPEM was simultaneously overexpressed in miR-92b-5p overexpressing granulosa cells. The results showed that circ-GPEM could weaken the inhibitory effect of miR-92b-5p on cells, and cell proliferation rate and hormone production were significantly increased compared with miR-92b overexpression alone. Granulosa cells were simultaneously transfected with miR-92b-5p inhibitor and TIAM1 siRNA, and changes in cell proliferation and function were observed. The results showed that, compared with cells transfected with miR-92b-5p inhibitor alone, the proliferation activity of granulocytes was no longer increased after co-transfection with TIAM1 siRNA, and was close to that of the untreated control group. This indicates that interfering with TIAM1 can significantly reverse the proliferative effect of miR-92b-5p inhibitor (see [link to study]). Figure 19 Similarly, inhibiting miR-92b-5p alone significantly increased the secretion levels of E2 and P4 in granulocytes, while the increase in these hormone secretion was significantly weakened after combined interference with TIAM1 (see [link to relevant documentation]). Figure 20 ).

[0071] Based on bioinformatics predictions, the circ-GPEM molecule contains a miR-92b-5p binding site, suggesting that it may regulate downstream genes by sponging miR-92b-5p. Co-transfection recovery experiments were used to further elucidate the effects of the circ-GPEM / miR-92b-5p / TIAM1 regulatory axis on granulosa cells. Specifically, miR-92b-5p was added concurrently with circ-GPEM overexpression, and TIAM1 expression and cell phenotypic changes were observed.

[0072] The results showed that the increase in TIAM1 expression induced by circ-GPEM after co-transfection with miR-92b-5p was significantly attenuated, indicating that the upregulation of TIAM1 by circ-GPEM depends on the adsorption of miR-92b-5p (see [link to article]). Figure 24Functionally, the promoting effects of circ-GPEM on cell proliferation and hormone secretion were significantly inhibited when miR-92b-5p was simultaneously overexpressed: compared with overexpression of circ-GPEM alone, the introduction of miR-92b-5p no longer significantly increased cell proliferation (see [link to original text]). Figure 25 The increase in estradiol and progesterone levels was also significantly reduced (see [reference]). Figure 26 ).

[0073] In summary, both complementary experiments demonstrated that circ-GPEM regulates TIAM1 expression by binding to miR-92b-5p: when circ-GPEM is insufficient, the amount of free miR-92b-5p increases, leading to TIAM1 inhibition and decreased cell function; when circ-GPEM is excessive, it can adsorb most of miR-92b-5p, thereby relieving TIAM1 inhibition and upregulating it, and cell proliferation and secretion functions are enhanced accordingly.

[0074] In summary, the series of experiments in the above embodiments fully demonstrate that the promotion of porcine ovarian granulosa cell proliferation and steroid hormone synthesis by follicular fluid exosomes is a multi-molecular synergistic process, especially involving the non-coding RNA-mediated ceRNA regulatory mechanism.

[0075] Specifically, exosome-carrying signals lead to the upregulation of circ-GPEM circular RNA expression in granulosa cells. circ-GPEM, acting as a competitive endogenous RNA, binds to ssc-miR-92b-5p, weakening the inhibitory effect of miR-92b-5p on its target gene TIAM1, thereby upregulating TIAM1 gene expression. Increased TIAM1 production promotes granulosa cell proliferation, survival, and steroid hormone synthesis. Conversely, if miR-92b-5p is overexpressed or circ-GPEM is absent, TIAM1 is suppressed, and cell proliferation and function decline. This mechanism elucidates the molecular basis of how follicular fluid exosomes regulate granulosa cell fate through the circRNA / miRNA / gene axis.

[0076] Based on this discovery, the present invention provides several potential applications: First, it can directly utilize follicular fluid exosomes to prepare biological agents as additives to enhance the proliferation and hormone production of granulosa cells in vitro, which can then be applied to improve the in vitro culture environment of oocytes or enhance the reproductive performance of livestock; Second, it can develop new molecular intervention methods targeting the circ-GPEM / miR-92b-5p / TIAM1 axis, such as administering customized nucleic acid preparations (circ-GPEM mimics, miR-92b inhibitors, TIAM1 expression vectors, etc.) to regulate the function of granulosa cells.

[0077] All embodiments disclosed in this specification are supported by specific experimental data and can achieve the stated inventive objectives, meeting the requirements of exhaustive disclosure and full disclosure. The claims are based on these embodiments, covering the core innovative points of the invention and their equivalent variations, and have broad application prospects in the field.

