Recombinant expression vector of human antibacterial peptide, engineering bacteria, construction method and application

Abstract

The invention relates to a recombinant expression vector of a human antibacterial peptide, an engineering bacterium, a construction method and application, and relates to the technical field of molecular biology. The structure of the recombinant expression vector is a pET28a-sfGFP-HRV3C tangency point-LL37, and the nucleotide sequence of the LL37 in the pET28a-sfGFP-HRV3Cp tangency point-LL37 is as shown in SED ID NO: 1, and the nucleotide sequence of the LL37 in the pET28a-sfGFP-HRV3Cp tangency point-LL37 is as shown in SED ID NO: 2. And the sfGFP in the pET28a-sfGFP-HRV3Cp tangency point-LL37 is the super-folded green fluorescent protein. The invention further discloses a preparation method of the super-folded green fluorescent protein. Compared with the prior art, an expression system with a fusion tag is designed by combining a fusion expression strategy and protein characteristics of LL37, so that soluble expression of LL37 in escherichia coli is promoted, and efficient production of target protein is realized; compared with an existing target protein obtaining mode, the method has the advantages that the protein expression quantity is increased by using sfGFP, and the method is more suitable for large-scale industrial application.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology technology, and in particular to a recombinant expression vector, an engineering bacterium, a construction method and an application of a human antimicrobial peptide. Background Art

[0002] LL37 is the only human antimicrobial peptide in the cathelicidin family. LL37 is named because its first two amino acids at the N-terminus are both leucine and it is composed of 37 amino acids in total. LL37 exists in the human body in the form of its inactive precursor hCAP-18 (humanCathelicidin Antimicrobial Peptide 18), which is stored in cytoplasmic granules and lamellar bodies. LL37 is located in the C-terminal domain of hCAP-18 and must be activated by kallikrein or proteolytic enzymes. Once cleaved, LL37 is further processed into a 37-amino acid polypeptide, which participates in immune responses as an important immune factor. The synthesis of LL37 is mainly seen in epithelial cells, and LL37 has also been shown to be present in macrophages, dendritic cells, natural killer cells, neutrophils, and mesenchymal stem cells.

[0003] LL37 has a broad spectrum of antibacterial activity and can kill bacteria through direct antibacterial activity or immunomodulation. Its main mechanism of action is membrane destruction. In addition, LL37 also has chemotaxis, promotes cell apoptosis, promotes skin and wound healing, and has anti-tumor effects, and is expected to become a new antimicrobial drug.

[0004] At present, the production of LL37 mainly relies on chemical synthesis, but its high cost and difficulty in meeting large-scale production seriously restrict its industrial application. Therefore, it is urgent to develop a method for efficient expression. In view of this, the present invention provides a recombinant expression vector, an engineered bacterium, a construction method and an application of a human antimicrobial peptide. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a recombinant expression vector, an engineering bacterium, a construction method and an application of a human antimicrobial peptide, with the purpose of promoting heterologous expression of LL37 antimicrobial peptide to save production time and industrial costs.

[0006] The technical solution of the present invention to solve the above technical problems is as follows:

[0007] In the first aspect, a recombinant expression vector of a human antimicrobial peptide, the structure of the recombinant expression vector is pET28a-sfGFP-HRV3Cp cut point-LL37 (i.e., pET28a-sfGFP-HRV3C protease cut point-LL37), the nucleotide sequence of LL37 in the pET28a-sfGFP-HRV3Cp cut point-LL37 is shown in SED ID NO: 1; the sfGFP in the pET28a-sfGFP-HRV3Cp cut point-LL37 is a superfolded green fluorescent protein.

[0008] Based on the above technical solution, the present invention can also be improved as follows.

