An optimized NlovFz2-ω RNA editing system
By optimizing and transforming the amino acid and ωRNA backbone of the NlovFz2-ωRNA editing system, combined with exonuclease fusion, the problems of low cleavage activity of NlovFz2 and large size of the CRISPR/Cas system were solved, efficient gene editing and small AAV vector packaging were achieved, and the application of gene editing tools was expanded.
Patent Information
- Application Number
- CN202411627205.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-14
- Publication Date
- 2025-08-01
- Estimated Expiration
- 2044-11-14
AI Technical Summary
The existing NlovFz2-ωRNA editing system has low cleavage activity in eukaryotic cells, and the traditional CRISPR/Cas system has large proteins, making it difficult to effectively package in AAV vectors, limiting the application of gene editing.
By optimizing and modifying the NlovFz2 protein and ωRNA backbone, including amino acid site mutations and base deletion or replacement of the ωRNA backbone, combined with fusion exonucleases such as T5 exonuclease, the cleavage activity and efficiency of the editing system are improved.
It significantly improves gene editing efficiency, is suitable for biological breeding, gene therapy and biomedical research, and is small in size suitable for AAV vector packaging.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of gene editing, and relates to the modification and application of a TnpB-IS200 / IS605 transposon NlovFz2 gene editing system derived from eukaryotes. Background Art
[0002] RNA-guided nuclease systems recognize target sites through the complementarity between guide RNAs and target DNA sequences, and cleave genomic DNA to generate double-strand breaks. Such systems play important roles in prokaryotes and eukaryotes, such as the adaptive immune response to foreign genetic elements. In recent years, a new class of RNA-guided nuclease systems, OMEGA (Obligate Mobile Element Guided Activity), has been reported. The OMEGA system belongs to the IS200 / IS605 transposon family, and members of this family are widely present in bacteria, archaea, and even some eukaryotes. The genes carried by these transposons encode a series of enzymes, including RNA-guided DNA endonucleases. Such enzymes can recognize and cleave DNA through specific RNA molecules, thereby achieving the movement and integration of transposons, including TnpB, IscB, IsrB, and IshB nucleases derived from prokaryotes. Among them, TnpB is the ancestor of the eukaryote-derived Fanzor protein in the OMEGA family and is also the ancestor of the Cas12 protein in the CRISPR / Cas family.
[0003] Studies on the TnpB homolog Fanzor protein found in eukaryotes have shown that Fanzor also has an RuvC cleavage domain and has the ability to recognize target sites guided by ωRNA and cleave double-stranded genomic DNA. The identified Fanzor proteins are divided into two categories: (i) Fanzor1, which is related to eukaryotic transposons and exists in various eukaryotes; (ii) Fanzor2, which is related to IS607-like transposons and exists in double-stranded DNA (dsDNA) virus genomes.
[0004] Adeno-associated virus (AAV) is a currently commonly used effective and safe vector for gene therapy, and its maximum packaging capacity is 4.7 kb. The protein sizes of traditional nucleases such as SpCas9 and Cas12a are all above 1000 amino acids, which is not conducive to the packaging and delivery of a single AAV vector of the editing system. It often has to be split by an intein and separately packaged into two AAV vectors for delivery and function, thus greatly reducing its editing effect and limiting its application.
[0005] NlovFz2 is derived from the species "Percolozoa Naegleria lovaniensis" and belongs to a type of Fanzor2 protein. NlovFz2 possesses some advantages of the TnpB and Cas12 families. For example, it has the activity of cleaving double-stranded DNA; and the protein has a relatively small size (490 amino acids), showing the potential for being easily packaged in an AAV vector for gene editing therapy. However, research has shown that the known NlovFz2 protein has extremely low cleavage activity in eukaryotic cells. Currently, there are no reports on mutating NlovFz2 to improve its cleavage activity. Only the TnpB editing system constructed using the programmable nuclease LrTnpB with low homology to TnpB has been seen (see CN117737034A), but the characteristics of LrTnpB are quite different from those of TnpB.
[0006] In addition, CN118620868A provides an efficient base editing system based on the miniature CRISPR Cas protein IscB. This system is obtained by performing different point mutations on IscBn(D61A) and / or mutating ωRNA. However, in the case where the mutated IscBn(D61A) is not fusion-modified, the corresponding system has the limitation of low editing efficiency at some genomic sites (compared to other sites). Summary of the Invention
[0007] The object of the present invention is to provide an optimized NlovFz2-ωRNA editing system. By optimizing and modifying the NlovFz2 protein and the ωRNA structure in the existing gene editing system, the editing efficiency is improved, thereby expanding and enriching the "miniature" gene editing toolbox.
[0008] To achieve the above object, the present invention adopts the following technical solutions:
[0009] In the first aspect, there is provided an editing system guided by an optimized ωRNA to recognize a target site. This editing system includes a recombinant vector A1 for expressing a ribonucleic acid-guided nuclease derived from a eukaryote and a mutant ωRNA backbone. The coding sequence of the mutant ωRNA backbone has multiple (multiple) mutations compared with the coding sequence of the ωRNA backbone (referred to as the parental ωRNA backbone) of the parental NlovFz2-ωRNA editing system shown in SEQ.ID.NO.4, including any one of the ωRNA backbone mutants formed by partially or completely deleting bases (such as U) in the unpaired region of the stem-loop structure at the 3` end of the parental ωRNA backbone.
[0010] Preferably, the multiple (multiple) mutations specifically include any one of the following situations:
[0011] (a1) Deletion of the nucleotides with base T at the 105th, 106th, 112th, and 113th bp in the ωRNA backbone coding sequence of the parental NlovFz2-ωRNA editing system, and the coding sequence of the corresponding ωRNA backbone mutant is shown in SEQ.ID.NO.7; or,
[0012] (a2) Deletion of the nucleotides with base T at the 104th, 105th, 106th, 112th, and 113th bp in the ωRNA backbone coding sequence of the parental NlovFz2-ωRNA editing system, and the coding sequence of the corresponding ωRNA backbone mutant is shown in SEQ.ID.NO.8.
[0013] Preferably, the multiple (multiple-site) mutations also include any one of the following cases for combination with other mutations (such as the above a1, a2):
[0014] (b1) Substitution of the nucleotide with base T at the 97th bp to the nucleotide with base C and substitution of the nucleotide with base A at the 120th bp to the nucleotide with base G in the ωRNA backbone coding sequence of the parental NlovFz2-ωRNA editing system, and the coding sequence of the corresponding ωRNA backbone mutant is shown in SEQ.ID.NO.6; or,
[0015] (b2) Substitution of the nucleotide with base A at the 103rd bp to the nucleotide with base G and substitution of the nucleotide with base T at the 114th bp to the nucleotide with base C in the ωRNA backbone coding sequence of the parental NlovFz2-ωRNA editing system, and the coding sequence of the corresponding ωRNA backbone mutant is shown in SEQ.ID.NO.9; or,
[0016] (b3) Deletion of the nucleotide with base A at the 103rd bp and the nucleotide with base T at the 114th bp in the ωRNA backbone coding sequence of the parental NlovFz2-ωRNA editing system, and the coding sequence of the corresponding ωRNA backbone mutant is shown in SEQ.ID.NO.10.
