siRNA for inhibiting XDH gene expression and its conjugate and application

By designing siRNA conjugates that specifically inhibit XDH gene expression, the treatment problem of gout is solved, and the effect of effectively reducing uric acid levels and reducing gout incidence is achieved.

CN119614575BActive Publication Date: 2025-08-29YOUJIA (HANGZHOU) BIOMEDICAL TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411958633.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-30
Publication Date
2025-08-29
Estimated Expiration
2044-12-30

AI Technical Summary

Technical Problem

Currently, there is a lack of effective treatment methods for gout. Existing drugs such as XDH inhibitors, URAT1 inhibitors and uric acid oxidase drugs are not suitable for goose, and commercial vaccines and conventional antibacterial and antiviral methods are ineffective, making gout caused by goose astrocyte infection difficult to control.

Method used

SiRNAs specifically inhibit XDH gene expression were designed and synthesized and modified by GalNAc to target liver delivery to form siRNA conjugates for the treatment of gout gout.

Benefits of technology

Effectively reduce the uric acid level of goose, significantly reduce the incidence of gout, and significantly reduce the blood uric acid concentration and urate deposition through a small number of doses, thereby improving the survival rate of goose.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119614575B_ABST
    Figure CN119614575B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of biomedicine, and in particular to siRNA and its conjugates and applications for inhibiting XDH gene expression, including a sense strand and an antisense strand, wherein the sense strand and / or the antisense strand have a length in the range of 19-25 nucleotides, and the antisense strand is reversely complementary to a segment on the target gene. The siRNA and siRNA conjugates provided by the present invention have a high inhibitory effect on goslings, and can well reduce the blood uric acid level of geese, greatly reducing the incidence of gout in goslings.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to an siRNA for inhibiting XDH gene expression, and a conjugate and application thereof. Background Art

[0002] RNA interference (RNAi) refers to a molecular biological phenomenon known as gene silencing induced by double-stranded RNA. Its mechanism is to inhibit gene expression by blocking the transcription or translation of specific genes. When double-stranded RNA homologous to the coding region of endogenous messenger RNA (mRNA) is introduced into cells, the mRNA is degraded, leading to gene silencing. Small interfering RNA (siRNA), 20-25 nt in length, can trigger RNAi and specifically downregulate or shut down the expression of specific genes. Due to its high efficiency, ease of synthesis, and ease of manipulation, this technology has been widely used to explore gene function and in gene therapy for infectious diseases and malignant tumors.

[0003] N-acetylgalactosamine (GalNAc) is a monosaccharide that recognizes sialoglycoprotein receptors, which are highly expressed in hepatocytes. Using GalNAc derivatives, such as divalent or trivalent branched linkers, attached to the 3' end of the siRNA sense strand can promote specific targeting of siRNA to liver tissue, thereby improving its bioavailability and reducing dosage and side effects.

[0004] Gout in goslings is primarily a metabolic disease caused by goose astrovirus, resulting in urate accumulation. In recent years, goose astrovirus infection has become widespread in goose-breeding regions across my country. Gooses that survive the infection experience weight loss, slow growth, and susceptibility to other pathogens. Currently, effective control remains unproven, resulting in significant economic losses for the goose industry. Goose astrovirus (GoAstV), a member of the genus Avian Astrovirus in the family Astroviridae, is a non-enveloped, single-stranded, positive-sense RNA virus with a genome size of approximately 8.0 kb. Infection can cause diarrheal enteritis, nephritis, and urate accumulation in goslings, making it a major cause of gout in goslings, with a mortality rate ranging from 20% to 50%.

[0005] Studies have shown that goslings are more susceptible to GoAstV, while adult geese often show latent infection. Initially, GoAstV infected only geese, but as it became widespread in my country, infection spread to Cherry Valley ducks, turnstones, and chickens. Viral shedding in the first few days after infection is proportional to time, peaking between 5 and 7 days after infection. Viral load then declines, and viral shedding can be detected for 15 days or even longer after infection. Symptoms of infection include depression, loss of appetite, white feces, swollen joints, and a tendency to lie down and not move. Pathological examinations reveal swollen and pale kidneys, an enlarged spleen, and urate deposits on the surface of the heart and liver, in the forebrain ventricles, in the joint cavity, and in the ureters. Goslings that survive this infection experience severely reduced growth performance.

[0006] Some studies have reported that egg yolk antibodies are effective in treating goose astrovirus infection, but are ineffective in treating goose astrovirus in the middle and late stages of the disease. The reason may be that the goose astrovirus has been cleared by the goose's immune system at this time, and egg yolk antibodies have no therapeutic effect on gout caused by infection.