[0009] Further, the sfGFP in the pET28a-sfGFP-HRV3Cp cut point-LL37 includes sfGFP (-7) sfGFP (-15) sfGFP (-30) sfGFP (-39) At least one of;

[0010] The sfGFP (-7) The nucleotide sequence of sfGFP is shown in SED ID NO: 2; (-15) The nucleotide sequence of sfGFP is shown in SED ID NO: 3; (-30) The nucleotide sequence of sfGFP is shown in SED ID NO: 4; (-39) The nucleotide sequence is shown in SED ID NO: 5;

[0011] In the pET28a-sfGFP-HRV3Cp cleavage point-LL37, there is a cleavage point of HRV3C protease between sfGFP and LL37. The nucleotide sequence of the cleavage point of HRV3C protease is shown in SED ID NO:6.

[0012] The pET28a-sfGFP-HRV3Cp cut point-LL37 includes pET28a-sfGFP (-7) -HRV3Cp cut point-LL37, pET28a-sfGFP (-15) -HRV3Cp cut point-LL37, pET28a-sfGFP (-30) -HRV3Cp cut point-LL37, pET28a-sfGFP (-39) -HRV3Cp cut point-Any one of LL37.

[0013] In a second aspect, a method for constructing a recombinant expression vector of a human antimicrobial peptide comprises the following steps:

[0014] (1) obtaining a sfGFP lytic tag gene fragment and a HRV3Cp cut point-LL37 gene fragment through two rounds of polymerase chain reaction; the HRV3Cp cut point-LL37 gene fragment is obtained by the first round of PCR amplification, and the sfGFP lytic tag gene fragment is obtained by the second round of PCR amplification;

[0015] (2) The LL37 gene fragment was cloned into the NdeⅠ and EcoRⅠ restriction sites of pET28a by ligation PCR to form a recombinant vector pET28a-HRV3Cp cut point-LL37; the sfGFP soluble tag gene fragment was cloned into the NdeⅠ linearized recombinant vector pET28a-HRV3Cp cut point-LL37 by homologous recombination, and the recombinant vector pET28a-sfGFP-HRV3Cp cut point-LL37 was obtained after sequencing verification.

[0016] For the two rounds of polymerase chain reaction, the PCR reaction system was: 2×Phanta Flash Master Mix, 10 μL; Primer F (10 μM), 1 μL; Primer R (10 μM), 1 μL; Sterile water, 7.5 μL; Template, 0.5 μL.

[0017] For the two rounds of polymerase chain reaction, the reaction program of PCR amplification is: 94°C, 30s; 98°C, 10s; 55°C, 5s; 72°C, 5s, 30 cycles; 72°C, 5min; 12°C, 5min.

[0018] For example, sfGFP was obtained by two rounds of PCR amplification. (-15) -HRV3Cp cutting point-LL37 fragment, wherein the first round of PCR amplification obtains the HRV3Cp cutting point-LL37 fragment, and the amplification primers are: the nucleotide sequence of LL37-F is shown in SED ID NO: 7; the nucleotide sequence of LL37-R is shown in SED ID NO: 8;

[0019] The second round of PCR amplification yielded sfGFP (-15) The soluble tag gene fragment, the amplification primers are: the nucleotide sequence of sfGFP-F is shown in SED ID NO: 9; the nucleotide sequence of sfGFP-R is shown in SED ID NO: 10.

[0020] In a third aspect, a genetically engineered bacterium expressing a human antimicrobial peptide, wherein the genetically engineered bacterium contains a recombinant expression vector of the human antimicrobial peptide.

[0021] In a fourth aspect, a method for constructing a genetically engineered bacterium expressing a human antimicrobial peptide comprises the following steps: transferring the recombinant expression vector of the human antimicrobial peptide into a cloning strain, selecting and sequencing transformants to obtain a correctly sequenced recombinant vector pET28a-sfGFP-HRV3Cp cut point-LL37; transferring the correctly sequenced recombinant vector pET28a-sfGFP-HRV3Cp cut point-LL37 into an expression strain, screening with a Kana antibiotic plate, and obtaining a genetically engineered bacterium expressing LL37.