[0017] Preferably, the coding sequence of the mutant ωRNA backbone is any one of the following cases:
[0018] (i) The nucleotide sequence shown in SEQ.ID.NO.5, SEQ.ID.NO.11, or SEQ.ID.NO.12; where SEQ.ID.NO.5 is the coding sequence of the ωRNA backbone mutant combined with the above a1 and b1; or,
[0019] (ii) A nucleotide sequence obtained by substitution, deletion, or insertion of one or more nucleotides in the nucleotide sequence shown in SEQ.ID.NO.5, SEQ.ID.NO.11, or SEQ.ID.NO.12, which is used to encode an ωRNA backbone mutant with the same function; or,
[0020] (iii) A nucleotide sequence having a sequence similarity of more than 95% with the nucleotide sequence shown in SEQ.ID.NO.5, SEQ.ID.NO.11, or SEQ.ID.NO.12.
[0021] Preferably, the nuclease is the NlovFz2 protein, and its coding sequence is as shown in SEQ.ID.NO.1.
[0022] Preferably, the recombinant vector A1 further includes a spacer sequence (i.e., Spacer sequence) designed according to the target site and used to form ωRNA with the mutant ωRNA backbone by expression.
[0023] Preferably, the recombinant vector A1 further includes a first reporter gene sequence for expressing a fluorescent protein (such as expressing red fluorescence).
[0024] Preferably, the editing system further includes a recombinant vector B1 for performing SSA detection on the cleavage activity of the nuclease (such as the NlovFz2 protein), and this recombinant vector B1 includes a second reporter gene sequence for expressing a fluorescent protein (such as expressing green fluorescence) after targeted cleavage.
[0025] In a second aspect, an optimized NlovFz2-ωRNA editing system is provided. This editing system includes a recombinant vector A2 for expressing the NlovFz2 mutant protein and the above-mentioned mutant ωRNA backbone. Compared with the parental NlovFz2 protein, the NlovFz2 mutant protein has mutations at one or more of the following amino acid sites: the 6th, 44th, 64th, 178th, and 285th positions, and all of these amino acid sites are mutated to arginine.
[0026] Preferably, the coding sequence of the parental NlovFz2 protein is as shown in SEQ.ID.NO.1.
[0027] Preferably, the coding sequence of the NlovFz2 mutant protein is any one of the following cases:
[0028] (i) The nucleotide sequence shown in SEQ.ID.NO.2, which is the coding sequence of the corresponding NlovFz2 mutant protein obtained by mutating the 285th amino acid (specifically glutamine) of the parental NlovFz2 protein to arginine; or,
[0029] (ii) The coding sequence of the nucleotide sequence shown in SEQ.ID.NO.2, which is obtained by substitution, deletion or insertion of one or more nucleotides, and encodes a protein with the same function (for example, a protein that still encodes the same amino acid sequence after substituting one or more nucleotides using codon degeneracy).
[0030] Preferably, the recombinant vector A2 further comprises a first reporter gene sequence for expressing a fluorescent protein (such as expressing red fluorescence).
[0031] Preferably, the sequence of the recombinant vector A2 is as shown in SEQ.ID.NO.21 (i.e., the nucleotide sequence of the enNlovFz2 system plasmid).
[0032] Preferably, the recombinant vector A2 further comprises a spacer sequence (i.e., Spacer sequence) designed according to the target site and used to form ωRNA with the mutant ωRNA backbone through expression.
[0033] Preferably, the editing system further comprises a recombinant vector (such as the above-mentioned recombinant vector B1) for performing SSA detection on the cleavage activity of the NlovFz2 mutant protein.
[0034] In a third aspect, an NlovFz2-ωRNA efficient editing system based on a fusion protein is provided. The editing system comprises a recombinant vector A3 for expressing the fusion protein and the above-mentioned mutant ωRNA backbone. The fusion protein comprises the above-mentioned NlovFz2 mutant protein and a modification component for enhancing the cleavage activity.
[0035] Preferably, the modification component specifically comprises T5 exonuclease, TREX1 exonuclease or CasTX nuclease fused and expressed with the NlovFz2 mutant protein.
[0036] Preferably, the modification component further comprises a linker, such as XTEN.
[0037] Preferably, the coding sequence of the fusion protein is any one of the following:
[0038] (i) The nucleotide sequence shown in SEQ.ID.NO.3, which is formed by ligating the nucleotide sequence shown in SEQ.ID.NO.2, the XTEN sequence and the coding sequence of T5 exonuclease; or
[0039] (ii) The nucleotide sequence shown in SEQ.ID.NO.3, which is obtained by substitution, deletion or insertion of one or more nucleotides, and encodes a protein with the same function (for example, a protein that still encodes the same amino acid sequence after substituting one or more nucleotides using codon degeneracy); or,
[0040] (iii) A nucleotide sequence having a sequence similarity of more than 95% with the nucleotide sequence shown in SEQ.ID.NO.3.
[0041] In a fourth aspect, there is provided a composition of an RNA-guided nuclease system derived from eukaryotes, which composition comprises a first nucleic acid and a second nucleic acid. The first nucleic acid is a vector for expressing the above-mentioned NlovFz2 protein (such as the protein encoded by SEQ.ID.NO.1), NlovFz2 mutant protein (such as the protein encoded by SEQ.ID.NO.2), or fusion protein (such as the protein encoded by SEQ.ID.NO.3), and the second nucleic acid is a vector for expressing the coding sequence and spacer sequence of the above-mentioned mutant ωRNA backbone (such as the ωRNA backbone mutant encoded by SEQ.ID.NO.5).
[0042] Preferably, the first nucleic acid further comprises a first reporter gene sequence for expressing a fluorescent protein (such as expressing red fluorescence), and the second nucleic acid further comprises a second reporter gene sequence for expressing a fluorescent protein (such as expressing green fluorescence).
[0043] Preferably, the ωRNA expressed by the second nucleic acid (using the coding sequence and spacer sequence of the mutant ωRNA backbone) can bind to the protein component expressed by the first nucleic acid and guide the protein component to the target site for cleavage; wherein the protein component and ωRNA bind to each other to form an RNP complex.
[0044] Preferably, the recombinant vectors A1, A2, A3 and the first nucleic acid further comprise NLS sequences located upstream and downstream of the coding sequence of the target protein expressed by them (specifically referring to the above-mentioned NlovFz2 protein, NlovFz2 mutant protein, fusion protein).
[0045] In a fifth aspect, there is provided the use of the above-mentioned editing system or composition in gene editing.
[0046] Preferably, the gene editing is gene knockout or gene knock-in.
[0047] In a sixth aspect, there is provided the use of the above-mentioned editing system or composition in the preparation of a preparation for:
[0048] (i) Gene or genome editing;
[0049] (ii) Target nucleic acid detection and diagnosis;
[0050] (iii) Editing a target sequence in a target gene locus to modify a biological genome;
[0051] (iv) Gene therapy of diseases;
[0052] (v) Targeting a target gene;
[0053] (vi)Cut the target gene.
[0054] The beneficial effects of the present invention are embodied in:
[0055] Through a large number of experiments and repeated explorations, the present invention systematically engineers the ωRNA structure (ωRNA backbone) of the NlovFz2-ωRNA editing system and the NlovFz2 protein, and discovers an optimized NlovFz2-ωRNA editing system (such as the enNlovFz2 system) that can significantly improve the gene editing efficiency, providing technical support for the efficient delivery of gene editing tools, and having broad application prospects in biological breeding, gene therapy, and promoting the research on the functional mechanisms in related fields of biomedicine and breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0056] Figure 1a It is a schematic diagram of the primary structure (amino acid sequence) of the parental NlovFz2 protein.