[0007] Goose goat infection primarily causes gout attacks by increasing blood uric acid levels. Therefore, lowering uric acid levels can effectively alleviate gout symptoms and improve the survival rate of geese. Commonly used uric acid-lowering drugs include xanthine oxidase (XDH) inhibitors, urate anion transporter 1 (URAT1) inhibitors, and urate oxidase inhibitors.

[0008] XDH inhibitors include small molecules such as allopurinol and febuxostat. They work by inhibiting XDH enzyme activity, blocking the conversion of purine substrates to uric acid, thereby effectively lowering uric acid levels. However, these small molecule drugs have a short half-life and require daily administration to ensure a stable uric acid-lowering effect, making them unsuitable for disease control in commercial animals such as geese.

[0009] Benzbromarone is a commonly used URAT1 inhibitor. Benzbromarone inhibits uric acid reabsorption in the renal tubules, increasing uric acid excretion and lowering serum uric acid levels. Similar to small-molecule XDH inhibitors, daily dosing is required to maintain efficacy. Furthermore, benzbromarone has been reported to cause liver and kidney dysfunction.

[0010] Urate oxidase drugs include recombinant human urate oxidase (rasburicase) and recombinant non-mammalian urate oxidase (pegloticase). These drugs are primarily used to treat hyperuricemia crises or refractory hyperuricemia caused by chemotherapy and radiotherapy for malignant tumors. They are generally not used to treat chronic gout and are relatively expensive.

[0011] Currently, there is no targeted treatment for gout in geese. Conventional antibacterial and antiviral treatments are ineffective against goose astrovirus infection, and there is no commercially available vaccine to prevent it. Current uric acid-lowering medications used in humans are not suitable for treating geese, necessitating the development of effective medications specifically targeting gout. Summary of the Invention

[0012] The present invention designs corresponding siRNAs targeting XDH, and their modified sequences, as well as applications in treating goose gout.

[0013] The first technical solution of the present invention discloses an siRNA for inhibiting the expression of the XDH gene, comprising a sense chain and an antisense chain, wherein the sense chain and the antisense chain are at least partially reverse-complementary to form a double-stranded region, and the siRNA is used as a drug for treating gout, and the siRNA is any one of the following (1) to (10):

[0014] (1) The sense strand is CCCUCAGCUUCUUCUUCAANn (SEQ ID NO: 51), and the antisense strand is UUGAAGAAGAAGCUGAGGGNn (SEQ ID NO: 61);

[0015] (2) The sense strand is GCUUCUUCUUCAAAUUCUANn (SEQ ID NO: 52), and the antisense strand is UAGAAUUUGAAGAAGAAGCNn (SEQ ID NO: 62);

[0016] (3) The sense strand is GGACUAUAAUGAAAAAAAANn (SEQ ID NO: 53), and the antisense strand is UUUUUUUUUCAUUAUAGUCCNn (SEQ ID NO: 63);

[0017] (4) The sense strand is GACUAUAAUGAAAAAAAAANn (SEQ ID NO: 54), and the antisense strand is UUUUUUUUUUCAUUAUAGUCNn (SEQ ID NO: 64);

[0018] (5) The sense strand is GGCAAUAUGUUAAAAAAAANn (SEQ ID NO: 55), and the antisense strand is UUUUUUUUAACAUAUUGCCNn (SEQ ID NO: 65);

[0019] (6) The sense strand is GCAAUAUGUUAAAAAAAAANn (SEQ ID NO: 56), and the antisense strand is UUUUUUUUUAACAUAUUGCNn (SEQ ID NO: 66);

[0020] (7) The sense strand is GGGAGUGAUAUAAAAUCAANn (SEQ ID NO: 57), and the antisense strand is UUGAUUUUAUAUCACUCCCNn (SEQ ID NO: 67);

[0021] (8) The sense strand is GGAGACCAAUGGAAAUUUANn (SEQ ID NO: 58), and the antisense strand is UAAAUUUCCAUUGGUCUCCNn (SEQ ID NO: 68);

[0022] (9) The sense strand is GGAACUAAGUGUCAGAUAANn (SEQ ID NO: 59), and the antisense strand is UUAUCUGACACUUAGUUCCNn (SEQ ID NO: 69);

[0023] (10) The sense strand is GCAAAAUAAAACUAAAAAANn (SEQ ID NO: 60), and the antisense strand is UUUUUUAGUUUUUAUUUUGCNn (SEQ ID NO: 70);

[0024] Wherein, N is any one of G, U, A, C, T, dG, dU, dA, dC, and dT; n is the number of N, and n is an integer from 0 to 3.

[0025] Furthermore, the N is any one of G, U, A, and C, and the n is 2.