[0022] Furthermore, the cloning strain is Escherichia coli DH5α; and the expression strain is Escherichia coli BL21 (DE3).

[0023] In a fifth aspect, the application of genetically engineered bacteria expressing human antimicrobial peptides is to use the genetically engineered bacteria expressing human antimicrobial peptides to prepare LL37 antimicrobial peptides.

[0024] In a sixth aspect, a method for promoting heterologous expression of LL37 antimicrobial peptide comprises the following steps: expanding the genetically engineered bacteria expressing the human antimicrobial peptide in a culture medium to a logarithmic growth phase, adding IPTG to the culture medium to a final concentration of 0.1 mM-0.5 mM, inducing culture at 18°C-37°C for 3h-20h, and obtaining a fusion protein containing the LL37 antimicrobial peptide.

[0025] Further, the fusion protein containing the LL37 antimicrobial peptide is digested with HRV3C protease to obtain the LL37 antimicrobial peptide. Specifically, the digestion is performed according to the digestion system (volume ratio): fusion protein containing the LL37 antimicrobial peptide: HRV3C protease: 100mM DTT = 89:10:1, and the digestion system is reacted at 4°C for 2h.

[0026] The present invention uses superfolder green fluorescent protein (sfGFP) to construct a recombinant vector capable of expressing LL37 based on the commercial vector pET28a; and the expression vector is transferred into Escherichia coli to obtain a genetically engineered bacterium expressing human antimicrobial peptides. The present invention also found that sfGFP (-15) Compared to sfGFP (-7) , sfGFP (-30) , sfGFP (-39) The expression effect is better. The recombinant expression vector pET28a-sfGFP was studied in detail. (-15) -HRV3Cp cleavage site-LL37, found the recombinant expression vector pET28a-sfGFP (-15) The expression level of -HRV3Cp cut point-LL37 was significantly increased under the conditions of 18°C ​​and IPTG final concentration of 0.2mM for 20h.

[0027] The beneficial effects of the present invention are as follows: compared with the prior art, the present invention combines the fusion expression strategy with the inherent characteristics of the LL37 protein, designs an expression system with a fusion tag, promotes the soluble expression of LL37 in Escherichia coli, and realizes the efficient production of the target protein. Compared with the existing method of obtaining the target protein, the present invention increases the expression amount of the protein by using sfGFP, and is more suitable for large-scale industrial applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Schematic diagram of the gene structure inserted into the fusion expression plasmid of the present invention;

[0029] Figure 2 Different lytic tag sfGFP of the present invention (-7) sfGFP (-15) sfGFP (-30) sfGFP (-39) SDS-PAGE detection diagram of the effect on LL37 expression; the arrows indicate the size and position of the fusion protein, and M represents Marker;

[0030] Figure 3 The SDS-PAGE detection diagram of the effect of adding different IPTG concentrations on the expression amount of the target protein of the present invention;

[0031] Figure 4 This is an SDS-PAGE detection diagram of the effects of different induction temperatures and times on the expression amount of the target protein when the final concentration of IPTG is 0.2 mM in the present invention;

[0032] Figure 5 The SDS-PAGE detection diagram of 12% separation gel after 0h, 2h, 5h, 8h, and 10h of enzyme digestion with HRV3C protease of the present invention;

[0033] Figure 6 This is a SDS-PAGE detection diagram of a 20% precast gel digested with HRV3C protease for 2h, 5h, 8h, and 10h. DETAILED DESCRIPTION

[0034] The principles and features of the present invention are described below, and the examples are only used to explain the present invention and are not used to limit the scope of the present invention. If no specific technology or conditions are specified in the embodiments, the technology or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased through regular channels.

[0035] Example

[0036] 1. Construction of recombinant expression vector of human antimicrobial peptide.