[0078] The above description is merely a specific embodiment of this application, but the scope of protection of this application is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application. Therefore, the scope of protection of this application should be determined by the scope of the claims.

[0079] In conclusion, the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method of promoting proliferation of porcine ovarian granulosa cells, characterized by, The porcine follicular fluid exosomes are added to the porcine granulosa cell culture system to improve the proliferation activity of the granulosa cells at an effective concentration for a certain time.

2. The method of claim 1, wherein, The exosome treatment concentration is 10-150 µg / mL of protein amount, and the maximum improvement of the granulosa cell proliferation ability can be achieved by treating for 24 hours at this concentration.

3. The method according to claim 1 or 2, characterized in that, After the exosome treatment, the apoptosis rate of the granulosa cells is reduced, the cell survival rate is improved, and the secretion of steroid hormones by the granulosa cells is promoted, including the improvement of the estradiol level and the expression of the luteinizing hormone synthesis enzyme.

4. A method for promoting proliferation of porcine ovarian granulosa cells by regulating a circ-GPEM / ssc-miR-92b-5p / TIAM1 competitive endogenous RNA axis, characterized in that, The proliferation ability and steroid hormone synthesis function of the granulosa cells are enhanced by up-regulating the expression of circ-GPEM circular RNA or the TIAM1 gene, or inhibiting the function of ssc-miR-92b-5p microRNA to relieve the inhibition of TIAM1 expression by ssc-miR-92b-5p.

5. The method of claim 4, wherein, The method for up-regulating circ-GPEM is to introduce a circ-GPEM expression vector or synthesize a circ-GPEM circular RNA molecule into the granulosa cells, and the method for inhibiting ssc-miR-92b-5p is to introduce an antisense oligonucleotide, an antisense expression vector, or a chemically modified miR-92b-5p inhibitor complementary to miR-92b-5p into the granulosa cells to reduce the activity of endogenous miR-92b-5p.

6. The method according to claim 4 or 5, characterized in that, The opposite biological effects of the above-mentioned effects are verified by reducing the expression of circ-GPEM or overexpressing ssc-miR-92b-5p: reducing circ-GPEM or overexpressing miR-92b-5p will down-regulate the expression of the TIAM1 gene and inhibit the proliferation and steroid synthesis of granulosa cells, and up-regulating the expression of the TIAM1 gene can rescue or reverse the inhibitory effect.

7. A method of preparing porcine follicular fluid exosomes, characterized by, The method comprises the following steps: The collected porcine follicular fluid is subjected to gradient centrifugation to remove cells and debris, filtered through a 0.22 µm filter to remove impurities, and then subjected to ultracentrifugation to precipitate exosomes; the obtained exosomes are identified by observing the morphology of the exosomes under a transmission electron microscope, determining that the particle size distribution of the exosomes is in the range of 50-150 nm and the average particle size is about 120 nm by nanoparticle tracking analysis, and detecting the expression of exosome marker proteins by Western Blot to confirm that the separated particles meet the characteristics of exosomes.

8. A biological preparation for promoting proliferation of porcine ovarian granulosa cells, characterized by, The biological preparation comprises an effective dose of porcine follicular fluid exosomes and / or at least one functional nucleic acid molecule capable of regulating the function of target molecules in the circ-GPEM / ssc-miR-92b-5p / TIAM1 axis.

9. The biological preparation of claim 8, wherein, The functional nucleic acid molecule is selected from one or a combination of the following: a circ-GPEM circular RNA molecule, an expression vector capable of increasing the expression of circ-GPEM, an inhibitory oligonucleic acid against ssc-miR-92b-5p, an expression vector capable of reducing the expression of ssc-miR-92b-5p, an expression vector or mRNA of the TIAM1 gene, and an siRNA molecule against TIAM1 for inhibiting the overexpression of TIAM1 to reverse the abnormal proliferation of granulosa cells.

10. Use of a biological agent according to claim 8 or 9, characterized in that, An in vitro culture additive, a veterinary drug or a reproductive control agent for promoting proliferation of ovarian granulosa cells and / or enhancing steroid hormone synthesis. An in vitro culture additive, a veterinary drug or a reproductive control agent for promoting proliferation of ovarian granulosa cells and / or enhancing steroid hormone synthesis.

Images