[0026] Furthermore, the n is 0.

[0027] When n is 0, the siRNA is any one of the following (1) to (10):

[0028] (1) The sense strand is CCCUCAGCUUCUUCUUCAA (SEQ ID NO: 71), and the antisense strand is UUGAAGAAGAAGCUGAGGG (SEQ ID NO: 81);

[0029] (2) The sense strand is GCUUCUUCUUCAAAUUCUA (SEQ ID NO: 72), and the antisense strand is UAGAAUUUGAAGAAGAAGC (SEQ ID NO: 82);

[0030] (3) The sense strand is GGACUAUAAUGAAAAAAAA (SEQ ID NO: 73), and the antisense strand is UUUUUUUUUCAUUAUAGUCC (SEQ ID NO: 83);

[0031] (4) The sense strand is GACUAUAAUGAAAAAAAAA (SEQ ID NO: 74), and the antisense strand is UUUUUUUUUUCAUUAUAGUC (SEQ ID NO: 84);

[0032] (5) The sense strand is GGCAAUAUGUUAAAAAAAA (SEQ ID NO: 75), and the antisense strand is UUUUUUUUAACAUAUUGCC (SEQ ID NO: 85);

[0033] (6) The sense strand is GCAAUAUGUUAAAAAAAAA (SEQ ID NO: 76), and the antisense strand is UUUUUUUUUAACAUAUUGC (SEQ ID NO: 86);

[0034] (7) The sense strand is GGGAGUGAUAUAAAAUCAA (SEQ ID NO: 77), and the antisense strand is UUGAUUUUAUAUCACUCCC (SEQ ID NO: 87);

[0035] (8) The sense strand is GGAGACCAAUGGAAAUUUA (SEQ ID NO: 78), and the antisense strand is UAAAUUUCCAUUGGUCUCC (SEQ ID NO: 88);

[0036] (9) The sense strand is GGAACUAAGUGUCAGAUAA (SEQ ID NO: 79), and the antisense strand is UUAUCUGACACUUAGUUCC (SEQ ID NO: 89);

[0037] (10) The positive strand is GCAAAAUAAAACUAAAAAA (SEQ ID NO: 80), and the antisense strand is UUUUUUAGUUUUAUUUUGC (SEQ ID NO: 90).

[0038] Furthermore, combinations of two Ns include GU, UG, UA, AU, CC, CU, AA, AG, CA, GG, and CG. The resulting siRNAs are shown in Table 1.

[0039] Furthermore, the siRNA is selected from YJV-001-1842, YJV-001-1850, YJV-001-4377, YJV-001-5818, YJV-001-5819, and YJV-001-7500.

[0040] Furthermore, at least one nucleotide in the siRNA is modified; the modified nucleotide is selected from one or more of a modified sugar moiety at the 2' position, or a phosphate group containing a modified group, or a nucleotide analog.

[0041] Furthermore, the nucleotide with a modified sugar moiety at the 2' position includes a 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-O-dimethylaminoethoxyethyl (2'-O-DMAEOE) or 2'-O-N-methylacetamido (2'-O-NMA) modified nucleotide.

[0042] Furthermore, the phosphate group containing a modified group is specifically a thiophosphate group formed by replacing at least one oxygen atom in the phosphodiester bond with a sulfur atom.

[0043] Furthermore, the nucleotide analogue is selected from one of isonucleotides, LNA, ENA, cEt BNA, UNA or GNA.

[0044] Furthermore, the structures of the sense strands of the modified siRNA molecules are shown in SEQ ID NOs: 21 to 30; and the structures of the antisense strands of the modified siRNA molecules are shown in SEQ ID NOs: 31 to 40.

[0045] The second technical solution of the present invention discloses that the siRNA conjugate contains any of the siRNAs described above and a ligand conjugated to the siRNA, wherein the ligand includes GalNAc, cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, and N-acetylglucosamine derivatives or analogs.

[0046] Furthermore, the siRNA conjugate conjugated with the ligand is selected from Table 3, which can help siRNA be delivered to the target organ or tissue and enter the cell, including monoclonal antibodies, bispecific antibodies, monosaccharides, polysaccharides, cationic polymers, etc.

[0047] Among them, the ligand is L96, and the structural formula of L96 is as follows:

[0048]

[0049] The third technical solution of the present invention discloses a biomaterial, which is any of the following:

[0050] 1) A vector containing the siRNA described in the first technical solution or the siRNA conjugate described in the second technical solution;

[0051] 2) A reagent or kit containing the siRNA described in the first technical solution or the siRNA conjugate described in the second solution or the vector described in 1);

[0052] 3) A pharmaceutical composition, consisting of the siRNA molecule described in the first technical solution or the siRNA conjugate described in the second technical solution and other pharmaceutically acceptable components.