[0037] The present invention utilizes a solubility-promoting protein tag sfGFP that promotes protein soluble expression (-7) (SED ID NO: 2), sfGFP (-15) (SED ID NO: 3), sfGFP (-30) (SED ID NO: 4), sfGFP (-39) (SED ID NO: 5), promoting the expression of antimicrobial peptide LL37 in Escherichia coli.

[0038] The method for constructing a recombinant expression vector of a human antimicrobial peptide involved in this embodiment comprises the following steps:

[0039] (1) obtaining the sfGFP lytic tag gene fragment and the HRV3Cp cut point-LL37 gene fragment through two rounds of polymerase chain reaction; the HRV3Cp cut point-LL37 gene fragment (SED ID NO: 1) was obtained by the first round of PCR amplification, and the sfGFP lytic tag gene fragment was obtained by the second round of PCR amplification;

[0040] (2) The HRV3Cp cut point-LL37 gene fragment was cloned into the NdeⅠ (purchased from NEB) and EcoRⅠ enzyme (purchased from NEB) cut sites of pET28a (from Wuhan Jinkairui Biotechnology Co., Ltd.) by ligation PCR to form a recombinant vector pET28a-HRV3Cp cut point-LL37; the sfGFP lytic tag gene fragment was cloned into the NdeⅠ (purchased from NEB) linearized recombinant vector pET28a-HRV3Cp cut point-LL37 by homologous recombination, and the recombinant vector pET28a-sfGFP-HRV3Cp cut point-LL37 was obtained after sequencing verification.

[0041] like Figure 1 As shown, including sfGFP (-7) Fusion tag recombinant expression vector pET28a-sfGFP (-7) -HRV3Cp cut point-LL37; contains sfGFP (-15) Fusion tag recombinant expression vector pET28a-sfGFP (-15) -HRV3Cp cut point-LL37; contains sfGFP (-30) Fusion tag recombinant expression vector pET28a-sfGFP (-30) -HRV3Cp cut point-LL37; contains sfGFP (-39) Fusion tag recombinant expression vector pET28a-sfGFP (-39)-HRV3Cp cut point -LL37.

[0042] There is a cleavage point of HRV3C protease between sfGFP and LL37 in the pET28a-sfGFP-HRV3Cp cleavage point-LL37, and the nucleotide sequence of the cleavage point of HRV3C protease is shown in SED ID NO:6.

[0043] Specifically, the recombinant expression vector pET28a-sfGFP of human antimicrobial peptide (-15) -HRV3Cp cut point-LL37 construction method, comprising the following steps:

[0044] ① Obtain sfGFP through two rounds of polymerase chain reaction (PCR) (-15) and HRV3Cp cut-point-LL37 fragment; the first round of PCR amplification obtained the HRV3Cp cut-point-LL37 gene fragment, and the second round of PCR amplification obtained sfGFP (-15) The soluble tag gene fragment, wherein the two rounds of PCR system are the same and the amplification procedure is the same;

[0045] PCR reaction system: 2×Phanta Flash Master Mix, 10 μL; Primer F (10 μM), 1 μL; Primer R (10 μM), 1 μL; Sterile water, 7.5 μL; Template, 0.5 μL

[0046] PCR amplification program: 94°C, 30 s; 98°C, 10 s; 55°C, 5 s; 72°C, 5 s, 30 cycles; 72°C, 5 min; 12°C, 5 min;

[0047] The first round of PCR amplification obtained the HRV3Cp cut point-LL37 fragment, and the amplification primers were:

[0048] LL37-F:TTAGAAGTTCTGTTCCAGGGCCCGCTGCTGGGCGATTTCTTCCG (SED ID NO: 7);

[0049] LL37-R:GTGGTGGTGGTGGTGGTGCTCGAGTGCGGCCGCAAGCTTGTCG (SED ID NO: 8);

[0050] The second round of PCR amplification obtained the sfGFP soluble tag gene fragment, and the amplification primers were:

[0051] sfGFP-F:GTTTAACTTTAAGAAGGAGATATACCATGGGCAGCAGCCATCATCAT C (SED ID NO: 9);

[0052] sfGFP-R:CCCTGGAACAGAACTTCTAAACTGCCTTTATACAGTTCATCCATGCC CAGATC (SED IDNO: 10).