[0057] Figure 1b It is a schematic diagram of the structure of the parental ωRNA (including the ωRNA backbone and Spacer); where: S1 represents the stem-loop structure labeled blue in the ωRNA backbone, S2 represents the stem-loop structure labeled green in the ωRNA backbone, S3 represents the stem-loop structure labeled yellow in the ωRNA backbone, and Spacer is labeled red for identification B2M Taking the gene locus (the specific target DNA sequence is "TCACCTGTCTCCAAGCCAGC") as an example.
[0058] Figure 1c It is the verification of the editing efficiency of the NlovFz2-ωRNA editing system modified by different ωRNA mutants (base substitutions on the ωRNA backbone) at the cell genome B2M gene locus (WT-ωRNA indicates that the part corresponding to the ωRNA backbone in the parental NlovFz2-ωRNA editing system is not mutated).
[0059] Figure 1d It is the verification of the editing efficiency of the NlovFz2-ωRNA editing system modified by different ωRNA mutants (base deletions on the ωRNA backbone) at the cell genome B2M gene locus (WT-ωRNA indicates that the part corresponding to the ωRNA backbone in the parental NlovFz2-ωRNA editing system is not mutated).
[0060] Figure 1e It is the corresponding NlovFz2-ωRNA editing system after being modified by a combination of relatively optimal mutations on the ωRNA backbone at the cell genome B2MVerification of the editing efficiency at the gene locus (the rightmost data column is WT-ωRNA).
[0061] Figure 1f Verification of the editing efficiency of the corresponding NlovFz2-ωRNA editing system at the cell genome after being modified by other mutation combinations on the ωRNA backbone B2M Verification of the editing efficiency at the gene locus (compared with the corresponding single mutation).
[0062] Figure 1g Plasmid map of an optimized NlovFz2-ωRNA editing system (i.e., enNlovFz2).
[0063] Figure 2a Verification of the arginine mutation of the key amino acids of the NlovFz2 protein selected according to the functional domain (the positions indicated by the arrows are P6R and Q285R respectively) and its efficiency in cleaving the reporter vector in cells.
[0064] Figure 2b Flow cytometry (FACS) results after the NlovFz2 mutant protein (specifically the Q285R mutation) used for determining the key amino acid mutations of the NlovFz2 protein cleaved the reporter vector; where: Q2 represents the cells sorted into which the NlovFz2 system plasmid and the reporter vector were successfully transfected and the reporter vector was cleaved, that is, emitting both red and green fluorescence.
[0065] Figure 3 Verification of the efficiency of the combined mutations at the high-efficiency mutation sites of the NlovFz2 protein in cleaving the reporter vector in cells (the rightmost data column is the NlovFz2-ωRNA v3.1 system).
[0066] Figure 4 Verification of the combination of the optimal NlovFz2 mutant protein and the optimal ωRNA backbone mutation and its editing efficiency in cells: * P <0.05; ** P <0.01; **** P <0.001.
[0067] Figure 5 Verification of the combination of the optimal NlovFz2-ωRNA editing system (i.e., enNlovFz2) with T5 exonuclease, TREX1 exonuclease, and CasTX nuclease (fused with the NlovFz2 mutant protein respectively) and its editing efficiency in cells.
[0068] Figure 6aThe experimental procedures involve the transfection of the enNlovFz2-ωRNA-mCherry ternary co-expression plasmid (Plasmid) where the editing system (taking enNlovFz2 as an example), single-fluorescence flow cytometry sorting, extraction of cell genomic DNA, and deep sequencing of target sites; between the two NLS sequences is the coding sequence of the NlovFz2 mutant protein (mutated to Q285R) adopted by enNlovFz2.
[0069] Figure 6b Verification and comparison of the editing efficiencies of the parental NlovFz2-ωRNA editing system (i.e., NlovFz2-WT or WT-NlovFz2), enNlovFz2, the optimal NlovFz2-ωRNA editing system fused with an exonuclease (i.e., enNlovFz2-T5), enCnCas12f editing system, and enRhCas12f editing system at different endogenous sites (different genes, different targeted DNA sequences) in HEK293T cells.
[0070] Figure 6c Schematic diagram of the structure of the endogenous sites (specifically referring to the targeted DNA sequence, abbreviated as sg) selected in the experiment.
[0071] Figure 6d Statistical results of the editing efficiencies of WT-NlovFz2, enNlovFz2, enNlovFz2-T5, enCnCas12f, and enRhCas12f at each endogenous site in the experiment. Specific implementation mode
[0072] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. The embodiments are only used to explain the present invention and are not used to limit the protection scope of the present invention.
[0073] Example 1 Modification and optimization of the NlovFz2-ωRNA editing system
[0074] 1. Design of the NlovFz2 mutant protein
[0075] In the present invention, amino acid residues are represented by three-letter or single-letter codes. For example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R); if a mutation occurs at the "x" -th position (starting from the N - terminus) in the reference sequence of a protein, the mutation type at this position is represented as "parent protein amino acid residue at 'x' mutated protein amino acid residue". For example, P6R represents that P at the 6 - th position is mutated to R.
[0076] For the known NlovFz2 protein, by dividing the functions of its domains, some amino acid sites that may be related to the protein function were selected in each domain for arginine mutation. The amino acid sequence of the parental NlovFz2 protein is the NlovFz2 protein reference sequence as shown in Figure 1a Specifically, in the case of mutation at the corresponding amino acid sites, the coding sequence of the corresponding mutant protein was determined according to the coding sequence of the parental NlovFz2 protein.