[0053] The pharmaceutically acceptable other components include, but are not limited to, water, saline, pH buffer, protective agent, osmotic pressure regulator, excipient, diluent, disintegrant, binder, lubricant, sweetener, preservative, or a combination thereof. The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose.

[0054] The above-mentioned carriers include, but are not limited to, magnetic nanoparticles (such as Fe2O3), carbon nanotubes, mesoporous silica, calcium phosphate nanoparticles, polyethyleneimine, polyamidoamine dendrimers, polylysine, chitosan, poly D- or L-lactic acid / glycolic acid copolymers, poly (aminoethyl ethylene phosphate) and poly methacrylate-N,N-dimethylaminoethyl ester and one or more of their derivatives.

[0055] The pharmaceutical composition can be in the form of a liquid preparation (e.g., an injection) or a lyophilized powder injection. The lyophilized powder injection is mixed with a liquid excipient to form a liquid preparation for administration. The liquid preparation can be administered, but is not limited to, by subcutaneous, intramuscular, or intravenous injection. It can also be administered via spray to the lungs, or via spray to other organs (e.g., the liver).

[0056] The siRNA, siRNA conjugate, related biological materials and pharmaceutical composition of the present invention are used for treating goose gout.

[0057] Beneficial effects:

[0058] The siRNA of the present invention is coupled to GalNAc to effectively deliver the siRNA to the liver, interfere with the XDH mRNA in the liver, effectively reduce the expression of XDH protein, reduce the synthesis of uric acid, and thus play a role in treating gout in geese. In addition, the incidence of gout in geese from hatching to slaughter can be reduced with very few administrations. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 Figure 2 is a graph showing the blood uric acid levels in geese after drug administration.

[0060] Figure 2 This is the result chart of gout incidence in geese after drug administration.

[0061] Figure 3 The diagram shows the urate deposition outside the cardiac pericardium of diseased and healthy geese. DETAILED DESCRIPTION

[0062] The following describes preferred embodiments of the present invention. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0063] As used herein, the term "linked" when referring to a connection between two molecules means that the two molecules are connected by a covalent bond or the two molecules are associated via a non-covalent bond (eg, a hydrogen bond or an ionic bond).

[0064] "Oligonucleotides" as used herein are nucleotide sequences comprising 10-50 nucleotides or nucleotide base pairs. In some embodiments of the invention, the oligonucleotides have a nucleobase sequence that is at least partially complementary to a coding sequence in a target gene expressed in a cell. The nucleotides may optionally be modified. In some embodiments of the invention, after the oligonucleotides are delivered to cells expressing a gene, the oligonucleotides are capable of inhibiting or blocking gene expression in vitro or in vivo.

[0065] As used herein, the term "inhibit" refers to a decrease in gene expression when the cell, cell population, or tissue is treated with the siRNA, pharmaceutical composition, or siRNA conjugate of the present invention, compared to cells, cell populations, or tissues that have not been treated.

[0066] The term "inhibit" as used herein is interchangeable with "reduce," "silence," "downregulate," "suppress," and other similar terms, and includes any level of inhibition. Preferably, inhibition includes statistically significant inhibition or clinically significant inhibition.

[0067] Each nucleotide in the sense strand and the antisense strand is independently a modified or unmodified nucleotide. In the context of the present invention, unless otherwise specified, "conjugation" refers to the covalent linkage of two or more chemical moieties, each with a specific function, to each other, also referred to as "coupling"; accordingly, "conjugate" refers to a compound formed by covalent linkage of these chemical moieties, also referred to as a "conjugate". Furthermore, "siRNA conjugate" refers to a compound formed by covalently linking one or more chemical moieties with a specific function to siRNA, also referred to as an "siRNA conjugate".

[0068] In the above and below, unless otherwise specified, generally, "G", "C", "A", "T" and "U" represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively. However, it should be understood that the term "ribonucleotide" or "nucleotide" may also refer to modified nucleotides, nucleotide analogs (surrogate replacement moieties) as further described below.

[0069] In the context of the present invention, the terms "complementary" and "reverse complement" are used interchangeably and have the meanings known to those skilled in the art, namely, that in a double-stranded nucleic acid molecule, the bases of one strand pair with bases on the other strand in a complementary manner. In DNA, the purine base adenine (A) consistently pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) consistently pairs with the pyrimidine base cytosine (G). Each base pair consists of a purine and a pyrimidine. When adenine on one strand consistently pairs with thymine (or uracil) on the other strand, and guanine consistently pairs with cytosine, the two strands are considered complementary to each other, and the sequence of that strand can be inferred from the sequence of its complementary strand. Accordingly, "mismatch," as used in the art, refers to the absence of a complementary pairing of bases at corresponding positions in a double-stranded nucleic acid.