[0053] ②The HRV3Cp cut point-LL37 was cloned into the NdeⅠ and EcoRⅠ restriction sites of pET28a by ligation PCR to form a large fragment pET28a-HRV3Cp cut point-LL37 recombinant vector; sfGFP was cloned into the NdeⅠ linearized pET28a-HRV3Cp cut point-LL37 vector by homologous recombination, and the recombinant vector pET28a-sfGFP-HRV3Cp cut point-LL37 was obtained by sequencing verification, which was transformed into the competent Escherichia coli and the transformants were selected for sequencing verification.

[0054] For other tag expression vectors sfGFP (-7) , sfGFP (-30) , sfGFP (-39) The construction method is the same as the above-mentioned expression vector sfGFP-HRV3Cp cut point-LL37 except for the template used, and the primers used are also the same, so it will not be repeated.

[0055] 2. Construction of genetically engineered bacteria expressing human antimicrobial peptides and induced expression of LL37 protein in Escherichia coli.

[0056] The method for constructing a genetically engineered bacterium expressing a human antimicrobial peptide involved in this embodiment comprises the following steps: transferring the recombinant expression vector of the human antimicrobial peptide into a cloning strain, selecting transformants and sequencing them to obtain a correctly sequenced recombinant vector pET28a-sfGFP-HRV3Cp cut point-LL37; transferring the correctly sequenced recombinant vector pET28a-sfGFP-HRV3Cp cut point-LL37 into an expression strain, screening with a Kana antibiotic plate, and obtaining a genetically engineered bacterium expressing LL37.

[0057] Specifically, the steps include:

[0058] ① The constructed fusion recombinant expression vector pET28a-sfGFP (-7) -HRV3Cp cut point-LL37, pET28a-sfGFP (-15) -HRV3Cp cut point-LL37, pET28a-sfGFP (-30) -HRV3Cp cut point-LL37, pET28a-sfGFP (-39)-HRV3Cp cut point-LL37 were transformed into E. coli DH5α competent cells (purchased from Beijing Qingke Biotechnology Co., Ltd.). Transformation system: 1μL recombinant plasmid, 50μL DH5α, after mixing the system, place on ice for 30min, then water bath at 42℃ for 45s, place on ice for 3min, add 700μL SOC medium, incubate at 37℃ shaker for 1h, then spread on LB plate with Kana, and culture at 37℃ for 12h-16h.

[0059] ② Extract the plasmid and sequence it, transform the correctly sequenced recombinant vector pET28a-sfGFP-HRV3Cp cut point-LL37 into the expression strain Escherichia coli BL21 (DE3) (purchased from Beijing Qingke Biotechnology Co., Ltd.), screen it with Kana antibiotic plates, and obtain the genetically engineered bacteria expressing LL37.

[0060] The present embodiment relates to a method for promoting heterologous expression of LL37 antimicrobial peptide, comprising the following steps: expanding the genetically engineered bacteria expressing the human antimicrobial peptide in a culture medium to a logarithmic growth phase, adding IPTG (isopropyl-β-D-thiogalactoside) to the culture medium, inducing the culture, obtaining LL37 antimicrobial peptide, and obtaining the corresponding protein concentration.