[0077] 2. Design of the mutant ωRNA scaffold (ωRNA - scaffold)
[0078] For the ωRNA in the known NlovFz2 - ωRNA editing system (its 5` - end is the ωRNA scaffold and the 3` - end is the Spacer), the stem - loop structures in its ωRNA scaffold were divided into regions (the ωRNA scaffold has a total of 3 stem - loop structures. The three stem - loop structures are called stem - loop S1, stem - loop S2, and stem - loop S3 in the order from 5` to 3`. See Figure 1b), and perform modifications such as deletion, insertion, and base substitution in different regions.For example, S3Loop-Δ4U means that the mutation site in the ωRNA backbone relative to the parental NlovFz2-ωRNA editing system is the 4 bases UUUU in the "Loop" at the top of stem-loop S3 (corresponding to the nucleotides where the bases at positions 105 bp, 106 bp, 112 bp, and 113 bp from the 5` end of the ωRNA backbone coding sequence in the parental NlovFz2-ωRNA editing system are T), and the mutation type is deletion; S3Loop-Δ5U means that the mutation site in the ωRNA backbone relative to the parental NlovFz2-ωRNA editing system is the 5 bases UUUUU in the "Loop" at the top of stem-loop S3 (corresponding to the nucleotides where the bases at positions 104 bp, 105 bp, 106 bp, 112 bp, and 113 bp from the 5` end of the ωRNA backbone coding sequence in the parental NlovFz2-ωRNA editing system are T), and the mutation type is deletion; UA97CG is located in stem-loop S3, which means that the UA base pair at the 97th position from the 5` end of the ωRNA backbone relative to the parental NlovFz2-ωRNA editing system is mutated to a CG base pair (when the nucleotide at the 97th bp from the 5` end of the ωRNA backbone coding sequence in the parental NlovFz2-ωRNA editing system is replaced from base T to base C, due to the complementary base pairs in the stem-loop structure within the ωRNA backbone, it also causes the nucleotide at the 120th bp from the 5` end to be replaced from base A to base G); AU103CG is located in stem-loop S3, which means that the AU base pair at the 103rd position from the 5` end of the ωRNA backbone relative to the parental NlovFz2-ωRNA editing system is mutated to a CG base pair; AU103GC means that the AU base pair at the 103rd position from the 5` end of the ωRNA backbone relative to the parental NlovFz2-ωRNA editing system is mutated to a GC base pair; U115C (or called GU102GC) is located in stem-loop S3, which means that the base U at the 115th position from the 5` end of the ωRNA backbone relative to the parental NlovFz2-ωRNA editing system is replaced by base C; S3-Δ2bp means that the mutation site in the ωRNA backbone relative to the parental NlovFz2-ωRNA editing system is 2 base pairs from the outside to the inside of stem-loop S3 (corresponding to the nucleotides where the base at the 102bp is G, the base at the 103 bp is A, the base at the 114 bp is T, and the base at the 115 bp is T in the ωRNA backbone coding sequence of the parental NlovFz2-ωRNA editing system), and the mutation type is deletion; S3-Δ1bp means that the mutation site in the ωRNA backbone relative to the parental NlovFz2-ωRNA editing system is 1 base pair from the outside to the inside of stem-loop S3 (corresponding to the nucleotides where the base at the 103 bp is A and the base at the 114 bp is T in the ωRNA backbone coding sequence of the parental NlovFz2-ωRNA editing system), and the mutation type is deletion.
[0079] 3. Vector construction strategies and examples
[0080] Recombinant vectors expressing NlovFz2 mutant proteins and / or ωRNA mutants (specific mutations are in the ωRNA backbone part) were all constructed using the pEASY ® -T1 Cloning Kit (Trans). Using the parental NlovFz2 system eukaryotic expression vector as a template, different primers were designed to amplify the required fragments by standard PCR. The method designed for amplification was centered on the mutated site, and single restriction enzyme sites were searched on both sides of the mutated site (located on one side of the 5` end and the 3` end of the coding sequence respectively). After digestion, the vector backbone was obtained. Then, the DNA sequence of the NlovFz2 protein or ωRNA backbone (i.e., the coding sequence) was divided into two parts. The two DNA sequences extended from the front and rear single restriction enzyme sites to the mutated site of the NlovFz2 protein or ωRNA backbone respectively, and two pairs of primers were used to amplify these two DNA sequences respectively, and the sequences to be mutated were introduced on the primers; the combination of different mutated sites in the mutants was achieved by PCR using the NlovFz2 system eukaryotic expression vector containing the coding sequence of a single mutant of the NlovFz2 protein (or ωRNA backbone) as a template, and another or more mutations were introduced through one or more amplifications according to the above amplification method.
[0081] Among them, the parental NlovFz2 system eukaryotic expression vector was obtained by the following method: Using the Cas12i editing system plasmid (from the literature An engineered xCas12i with high activity, high specificity, and broad PAM range; in this plasmid, the CAG promoter drives the expression of the Cas12i protein, the U6 promoter drives the expression of the sgRNA, and the CMV promoter drives the expression of the fluorescent protein), and the nucleotide sequence encoding the parental NlovFz2 protein and the nucleotide sequence encoding the parental ωRNA backbone obtained by synthesis were used to replace the nucleotide sequence encoding the Cas12i protein (the NLS sequences directly connected to it at the upstream and downstream are: the nuclear localization signal sequence SV40 NLS at the 5` end and the nuclear localization signal sequence nucleoplasmin NLS at the 3` end) and the nucleotide sequence encoding the sgRNA backbone, respectively, to obtain the parental NlovFz2-ωRNA editing system plasmid.
[0082] Taking the parental NlovFz2-ωRNA editing system plasmid as a template to construct recombinant vectors expressing NlovFz2 mutant proteins and / or ωRNA mutants (specific mutations are in the ωRNA backbone part), the construction process is illustrated as follows.
[0083] Taking the construction of the plasmid enNlovFz2 shown as an example Figure 1g First, use the BshTⅠ and SacⅠ restriction endonucleases (Thermo) to digest the parental NlovFz2-ωRNA editing system plasmid to obtain a linearized vector backbone. Using the parental NlovFz2-ωRNA editing system plasmid as a template, use primer F1 (5`-CCTGAAATCACTTTTTTTCAGGTTGGA-3`, i.e., SEQ.ID.NO.13) and primer R1 (5`-CCAGAGTGCCGAGGGGCCTGATTTTCTCCCC-3`, i.e., SEQ.ID.NO.14), primer F2 (5`-AGGCCCCTCGGCACTCTGGACAGGTGGTGG-3`, i.e., SEQ.ID.NO.15) and primer R2 (5`-AGTCGAGGCTGATCAGCG-3`, i.e., SEQ.ID.NO.16) for PCR. Use pEASY ® -T1 CloningKit and construct a recombinant vector through seamless cloning to introduce the Q285R mutation of the NlovFz2 protein; then use the SacⅠ and NheⅠ restriction endonucleases (Thermo) to digest the NlovFz2-ωRNA editing system plasmid containing Q285R obtained in the previous step to obtain a linearized backbone vector. Using the NlovFz2-ωRNA editing system plasmid containing Q285R obtained in the previous step as a template, use primer F3 (5`-GCAAAGAAGAAAAAGTAAGAATTCCTAG-3`, i.e., SEQ.ID.NO.17) and primer R3 (5`-TTCGAACAACAAACATCGAACGAAGTGCTGATCTTGCAAGCAAAC-3`, i.e., SEQ.ID.NO.18), primer F4 (5`-TCGTTCGATGTTTGTTGTTCGAATTGTTGATTTAAATAAAGGCGTGAGACC-3`, i.e., SEQ.ID.NO.19) and primer R4 (5`-TCGCCCTTGCTCACCATG-3`, i.e., SEQ.ID.NO.20) for PCR. Use pEASY ®The -T1 Cloning Kit constructs recombinant vectors through seamless cloning to obtain the enNlovFz2 system plasmid (i.e., the NlovFz2-ωRNA editing system plasmid containing Q285R+S3Loop-Δ4U+UA97CG). In the enNlovFz2 system plasmid, the NlovFz2 protein (specifically, the NlovFz2 protein introduced with the Q285R mutation) expression cassette contains the CAG promoter (i.e., CMV enhancer + chicken β-actin promoter) and a transcription termination signal (specifically, the bGH poly(A) sequence); the ωRNA expression cassette uses the U6 promoter, downstream of which is the ωRNA backbone (i.e., the NlovFz2 ωRNA scaffold, also known as ωRNA-scaffold) introduced with the S3Loop-Δ4U and UA97CG mutations. Downstream of this ωRNA backbone is a restriction enzyme cleavage site (specifically, Eco31I) for inserting the spacer sequence (i.e., the Spacer sequence); the fluorescent protein (specifically, mCherry) expression cassette uses the CMV promoter.