[0070] In the above and below, unless otherwise specified, "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially reverse complementary" means that there are no more than 1 base mismatch between the two nucleotide sequences; and "completely reverse complementary" means that there are no base mismatches between the two nucleotide sequences. In the above and below, the existence of a "nucleotide difference" between one nucleotide sequence and another nucleotide sequence means that the base type of the nucleotide at the same position in the former is changed compared to the latter. For example, when a nucleotide base in the latter is A, the corresponding nucleotide base at the same position in the former is U, C, G or T, and it is determined that there is a nucleotide difference at that position between the two nucleotide sequences. In some embodiments, when a nucleotide at the original position is replaced by an abasic nucleotide or its equivalent, it can also be considered that a nucleotide difference has occurred at that position.

[0071] The experimental techniques and methods used in this example are conventional unless otherwise specified. For example, in the following examples, where specific conditions are not specified, conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) or the conditions recommended by the manufacturer are generally followed. Materials and reagents used in the examples were obtained through commercial channels unless otherwise specified.

[0072] A set of siRNAs targeting the XDH gene (NCBI RefSeq ID XM_048078421.2; NCBI Gene ID: 106031596) was designed based on the transcriptome sequence, including 10 pairs of unmodified siRNAs, as shown in Table 1. The siRNAs in Table 1 were further modified, as shown in Table 2. The modified siRNAs were further conjugated to ligands to obtain conjugates, as shown in Table 3.

[0073] Table 1

[0074] Name SEQ ID NO: siXDH sense strand sequence (5'-3') SEQ ID NO: siXDH antisense strand sequence (5'-3') Position in XM_048078421.2 YJV-001-1842 1 CCCUCAGCUUCUUCUUCAAGU 11 UUGAAGAAGAAGCUGAGGGUG 1842 YJV-001-1850 2 GCUUCUUCUUCAAAUUCUACC 12 UAGAAUUUGAAGAAGAAGCUG 1850 YJV-001-4377 3 GGACUAUAAUGAAAAAAAAAA 13 UUUUUUUUCAUUAUAGUCCUA 4377 YJV-001-4378 4 GACUAUAAUGAAAAAAAAAAA 14 UUUUUUUUUCAUUAUAGUCCU 4378 YJV-001-5818 5 GGCAAUAUGUUAAAAAAAAAA 15 UUUUUUUUAACAUAUUGCCAG 5818 YJV-001-5819 6 GCAAUAUGUUAAAAAAAAAAA 16 UUUUUUUUUAACAUAUUGCCA 5819 YJV-001-6624 7 GGGAGUGAUAUAAAAUCAAGG 17 UUGAUUUUAUAUCACUCCCCG 6624 YJV-001-6699 8 GGAGACCAAUGGAAAUUUAUG 18 UAAAUUUCCAUUGGUCUCCAA 6699 YJV-001-6840 9 GGAACUAAGUGUCAGAUAACC 19 UUAUCUGACACUUAGUUCCAU 6840 YJV-001-7500 10 GCAAAAUAAAACUAAAAAAUA 20 UUUUUUAGUUUUAUUUUGCAA 7500