[0061] Specifically, the steps include:

[0062] ① Inoculate a single colony (genetically engineered bacteria expressing LL37) into 5 mL of liquid LB medium, add kanamycin at a final concentration of 50 μg / mL, and culture at 37°C for 12-16 h. Inoculate into 100 mL of liquid LB medium at a 1% inoculum volume, add kanamycin at a final concentration of 50 μg / mL, and culture at 37°C until OD 600 When it reached 0.7-0.9, IPTG was added to a final concentration of 0.2 mM, and then the cells were transferred to 37 °C for low-temperature induction for 3 h;

[0063] ② After the expression of the recombinant expression strain is completed, the bacteria are collected by centrifugation at 4°C and 3800r / min for 10min, and the bacteria are resuspended in 20mL of bacterial lysis buffer. After ultrasonic disruption, centrifugation and filtering the supernatant with a 0.22μm filter membrane, purification begins. The target protein is purified using a Ni-NTA chromatography column (filler source: Ni-NTA Purose 6Fast Flow from Qianchun Biology). The target protein bound to the chromatography column is washed with a buffer containing 10mM and 40mM imidazole for 5 column volumes to remove non-specific binding proteins, and then eluted and collected in batches using a buffer containing 300mM imidazole (1mL each elution). Subsequently, the target protein obtained is desalted with a desalting buffer using a GE HiTrap Desalting column (PD-10Desalting Column: Cytiva Company Product Number: 17-0851-01), and 10μL of the sample is taken to detect the size of each protein using 12% SDS-PEAG gel.

[0064] Among them, liquid LB medium: 1% peptone, 0.5% yeast extract, 1% NaCl;

[0065] Lysis / desalting buffer: 50 mM Tris-HCl, 150 mM NaCl, adjusted to pH 8.

[0066] After SDS-PAGE detection, the results of various soluble tags promoting expression are as follows Figure 2 As shown, lanes 1 and 2 are the soluble tag sfGFP (-7) -HRV3Cp cut point-LL37 protein supernatant and purified samples; Lanes 3 and 4 are connected to the solubilizing tag sfGFP (-15) The supernatant and purified samples of the expressed LL37 protein; Lanes 5 and 6 are respectively connected with the solubilizing tag sfGFP (-30) The supernatant and purified samples of the expressed LL37 protein; Lanes 7 and 8 are respectively connected with the solubilizing tag sfGFP (-39) The supernatant and purified samples of the expressed LL37 protein. The results showed that all four lytic tags can promote the expression of the target protein, but the best one is the recombinant expression vector pET28a-sfGFP. (-15) -HRV3Cp cut point -LL37.

[0067] 3. Optimization of the induced expression and enzyme cleavage conditions of genetically engineered bacteria expressing human antimicrobial peptides.

[0068] 3.1 Effect of different IPTG concentrations on the expression level of the target protein.

[0069] The best fusion expression vector pET28a-sfGFP was added (-15)-HRV3Cp cut point-LL37 was used for condition optimization. A single colony was picked from the LK plate coated in the above method and inoculated into 5 mL of liquid LB medium. Kanamycin with a final concentration of 50 μg / mL was added and cultured at 37°C for 12 h-16 h. The colony was inoculated into 100 mL of liquid LB medium at a ratio of 1%, and kanamycin with a final concentration of 50 μg / mL was added. The culture was continued at 37°C until OD 600 When the concentration reached 0.6-0.9, different final concentrations of IPTG (0.1 mM, 0.2 mM and 0.5 mM) were added and the shake flask was placed in a shaker at 37°C to induce expression. The specific method was consistent with the above description.

[0070] The results are as follows Figure 3 As shown, lanes 1 and 2 are sfGFP expressed at an IPTG concentration of 0.1 mM. (-15) -HRV3Cp cut-point-LL37 protein supernatant and purified samples; Lanes 3 and 4 are sfGFP expressed at an IPTG concentration of 0.2 mM (-15) -HRV3Cp cut-point-LL37 protein supernatant and purified samples; Lanes 5 and 6 are sfGFP expressed at an IPTG concentration of 0.5 mM (-15) -HRV3Cp cut point-LL37 protein supernatant and purified samples. The results showed that the best expression effect was achieved when IPTG concentration was 0.2mM.