[0084] Example 2 Verification of the editing efficiency of the ωRNA backbone after modification in the NlovFz2 system
[0085] For human B2M Select the target site (i.e., the target site) for the endogenous gene B2M -site: 5`- ccg tcacctgtctccaagccagc -3` (i.e., SEQ.ID.NO.22), where the italic part is the TAM sequence and the underlined region is the target DNA sequence of the target site. Anneal the paired primers for the target site B2M -site and ligate them to the NlovFz2 system eukaryotic expression vector fragment that can express the modified target ωRNA structure (i.e., the mutant ωRNA backbone) linearized by the Eco31I restriction enzyme to obtain the NlovFz2 system expression vector targeting the B2M gene locus.
[0086] Through the Hieff Trans® PEI transfection reagent (Yeasen), the NlovFz2 system expression vector targeting the B2M gene locus was transfected into 3×10 5In HEK293T cells. After transfection, the parental NlovFz2 system eukaryotic expression vector (i.e., the parental NlovFz2-ωRNA editing system plasmid) was used as a positive control, and untransfected cells were used as a negative control (negative control, NC). After 60 - 72 h of transfection, flow cytometry was used to sort positive cells with red fluorescence for genomic DNA extraction. The method for extracting genomic DNA from cell samples is as follows: Cells were resuspended with 1×Lysis Buffer containing Proteinase K and lysed overnight at 55 °C. Then, Proteinase K was inactivated by treating at 95 °C for 10 min to obtain genomic DNA of positive cells.
[0087] The target fragment containing the editing site on the extracted DNA was amplified using Phanta Max Super-Fidelity DNA Polymerase (Vazyme) and high-throughput sequencing primers with barcodes. After library construction, amplicon sequencing was performed, and the editing efficiency obtained through data analysis is as Figure 1c 、 Figure 1d shown. And the best modification methods for different regions of the ωRNA backbone v1 version were selected, that is, 8 ωRNA backbone mutants (designated by mutation types) that can significantly improve the editing efficiency relative to the parental NlovFz2-ωRNA editing system were obtained: S3Loop-Δ4U, S3Loop-Δ5U, AU103CG, AU103GC, GU102GC, UA97CG, S3-Δ2bp, S3-Δ1bp (Since S3-Δ9bp deleted too many bases and S3Loop-Δ2U was included in S3Loop-Δ4U and S3Loop-Δ5U, they were not selected).
[0088] The ωRNA backbone in the above parental NlovFz2-ωRNA editing system has a coding sequence that is the nucleotide sequence shown below (i.e., SEQ.ID.NO.4):
[0089] 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGATTTGTTTGTTTTGTTCAAATTGTTGATTTAAATAAAGGCG-3`
[0090] The coding sequence corresponding to the above ωRNA backbone mutant UA97CG is the nucleotide sequence shown below (i.e., SEQ.ID.NO.6):
[0091] 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTCGTTCGATTTGTTTGTTTTGTTCGAATTGTTGATTTAAATAAAGGCG-3`
[0092] The coding sequence corresponding to the above ωRNA backbone mutant S3Loop-Δ4U is the nucleotide sequence shown below (i.e., SEQ.ID.NO.7):
[0093] 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGATGTTTGTTGTTCAAATTGTTGATTTAAATAAAGGCG-3`
[0094] The coding sequence corresponding to the above ωRNA backbone mutant S3Loop-Δ5U is the nucleotide sequence shown below (i.e., SEQ.ID.NO.8):
[0095] 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGAGTTTGTTGTTCAAATTGTTGATTTAAATAAAGGCG-3`
[0096] The coding sequence corresponding to the above ωRNA backbone mutant AU103GC is the nucleotide sequence shown below (i.e., SEQ.ID.NO.9):
[0097] 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGGTTTGTTTGTTCTGTTCAAATTGTTGATTTAAATAAAGGCG-3`
[0098] The coding sequence corresponding to the above ωRNA backbone mutant S3-Δ1bp is the nucleotide sequence shown below (i.e., SEQ.ID.NO.10):
[0099] 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGTTTGTTTGTTTGTTCAAATTGTTGATTTAAATAAAGGCG-3`
[0100] Example 3 Verification of the editing efficiency of the ωRNA backbone after iterative modification in the NlovFz2 system
[0101] Based on the above ωRNA backbone mutation sites, different combinations of mutation sites were made and iterative mutations were carried out respectively, and then the activities of the NlovFz2-ωRNA iterative mutants were verified (that is, the improvement of the editing efficiency relative to the parental NlovFz2-ωRNA editing system).
[0102] The targeting B2M gene locus (i.e., the above-mentioned target locus B2M -site) corresponding NlovFz2 system expression vector was transfected into 3×10 5 HEK293T cells. After transfection, the parental NlovFz2 system expression vector (i.e., the plasmid of the parental NlovFz2-ωRNA editing system) was used as a positive control, and untransfected cells were used as a negative control. 60 h to 72 h after transfection, flow sorting of red fluorescence was performed to obtain positive cells for genomic extraction, and high-throughput sequencing was carried out. The editing efficiency results obtained from the analysis of high-throughput sequencing data are as Figure 1e 、 Figure 1f shown.
[0103] Select the three ωRNA backbone mutation site combinations with the highest efficiency in the editing results of the NlovFz2 system with different ωRNA structures obtained from the analysis of high-throughput sequencing data: ωRNA v3.1 (i.e., the ωRNA backbone mutant of the S3Loop-Δ4U+UA97CG combination), ωRNA v3.2 (i.e., the ωRNA backbone mutant of the S3Loop-Δ5U+AU103GC combination), ωRNA v3.3 (i.e., the ωRNA backbone mutant of the S3Loop-Δ4U+S3-Δ1bp combination) for subsequent experiments (see specifically Figure 1e ).
[0104] The corresponding coding sequence of the above ωRNA backbone mutant ωRNA v3.1 is the nucleotide sequence shown below (i.e., SEQ.ID.NO.5):
[0105] 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTCGTTCGATGTTTGTTGTTCGAATTGTTGATTTAAATAAAGGCG-3`
[0106] The coding sequence corresponding to the above ωRNA backbone mutant ωRNA v3.2 is the nucleotide sequence shown below (i.e., SEQ.ID.NO.11):
[0107] 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGGGTTTGCTGTTCAAATTGTTGATTTAAATAAAGGCG-3`
[0108] The coding sequence corresponding to the above ωRNA backbone mutant ωRNA v3.3 is the nucleotide sequence shown below (i.e., SEQ.ID.NO.12):
[0109] 5`-GAGCACCTTGTGTGTTGGGTCTTCCCCACCTTGTGTGCGTTGGGTCCTTTCCCCTGGCTTTCACTCTTTGAGTGTTTGCTTGCAAGATCAGCACTTTGTTCGTGTTTGTGTTCAAATTGTTGATTTAAATAAAGGCG-3`
[0110] Verification of the editing activity of the NlovFz2 mutant protein in Example 4
[0111] After verifying the in - cell editing efficiency of the corresponding NlovFz2 system with the modified ωRNA backbone, single - strand annealing (SSA) assay was used to verify the activity of the NlovFz2 mutant protein. Specifically, eukaryotic expression vectors of the NlovFz2 system with different expected amino acid mutations were designed, and all of them were able to target a fluorescent reporter vector, which carried the coding sequence of the fluorescent protein EGFP that could only be expressed after being targeted and cleaved. When the eukaryotic expression vector of the NlovFz2 system entered the cell, the coding sequence of the fluorescent protein mCherry carried by it was expressed and emitted red light. Only when the fluorescent reporter vector was successfully cleaved by the NlovFz2 mutant protein expressed by the eukaryotic expression vector of the NlovFz2 system, could the expression of EGFP be achieved by using this fluorescent reporter vector, and green fluorescence was emitted.