[0075] Table 2

[0076] Name SEQ IDNO: siXDH sense strand sequence (5'-3') SEQ IDNO: siXDH antisense strand sequence (5'-3') YJV-001-1842 m2 21 fC-s-mC-s-fC-mU-fC-mA-fG-fC-fU-mU-fC-mU-fU-mC-fU-mU-fC-mA-fA-mG-mU 31 [[ID= ​ 22 ​ 32 ​ ​ 23 fG-s-mG-s-fA-mC-fU-mA-fU-fA-fA-mU-fG-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA 33 mU-s-fU-s-mU-fU-mU-fU-mU-fU-mC-fA-mU-mU-mA-fU-mA-fG-mU-fC-mC-s-mU-s-mA YJV-001-4378 m2 24 fG-s-mA-s-fC-mU-fA-mU-fA-fA-fU-mG-fA-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA 34 mU-s-fU-s-mU-fU-mU-fU-mU-fU-mU-fC-mA-mU-mU-fA-mU-fA-mG-fU-mC-s-mC-s-mU YJV-001-5818 m2 25 fG-s-mG-s-fC-mA-fA-mU-fA-fU-fG-mU-fU-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA 35 mU-s-fU-s-mU-fU-mU-fU-mU-fU-mA-fA-mC-mA-mU-fA-mU-fU-mG-fC-mC-s-mA-s-mG YJV-001-5819 m2 26 fG-s-mC-s-fA-mA-fU-mA-fU-fG-fU-mU-fA-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA 36 mU-s-fU-s-mU-fU-mU-fU-fU-mU-fA-mA-mC-mA-fU-mA-fU-mU-fG-mC-s-mC-s-mA YJV-001-6624 m2 27 fG-s-mG-s-fG-mA-fG-mU-fG-fA-fU-mA-fU-mA-fA-mA-fA-mU-fC-mA-fA-mG-mG 37 mU-s-fU-s-mG-fA-mU-fU-mU-fU-mA-fU-mA-mU-mC-fA-mC-fU-mC-fC-mC-s-mC-s-mG YJV-001-6699 m2 28 fG-s-mG-s-fA-mG-fA-mC-fC-fA-fA-mU-fG-mG-fA-mA-fA-mU-fU-mU-fA-mU-mG 38 mU-s-fA-s-mA-fA-mU-fU-mU-fC-mC-fA-mU-mU-mG-fG-mU-fC-mU-fC-mC-s-mA-s-mA YJV-001-6840 m2 29 fG-s-mG-s-fA-mA-fC-mU-fA-fA-fG-mU-fG-mU-fC-mA-fG-mA-fU-mA-fA-mC-mC 39 mU-s-fU-s-mA-fU-mC-fU-mG-fA-mC-fA-mC-mU-mU-fA-mG-fU-mU-fC-mC-s-mA-s-mU YJV-001-7500 m2 30 fG-s-mC-s-fA-mA-fA-mA-fU-fA-fA-mA-fA-mC-fU-mA-fA-mA-fA-mA-fA-mU-mA 40 mU-s-fU-s-mU-fU-mU-fU-mA-fG-mU-fU-mU-mU-mA-fU-mU-fU-mU-fG-mC-s-mA-s-mA

[0077] Table 3

[0078] name SEQ ID NO: siXDH positive chain sequence (5'-3') SEQ ID NO: siXDH antisense strand sequence (5'-3') YJV-001-1842m2-L96 41 fC-s-mC-s-fC-mU-fC-mA-fG-fC-fU-mU-fC-mU-fU-mC-fU-mU-fC-mA-fA-mG-mU-L96 31 mU-s-fU-s-mG-fA-mA-fG-mA-fA-mG-fA-mA-mG-mC-fU-mG-fA-mG-fG-mG-s-mU-s-mG YJV-001-1850m2-L96 42 fG-s-mC-s-fU-mU-fC-mU-fU-fC-fU-mU-fC-mA-fA-mA-fU-mU-fC-mU-fA-mC-mC-L96 32 mU-s-fA-s-mG-fA-mA-fU-mU-fU-mG-fA-mA-mG-mA-fA-mG-fA-mA-fG-mC-s-mU-s-mG YJV-001-4377m2-L96 43 fG-s-mG-s-fA-mC-fU-mA-fU-fA-fA-mU-fG-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA-L96 33 mU-s-fU-s-mU-fU-mU-fU-mU-fU-mC-fA-mU-mU-mA-fU-mA-fG-mU-fC-mC-s-mU-s-mA YJV-001-4378m2-L96 44 fG-s-mA-s-fC-mU-fA-mU-fA-fA-fU-mG-fA-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA-L96 34 mU-s-fU-s-mU-fU-mU-fU-mU-fU-mU-fC-mA-mU-mU-fA-mU-fA-mG-fU-mC-s-mC-s-mU YJV-001-5818m2-L96 45 fG-s-mG-s-fC-mA-fA-mU-fA-fU-fG-mU-fU-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA-L96 35 mU-s-fU-s-mU-fU-mU-fU-mU-fU-mA-fA-mC-mA-mU-fA-mU-fU-mG-fC-mC-s-mA-s-mG YJV-001-5819m2-L96 46 fG-s-mC-s-fA-mA-fU-mA-fU-fG-fU-mU-fA-mA-fA-mA-fA-mA-fA-mA-fA-mA-mA-L96 36 mU-s-fU-s-mU-fU-mU-fU-mU-fU-mU-fA-mA-mC-mA-fU-mA-fU-mU-fG-mC-s-mC-s-mA YJV-001-6624m2-L96 47 fG-s-mG-s-fG-mA-fG-mU-fG-fA-fU-mA-fU-mA-fA-mA-fA-mU-fC-mA-fA-mG-mG-L96 37 mU-s-fU-s-mG-fA-mU-fU-mU-fU-mA-fU-mA-mU-mC-fA-mC-fU-mC-fC-mC-s-mC-s-mG YJV-001-6699m2-L96 48 fG-s-mG-s-fA-mG-fA-mC-fC-fA-fA-mU-fG-mG-fA-mA-fA-mU-fU-mU-fA-mU-mG-L96 38 mU-s-fA-s-mA-fA-mU-fU-mU-fC-mC-fA-mU-mU-mG-fG-mU-fC-mU-fC-mC-s-mA-s-mA YJV-001-6840m2-L96 49 fG-s-mG-s-fA-mA-fC-mU-fA-fA-fG-mU-fG-mU-fC-mA-fG-mA-fU-mA-fA-mC-mC-L96 39 mU-s-fU-s-mA-fU-mC-fU-mG-fA-mC-fA-mC-mU-mU-fA-mG-fU-mU-fC-mC-s-mA-s-mU YJV-001-7500m2-L96 50 fG-s-mC-s-fA-mA-fA-mA-fU-fA-fA-mA-fA-mC-fU-mA-fA-mA-fA-mA-fA-mU-mA-L96 40 mU-s-fU-s-mU-fU-mU-fU-mA-fG-mU-fU-mU-mU-mA-fU-mU-fU-mU-fG-mC-s-mA-s-mA