[0071] 3.2 Effects of different induction temperatures and times on the expression level of the target protein when the final IPTG concentration is 0.2 mM.

[0072] The best fusion expression vector pET28a-sfGFP was added (-15) -HRV3Cp cut point-LL37 was used for condition optimization. A single colony was picked from the LK plate coated in the above method and inoculated into 5 mL of liquid LB medium. Kanamycin with a final concentration of 50 μg / mL was added and cultured at 37°C for 12-16 h. The colony was inoculated into 100 mL of liquid LB medium at a ratio of 1%, and 50 μg / mL of kanamycin was added. The culture was continued at 37°C until OD 600 When the pH value reached 0.6-0.9, IPTG with a final concentration of 0.2 mM was added and the flask was placed in a shaker at different temperatures to induce expression. The specific method was consistent with the above description.

[0073] The results are as follows Figure 4 As shown, lanes 1 and 2 are respectively sfGFP expressed at 18°C ​​for 20h. (-15) -HRV3Cp cut point-LL37 protein supernatant and purified samples; Lanes 3 and 4 are sfGFP expressed at 18°C ​​for 20h. (-15)-HRV3Cp cut point-LL37 protein supernatant and purified samples; Lanes 5 and 6 are sfGFP expressed at 28°C for 6 hours (-15) -HRV3Cp cut point-LL37 protein supernatant and purified samples; Lanes 7 and 8 are sfGFP expressed at 37°C for 3h (-15) The supernatant and purified samples of HRV3Cp cut-point-LL37 protein. The results showed that the expression effect was best when the final concentration of IPTG was 0.2mM and induced for 20h at 18℃.

[0074] 3.3HRV3C protease cleavage optimization.

[0075] Take the sfGFP obtained above (-15) -HRV3Cp cleavage point-LL37 fusion protein was purified and desalted, and the HRV3C protease expressed and purified in this laboratory (purchased from Takara) was used for enzyme digestion, and samples were taken at 0h, 2h, 5h, and 8h respectively; the results are shown in Figure 5 The results showed that the optimal enzyme digestion time was 2 h. SDS-PAGE gel electrophoresis was performed using 20% ​​precast gel (purchased from Nanjing GenScript Biotechnology Co., Ltd.). Figure 6 The results showed that HRV3C protease successfully cut the fusion protein.

[0076] In summary, the present invention found that 4 fusion tags (sfGFP (-7) sfGFP (-15) sfGFP (-30) sfGFP (-39) ) all promoted the expression of LL37 in E. coli, but the best one was sfGFP (-15) ; and by pET28a-sfGFP (-15) -HRV3Cp cut point-LL37 induction conditions were optimized to find the optimal induction conditions; finally, HRV3C protease was used to cleave the fusion protein sfGFP (-15) -HRV3Cp cutting point-LL37 was used for enzyme digestion, and the optimal enzyme digestion time was found to be 2h.

[0077] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A recombinant expression vector of human antimicrobial peptide, characterized in that: The structure of the recombinant expression vector is pET28a-sfGFP-HRV3Cp cut point-LL37, the nucleotide sequence of LL37 in the pET28a-sfGFP-HRV3Cp cut point-LL37 is shown in SEDID NO: 1; the sfGFP in the pET28a-sfGFP-HRV3Cp cut point-LL37 is a superfolded green fluorescent protein.

2. The recombinant expression vector of human antimicrobial peptide according to claim 1, characterized in that: The sfGFP in pET28a-sfGFP-HRV3Cp cutting point-LL37 includes sfGFP (-7) sfGFP (-15) sfGFP (-30) sfGFP (-39) At least one of; The sfGFP (-7) The nucleotide sequence of sfGFP is shown in SED ID NO: 2; (-15) The nucleotide sequence of sfGFP is shown in SEDID NO: 3; (-30) The nucleotide sequence of sfGFP is shown in SED ID NO: 4; (-39) The nucleotide sequence is shown in SED ID NO: 5; In the pET28a-sfGFP-HRV3Cp cleavage point-LL37, there is a cleavage point of HRV3C protease between sfGFP and LL37. The nucleotide sequence of the cleavage point of HRV3C protease is shown in SED ID NO:

6.