[0112] The construction principle of the above - mentioned fluorescent reporter vector is described as follows (Reference: Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single - guided RNA): The coding sequence of the green fluorescent protein EGFP was divided into two segments. The last 200 bp of the first segment and the first 200 bp of the second segment were homologous sequences. The two segments were cloned separately, and a stop codon and a target sequence of ωRNA (such as the targeted DNA sequence in the above B2M -site) were inserted in the middle. When the ωRNA - specific detection vector (i.e., the above - mentioned fluorescent reporter vector) was transfected into cells alone, no green fluorescence was observed. However, if the gene - editing plasmid (such as the parental NlovFz2 system plasmid or the modified NlovFz2 system plasmid) and the corresponding fluorescent reporter vector were co - transfected into cells, the RNP complex would be recruited to the ωRNA target sequence between the two fluorescent protein coding sequences, thus causing double - strand DNA breaks by cleavage. Subsequently, homologous recombination occurred between the homologous regions of the first segment and the second segment of the fluorescent protein EGFP. After homologous recombination, a complete coding sequence of the fluorescent protein EGFP was generated and green fluorescence was expressed. Finally, by analyzing the proportion of green - fluorescent cells, the influence of different modification strategies of the NlovFz2 protein on the editing efficiency of the gene - editing system could be evaluated.
[0113] The complex of the NlovFz2 - ωRNA editing system expression vector carrying the NlovFz2 mutant protein coding sequence and the fluorescent reporter vector was transfected at a ratio of 1:1 (1 μg:1 μg) and transfected into 3×10 5After transfection into HEK293T cells, the parental NlovFz2 system was used as a positive control, and untransfected cells were used as a negative control. After 60 h of transfection, flow cytometry analysis was performed to count the proportion of green fluorescent cells among the red fluorescent cells. No obvious green fluorescence was observed in the experimental results, which might be due to the too low editing activity of the parental NlovFz2 system. Therefore, ωRNA v3.1 in Example 3 was used to replace the ωRNA backbone in the NlovFz2-ωRNA editing system carrying the NlovFz2 mutant protein coding sequence. Flow cytometry analysis found that the green fluorescence was significantly enhanced (see Figure 2b ). The cleavage efficiency of different NlovFz2 mutant proteins obtained based on ωRNA v3.1 on the fluorescent reporter vector is as shown in Figure 2a . Five NlovFz2 mutant proteins (designated by mutation types) with significantly enhanced cleavage efficiency compared to the parental NlovFz2 protein were determined: P6R, Q44R, E64R, T178R, Q285R, that is, compared with the amino acid sequence of the parental NlovFz2 protein in Example 1, they are NlovFz2 mutant proteins in which the 6th, 44th, 64th, 178th, and 285th amino acids from the N-terminus are mutated to arginine, respectively.
[0114] Example 5 Verification of the editing activity of NlovFz2 mutant proteins (combined mutations)
[0115] Using the above amino acid mutation sites: P6R, Q44R, E64R, T178R, Q285R, iterative mutations were performed respectively, that is, the cleavage efficiency of NlovFz2 proteins with combined mutations at the following amino acid sites was verified:
[0116] (1) The 6th position from the N-terminus (specifically, by changing the bases C, C, T at the 16th, 17th, and 18th bp from the 5` end of the coding sequence of the parental NlovFz2 protein to bases C, G, G), the 44th position (specifically, by changing the bases C, A, G at the 130th, 131st, and 132nd bp from the 5` end of the coding sequence of the parental NlovFz2 protein to bases C, G, G) amino acid mutation site R; (2) The 6th position and the 64th position from the N-terminus (specifically, by changing the bases G, A, G at the 190th, 191st, and 192nd bp from the 5` end of the coding sequence of the parental NlovFz2 protein to bases C, G, G) amino acid mutation site R; (3) The 6th position and the 178th position from the N-terminus (specifically, by changing the bases A, C, C at the 532nd, 533rd, and 534th bp from the 5` end of the coding sequence of the parental NlovFz2 protein to bases C, G, G) amino acid mutation site R; (4) The 6th position and the 285th position from the N-terminus (specifically, by changing the bases C, A, G at the 853rd, 854th, and 855th bp from the 5` end of the coding sequence of the parental NlovFz2 protein to bases C, G, G) amino acid mutation site R; (5) The 44th position and the 64th position from the N-terminus amino acid mutation site R; (6) The 44th position and the 178th position from the N-terminus amino acid mutation site R; (7) The 44th position and the 285th position from the N-terminus amino acid mutation site R; (8) The 64th position and the 178th position from the N-terminus amino acid mutation site R; (9) The 64th position and the 285th position from the N-terminus amino acid mutation site R; (10) The 178th position and the 285th position from the N-terminus amino acid mutation site R; (11) The 6th position, the 44th position, and the 64th position from the N-terminus amino acid mutation site R; (12) The 6th position, the 44th position, and the 178th position from the N-terminus amino acid mutation site R; (13) The 6th position, the 44th position, and the 285th position from the N-terminus amino acid mutation site R; (14) The 44th position, the 64th position, and the 178th position from the N-terminus amino acid mutation site R; (15) The 44th position, the 64th position, and the 285th position from the N-terminus amino acid mutation site R; (16) The 64th position, the 178th position, and the 285th position from the N-terminus amino acid mutation site R; (17) The 6th position, the 64th position, and the 178th position from the N-terminus amino acid mutation site R; (18) The 6th position, the 64th position, and the 285th position from the N-terminus amino acid mutation site R; (19) The 44th position, the 178th position, and the 285th position from the N-terminus amino acid mutation site R; (20) The 6th position, the 178th position, and the 285th position from the N-terminus amino acid mutation site R; (21) The 6th position, the 44th position, the 64th position, and the 178th position from the N-terminus amino acid mutation site R; (22) The 6th position, the 44th position, the 64th position, and the 285th position from the N-terminus amino acid mutation site R; (23) The 6th position, the 44th position, the 178th position, and the 285th position from the N-terminus amino acid mutation site R;(24)The amino acid mutation sites R at the 6th, 64th, 178th, and 285th positions from the N-terminus; (25) The amino acid mutation sites R at the 44th, 64th, 178th, and 285th positions from the N-terminus; (26) The amino acid mutation sites R at the 6th, 44th, 64th, 178th, and 285th positions from the N-terminus.;
[0117] The coding sequence of the above parental NlovFz2 protein is shown below (i.e., SEQ.ID.NO.1):
[0118]
[0119] When verifying the cleavage activity of the NlovFz2 protein combination mutants, the complex of the NlovFz2 system expression vector carrying the mutant protein coding sequence and the fluorescent reporter vector was transfected at a ratio of 1:1 (1 μg: 1 μg) into 3×10 5 HEK293T cells. The NlovFz2-ωRNA v3.1 system (i.e., the system after replacing the ωRNA backbone in the parental NlovFz2 system with ωRNA v3.1) was used as a positive control, and untransfected cells were used as a negative control. After 60 h to 72 h of transfection, flow cytometry analysis was performed to count the proportion of green fluorescent cells among the red fluorescent cells. The cleavage efficiency of different combinations of NlovFz2 protein mutants on the fluorescent reporter vector was obtained as Figure 3 shown.