[0079] The abbreviations of nucleotide monomers in Tables 2 and 3 are shown in Table 4:

[0080] Table 4

[0081] Compact copy Nucleic acid A Adenum-3'-isoic acid fA 2'-Kishiroadenin-3'-Ikashi acid mA 2'-O-Carrobase-3'-saccharide s-mA 2'-O-Sulfuric acid s-fA 2'-Sulfuric acid C Sporax-3'-sho acid fC 2'-Kishirosorawaki-3'-Issho acid mC 2'-O-A-3'-acid s-mC 2'-O-methylcytidine-3'-phosphorothioate s-fC 2'-Fluorocytidine-3'-phosphorothioate G Guanosine 3'-phosphate fG 2'-Fluoroguanosine-3'-phosphate mG 2'-O-methylguanosine-3'-phosphate s-mG 2'-O-methylguanosine-3'-phosphorothioate s-fG 2'-Fluoroguanosine-3'-phosphorothioate U Uridine 3'-phosphate f 2'-Fluorouridine-3'-phosphate mU 2'-O-methyluridine-3'-phosphate s-mU 2'-O-methyluridine-3'-phosphorothioate s-fU 2'-Fluorouridine-3'-phosphorothioate

[0082] Example 2: Preparation of siRNA

[0083] All siRNA sequences used in Example 1 were synthesized by Suzhou Ouli Biopharmaceutical Technology Co., Ltd.

[0084] Example 3: Sequence knockdown effect screening

[0085] 1) The pharmacodynamic activity of the GalNAc-conjugated siRNAs targeting XDH listed in Table 3 was analyzed in goslings (1 week old) after intramuscular injection of siRNA:

[0086] Each GalNAc-conjugated siRNA was administered to each animal via a single intramuscular injection at a single dose concentration (3 mg / kg). Liver samples were collected seven days after dosing, and XDH mRNA levels in all samples were analyzed by RT-qPCR. Liver tissue was lysed using a lysis buffer (BioFlux) and extracted with chloroform (MREDA). After vortexing and mixing, the tissue was allowed to stand at room temperature for 2-3 minutes and then centrifuged. The supernatant was transferred to a well plate and combined with the binding buffer. Total RNA was extracted using an automated nucleic acid extraction instrument.

[0087] 2) Prepare the qPCR system on ice by adding 1 μL One SteP SYBR Green Mix, 10 μL 2*One SteP SYBR Green Mix, 0.4 μL gYJV-001 3P F, and 0.4 μL gYJV-001 3P R to each well. Dilute the total RNA from the liver tissue in 8.2 μL RNase-free deionized water and add it to the wells. Mix well and place the mixture in a qPCR instrument for reaction.

[0088] qPCR reaction conditions were as follows: 50°C for 15 min pre-denaturation, 95°C for 1 min, 95°C annealing for 15 s, and 60°C extension for 1 min, for 39 cycles.

[0089] PCR primers:

[0090] Target name Sequence (5'-3') XD gYJV-001 3P F GCCTACAACCCTCCAGGAAC (SEQ ID NO:91) XD gYJV-001 3P R TTTCAGCGATCCATGCTGGT (SEQ ID NO:92)

[0091] The screening results are shown in Table 5:

[0092] Table 5

[0093] sequence name Inhibition rate (%) STDEV YJV-001-1842 m2-L96 92.2 39.4 YJV-001-1850 m2-L96 84.6 2.0 YJV-001-4377 m2-L96 60.3 13.7 YJV-001-4378 m2-L96 45.4 3.1 YJV-001-5818 m2-L96 67.0 72.6 YJV-001-5819 m2-L96 73.3 1.0 YJV-001-6624 m2-L96 23.9 6.0 YJV-001-6699 m2-L96 16.4 19.7 YJV-001-6840 m2-L96 40.5 15.3 YJV-001-7500 m2-L96 55.5 62.8

[0094] As shown in Table 5 , among the 10 pairs of siRNA conjugates conjugated to L96, 6 pairs of sequences had an inhibition rate of more than half, among which YJV-001-1842 m2-L96 had the highest inhibition rate of 92%, and was therefore used in subsequent experiments.