3. The recombinant expression vector of human antimicrobial peptide according to claim 2, characterized in that: The pET28a-sfGFP-HRV3Cp cut point-LL37 includes pET28a-sfGFP (-7) -HRV3Cp cut point-LL37, pET28a-sfGFP (-15) -HRV3Cp cut point-LL37, pET28a-sfGFP (-30) -HRV3Cp cut point-LL37, pET28a-sfGFP (-39) -HRV3Cp cut point-Any one of LL37.

4. A method for constructing a recombinant expression vector of a human antimicrobial peptide according to any one of claims 1 to 3, characterized in that: The steps include: (1) obtaining a sfGFP lytic tag gene fragment and a HRV3Cp cut point-LL37 gene fragment through two rounds of polymerase chain reaction; the HRV3Cp cut point-LL37 gene fragment is obtained by the first round of PCR amplification, and the sfGFP lytic tag gene fragment is obtained by the second round of PCR amplification; (2) The HRV3Cp cut point-LL37 gene fragment was cloned into the NdeⅠ and EcoRⅠ restriction sites of pET28a by ligation PCR to form a recombinant vector pET28a-HRV3Cp cut point-LL37; the sfGFP soluble tag gene fragment was cloned into the NdeⅠ linearized recombinant vector pET28a-HRV3Cp cut point-LL37 by homologous recombination, and the recombinant vector pET28a-sfGFP-HRV3Cp cut point-LL37 was obtained after sequencing verification.

5. A genetically engineered bacterium expressing a human antimicrobial peptide, characterized in that: The genetically engineered bacteria contains the recombinant expression vector of the human antimicrobial peptide according to any one of claims 1 to 3.

6. A method for constructing a genetically engineered bacterium expressing a human antimicrobial peptide according to claim 5, characterized in that: The method comprises the following steps: transferring the recombinant expression vector of the human antimicrobial peptide into a cloning strain, selecting transformants and sequencing them to obtain a correctly sequenced recombinant vector pET28a-sfGFP-HRV3Cp cut point-LL37; transferring the correctly sequenced recombinant vector pET28a-sfGFP-HRV3Cp cut point-LL37 into an expression strain, screening with an antibiotic plate, and obtaining a genetically engineered bacterium expressing the fusion protein sfGFP-HRV3Cp cut point-LL37.

7. The method for constructing a genetically engineered bacterium expressing a human antimicrobial peptide according to claim 6, characterized in that: The cloning strain is Escherichia coli DH5α; the expression strain is Escherichia coli BL21 (DE3).

8. Use of genetically engineered bacteria expressing human antimicrobial peptides, characterized in that: The genetically engineered bacteria expressing the human antimicrobial peptide according to claim 5 are used to prepare the LL37 antimicrobial peptide.

9. A method for promoting heterologous expression of LL37 antimicrobial peptide, characterized in that: The method comprises the following specific steps: expanding and culturing the genetically engineered bacteria expressing the human antimicrobial peptide as claimed in claim 5 in a culture medium to a logarithmic growth phase, adding IPTG to the culture medium to a final concentration of 0.1 mM-0.5 mM, inducing and culturing at 18°C-37°C for 3h-20h, and obtaining a fusion protein containing the LL37 antimicrobial peptide.

10. A method for promoting heterologous expression of LL37 antimicrobial peptide according to claim 9, characterized in that: The fusion protein containing the LL37 antimicrobial peptide is enzymatically cleaved by HRV3C protease to obtain the LL37 antimicrobial peptide.

Images