[0120] Figure 3 The results in B2M showed that for the same target site (specifically referring to the above B2M -site), the efficiency decreased after protein mutation combination. Therefore, two optimal NlovFz2 mutant proteins were used: the NlovFz2 mutant protein with only the amino acid mutation P6R and the NlovFz2 mutant protein with only the amino acid mutation Q285R for subsequent related experiments. The coding sequence of the latter NlovFz2 mutant protein is shown below (i.e., SEQ.ID.NO.2):
[0121]
[0122] In addition, based on the NlovFz2 mutant protein with only the amino acid mutation Q285R as described above, the mutant protein was fused with T5 exonuclease and others through the linker XTEN. The coding sequence of the corresponding fusion protein with T5 exonuclease fused to the C-terminus of the NlovFz2 protein is shown below (i.e., SEQ.ID.NO.3):
[0123] TCCGGAGGATCTAGCGGAGGCTCCTCTGGCAGCGAGACACCA GGAACAAGCGAGTCAGCAACACCAGAGAGCAGTGGCGGCAGCAGCGGCGGCAGC ATGAGCAAGTCCTGGGGCAAGT TCATCGAGGAAGAGGAAGCTGAAATGGCCTCTAGACGCAACCTGATGATCGTGGATGGCACCAACCTCGGCTTCAG GTTCAAGCACAACAACTCCAAGAAACCTTTCGCCAGCAGCTACGTGTCTACCATCCAGAGCCTGGCCAAGAGCTAT AGCGCCAGAACCACAATCGTGCTCGGCGATAAGGGCAAAAGCGTGTTCAGACTGGAACATCTGCCTGAGTACAAGG GCAACCGGGACGAGAAGTACGCCCAGCGGACCGAGGAAGAGAAGGCTCTGGATGAGCAGTTTTTCGAGTACCTGAA AGACGCCTTCGAGCTTTGTAAAACAACATTTCCTACATTCACAATCAGAGGAGTGGAAGCCGATGATATGGCCGCT TATATCGTGAAGCTGATCGGCCACCTGTACGACCACGTGTGGCTGATCTCTACAGATGGTGACTGGGACACCCTGC TGACCGACAAGGTGTCCAGATTCAGCTTCACCACCAGAAGAGAGTACCACCTGAGAGATATGTACGAGCACCACAA TGTGGACGACGTGGAGCAATTTATCAGCCTGAAGGCCATTATGGGCGACCTGGGCGACAACATCCGGGGCGTTGAA GGCATCGGCGCTAAAAGAGGCTACAACATCATCCGGGAGTTCGGCAATGTGCTGGACATCATCGACCAGCTGCCCC TGCCAGGCAAGCAGAAATACATCCAGAACCTGAACGCCAGCGAGGAGCTGCTGTTCAGAAATCTGATTCTGGTGGA CCTGCCTACCTACTGCGTGGATGCCATCGCCGCCGTGGGCCAGGACGTGCTGGACAAGTTTACCAAGGACATCCTG GAAATCGCCGAGCAG -3`
[0124] In the above nucleotide sequence (i.e., SEQ.ID.NO.3), the coding sequence of T5 exonuclease is in italics, and the linker sequence is underlined.
[0125] Example 6 Obtaining the Optimal NlovFz2-ωRNA Editing System
[0126] After obtaining three optimal ωRNA backbone mutants: ωRNA v3.1, ωRNA v3.2, ωRNA v3.3 through Example 3, and two optimal NlovFz2 mutant proteins (designated by mutation types): P6R, Q285R through Example 4 and Example 5, they were combined to obtain a total of 6 different combinations of NlovFz2-ωRNA systems: P6R + ωRNA v3.1, P6R + ωRNA v3.2, P6R + ωRNA v3.3, Q285R + ωRNA v3.1, Q285R + ωRNA v3.2, Q285R + ωRNA v3.3.
[0127] For human B2M the endogenous gene target site (i.e., the above B2M -site), a corresponding expression vector was constructed, and the editing efficiency was verified according to the methods in Examples 2 and 3, that is, through processes such as cell transfection, flow sorting, cell genome extraction, and high-throughput library construction and sequencing. The results are as Figure 4 shown. The recombinant vector expressing the NlovFz2 mutant protein with the highest editing efficiency (specific mutation is Q285R) and the ωRNA backbone mutant (specifically ωRNA v3.1) was selected as the final optimized NlovFz2-ωRNA system, named enNlovFz2. The sequence of the corresponding vector (i.e., the plasmid of the enNlovFz2 system) is as follows (i.e., SEQ.ID.NO.21, and the construction method can be referred to in Example 1):
[0128]
[0129] Example 7: Verification of the Fusion of the NlovFz2-ωRNA System with Different Exonucleases and Editing Efficiency
[0130] Exonucleases or other nucleases added to improve the editing efficiency based on Cas proteins in the CRISPR / Cas system were selected and fused with the modified NlovFz2 mutant protein to verify the optimization scheme for further enhancing the editing efficiency of the system. Specifically, two exonucleases, T5 exonuclease and TREX1 exonuclease, and another nuclease, CasTX, were selected. The coding sequences of T5 exonuclease, TREX1 exonuclease, and CasTX nuclease were constructed in the protein expression cassette of the enNlovFz2 system expression vector and linked using linker XTEN (linked to the N-terminus and C-terminus of the corresponding NlovFz2 mutant protein respectively), and a total of 6 expression vectors with different fusion protein coding sequences were constructed: T5-enNlovFz2, enNlovFz2-T5, TREX1-enNlovFz2, enNlovFz2-TREX1, CasTX-enNlovFz2, enNlovFz2-CasTX. At the same time, the parental NlovFz2 protein and the fusion proteins of this protein with T5 exonuclease, TREX1 exonuclease, and CasTX nuclease were set as controls. According to the methods in Examples 4 and 5, in human B2M endogenous gene loci (i.e., the above B2M -site), the editing efficiency was verified. The results are as Figure 5 shown. It can be seen that fusing T5 exonuclease, TREX1 exonuclease, or CasTX nuclease to the C-terminus of the NlovFz2 mutant protein in enNlovFz2 can enable the optimized system to obtain higher editing efficiency, and finally the enNlovFz2-T5 editing system with the highest efficiency was obtained (i.e., the system obtained by fusing T5 exonuclease to the C-terminus of the NlovFz2 mutant protein in enNlovFz2).
[0131] Example 8: Verification of the Editing Activity of enNlovFz2 at Different Human Endogenous Loci
[0132] The enNlovFz2 and enNlovFz2-T5 editing systems were used to verify the editing efficiency at different endogenous sites, and were compared with the enCnCas12f and enRhCas12f editing systems with the same TAM sequence, size and similar higher-order structures (References: Molecular basis and engineering of miniature Cas12f with C-rich PAM specificity; Engineered CRISPR-OsCas12f1 and RhCas12f1 with robust activities and expanded target range for genome editing) to verify the superiority of the enNlovFz2 (and enNlovFz2-T5) editing system.