[0095] Example 4: Effect of siRNA on lowering blood uric acid

[0096] 1) The effects of GalNAc-conjugated siRNA (YJV-001-1842 m2-L96) targeting XDH on serum uric acid levels were analyzed in goslings after subcutaneous injection of siRNA.

[0097] 2) Twenty one-week-old goslings were enrolled, and 10 were randomly selected to receive a single intramuscular injection of 0.1 mg / goose. The blood uric acid levels of the geese were measured 7 days after administration.

[0098] The results are as follows Figure 1 As shown, the blood uric acid concentration of geese in the control group was 62.48 μg / mL, while that in the drug-treated group was 48.45 μg / mL, indicating that the siRNA conjugate can significantly reduce the blood uric acid level in geese.

[0099] Example 5: Therapeutic effect on the incidence of gout in goose

[0100] 1) We investigated the inhibitory effect of a GalNAc-conjugated siRNA (YJV-001-1842 m2-L96) targeting XDH on the incidence of gout in goslings after subcutaneous injection of siRNA.

[0101] 2) Randomly select 1,000 goslings from 2,000 goslings that are one day old and give them the drug (0.1 mg / goose). Then, place them together with the rest of the goslings and count the number of goslings that develop gout within three weeks, and calculate the incidence of gout.

[0102] The results are as follows Figure 2 As shown, the incidence rate of geese in the control group was 21.6%, while that in the geese in the treatment group was only 4.5%, indicating that the XDH siRNA can significantly reduce the number of geese that become ill.

[0103] In addition, some diseased geese and geese that did not develop the disease after treatment were selected for autopsy. Figure 3 As shown, obvious white urate deposits appeared outside the cardiac capsule of the diseased goose ( Figure 3 Left), while the viscera of the unaffected geese after treatment were normal ( Figure 3 Right), indicating that the drug can effectively treat goose gout.

[0104] The series of detailed descriptions listed above are merely specific illustrations of feasible embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Those skilled in the art may devise numerous other modifications and implementations that fall within the scope and spirit of the principles disclosed herein. More specifically, within the scope of the present disclosure, the drawings, and the claims, various variations and improvements may be made to the components and / or layout of the subject combination arrangement. In addition to variations and improvements to the components and / or layout, other uses will also be apparent to those skilled in the art.

Claims

1. An siRNA for inhibiting XDH gene expression, characterized in that: The invention comprises a sense chain and an antisense chain, wherein the sense chain and the antisense chain are at least partially reverse-complementary to form a double-stranded region. The siRNA is used in a drug for treating gout. The nucleotide sequence of the sense chain is fC-s-mC-s-fC-mU-fC-mA-fG-fC-fU-mU-fC-mU-fU-mC-fU-mU-fC-mA-fA-mG-mU (SEQ ID NO: 21), and the nucleotide sequence of the antisense chain is mU-s-fU-s-mG-fA-mA-fG-mA-fA-mG-fA-mA-mG-mC-fU-mG-fA-mG-fG-mG-s-mU-s-mG (SEQ ID NO: 31).

2. A siRNA conjugate, characterized in that The siRNA conjugate contains the siRNA according to claim 1 and a ligand conjugated to the siRNA, wherein the ligand comprises GalNAc, cholesterol, biotin, vitamins, galactose, lactose, and N-acetylglucosamine.

3. A biomaterial, any of the following: 1) A vector containing the siRNA according to claim 1 or the siRNA conjugate according to claim 2; 2) A reagent or kit comprising the siRNA according to claim 1 or the siRNA conjugate according to claim 2 or the vector according to 1); 3) A pharmaceutical composition, consisting of the siRNA molecule according to claim 1 or the siRNA conjugate according to claim 2 and other pharmaceutically acceptable components.

Citation Information

Patent Citations

  • RNAi Agents for Inhibiting Expression of Xanthine Dehydrogenase (XDH), Pharmaceutical Compositions Thereof, and Methods of Use

    US20230002773A1

  • Nucleic acids for inhibiting expression of XDH in a cell

    WO2022223557A1