[0133] Specifically, B2M -site-1, CXCR4 -site-1, CA2 -site-1, KRAS -site-1, DYRK1A -site-1, HPRT1 -site-1, DMD -site-1, DMD -site-2, DMD -site-3, DMD -site-4, DMD -site-5, TTR -site-1, TTR -site-2, TTR -site-3, TTR -site-4, TTR -site-5, PCSK9 -site-1, PCSK9 -site-2, PCSK9 -site-3, PCSK9 -site-4, PCSK9 -site-5, VEGFA -site-1, VEGFA -site-2, VEGFA -site-3, VEGFA -site-4, VEGFA -site-5, a total of 26 endogenous sites, among which B2M -site-1, CXCR4 -site-1, VEGFA -site-1, CA2 -site-1,KRAS -site-1, DYRK1A -site-1, HPRT1 -site-1, DMD -site-1 is a highly efficient editing site discovered in previous studies, and the remaining sites are for subsequent designs (see Figure 6c ). The editing activities of WT-NlovFz2, enNlovFz2, enNlovFz2-T5, enCnCas12f, and enRhCas12f were tested and compared on the above 26 endogenous sites respectively.
[0134] Specifically, according to the methods in Examples 2 and 3, that is, through processes such as cell transfection, flow sorting, cell genome extraction, and high-throughput library construction and sequencing, the editing efficiency was verified ( Figure 6a ). The results are as shown in Figure 6b and Figure 6d . Compared with the parental NlovFz2 system, the enNlovFz2 system has a significant improvement in the editing efficiency at human endogenous gene sites, and is higher than the enCnCas12f and enRhCas12f systems. Adding exonuclease T5 can further improve the editing efficiency of the enNlovFz2 system.
[0135] In summary, the optimized NlovFz2-ωRNA editing systems such as enNlovFz2 proposed in the present invention not only significantly improve the editing efficiency compared with the parental NlovFz2 system, but also have broad application prospects due to the following characteristics:
[0136] (1) The optimized NlovFz2-ωRNA editing system of the present invention (such as enNlovFz2) can perform efficient gene knockout and gene knock-in at multiple endogenous sites in the genomes of human and mammalian cells.
[0137] (2) The optimized NlovFz2-ωRNA editing system of the present invention (such as enNlovFz2) is small in size, facilitating the delivery of a single AAV, providing ideas for solving the packaging volume limitation, broadening the miniaturized high-efficiency gene editing toolbox, and increasing the application possibilities in the field of gene therapy.
[0138] (3) The optimized NlovFz2-ωRNA editing system of the present invention (such as enNlovFz2) has higher editing efficiency compared with enCnCas12f and enRhCas12f with similar structures and sizes and the same TAM sequence.
[0139] (4) The optimized NlovFz2-ω RNA editing system of the present invention (such as enNlovFz2) can also be used to construct gene mutation animal models, and the constructed related animal models can be used for the research of functional mechanisms and the development of new drugs in the biomedical field.
Claims
1. An editing system that recognizes target sites guided by optimized ωRNA, characterized in that: The editing system includes a recombinant vector for expressing an RNA-guided nuclease of eukaryotic origin and a mutant ωRNA backbone, the nuclease being the parental NlovFz2 protein, and the mutant ωRNA backbone including any one of the following mutation types that make the parental ωRNA backbone form an ωRNA backbone mutant: (a1) Deletion of nucleotides with a base of T at positions 105 bp, 106 bp, 112 bp, and 113 bp in the coding sequence of the parental ωRNA backbone; or, (a2) Deletion of nucleotides with a base of T at positions 104 bp, 105 bp, 106 bp, 112 bp, and 113 bp in the coding sequence of the parental ωRNA backbone; The coding sequence of the parental ωRNA backbone is as shown in SEQ.ID.NO.4; The amino acid sequence of the parental NlovFz2 protein is: Met Glu Pro Thr His Pro Pro Thr Asn Pro Ser Leu Ala His Gly Ile Ile ProPhe Trp Asp Glu Tyr Ser Gln Gln Val Ser Asp Lys Leu Trp Ala Cys Ser Arg AspSer Phe His Glu Phe Asn Gln Tyr Asn Asn Lys Gly Cys Thr Asp Gly Trp Phe AsnPhe Ser Gln Phe Thr Val Ile Glu Ser Gln Pro Val Phe Asp Val Pro Leu Asn ValHis His Ser Ile Thr Glu Asn Val Ala Phe Asp Asn Ser Lys Lys Pro Pro Gln LeuLys Lys Ala Lys Lys Gly Gln Lys Thr Pro Gln Lys Phe Gln Ala Asp Lys Ser MetLys Ile Arg Leu Tyr Pro Asn Glu Gln Glu Arg Thr Thr Leu Asn Gln Trp Met GlyThr Ala Arg Trp Ile Tyr Asn Lys Cys Leu Glu Phe Thr Asn Lys Ser Lys Gly ValLys Lys Asn Lys Lys Asn Phe Arg Thr Phe Val Val Asn Asn Asp Asn Tyr Gln ThrGlu Asn Gln Trp Val Val Asn Thr Pro Tyr Asp Val Arg Asp Ala Ala Ala Ile GluLeu Leu Thr Ala Phe Asn Thr Asn Phe Glu Lys Lys Lys Ala Gly Thr Ile Asp LysPhe Met Ile Arg Phe Arg Arg Lys Lys Asp Arg Lys Asp His Phe Val Leu Arg CysLys His Trp Lys Lys Lys Ser Gly Met Tyr Ser Phe Ile Arg Asn Ile Lys Ser AlaGlu Pro Leu Pro Glu Glu LeuGln Tyr Asp Ser Ile Ile Ile Lys Asn Lys Leu Asn His Tyr Tyr Leu Cys Ile Pro Gln Val Leu Asp Ile Arg Gly Glu Asn Gln Ala Pro Gln His Ser Gly Gln Val Val Ala Leu Asp Pro Gly Val Arg Thr Phe Gln Thr Thr Phe Asp Leu Asn Gly Tyr Ser Thr Lys Trp Gly Ser Gly Gly Ala Glu Arg Ile Gly Arg Leu Cys Cys Ala Tyr Asp Lys Leu Gln Ser Lys Trp Ser Gln Pro Glu Val Arg His Cys Lys Arg Tyr Lys Tyr Lys Arg Ala Gly Arg Arg Ile Gln Gln Lys Ile Arg Asn Ile Val Asp Asp Leu His Lys Lys Leu Cys Leu Trp Leu Cys Arg Asn Tyr Gln Val Ile Leu Leu Pro Ser Phe Glu Thr Gln Lys Met Val Lys Lys Leu His Arg Arg Ile Asn Ser Lys Thr Ala Arg Lys Met Leu Thr Trp Ser His Tyr Arg Phe Lys Gln Arg Leu Leu His Lys Ala Arg Glu His Pro Trp Thr His Ile Tyr Ile Val Asn Glu Ala Tyr Thr Ser Lys Thr Cys Ser Cys Cys Gly His Val Tyr Thr Val Gly Ser Ser Glu Val Phe Arg Cys Pro Ser Cys Gly Ser Ile Phe Asp Arg Asp Ile Asn Gly Ala Arg Asn Ile Leu Leu Arg Phe Leu Thr Thr His Arg Ile Ser Phe。 2. An editing system that uses optimized ωRNA to guide the recognition of target sites, characterized in that: The editing system includes a recombinant vector for expressing an RNA-guided nuclease of eukaryotic origin and a mutant ωRNA backbone, the nuclease being the parental NlovFz2 protein; the mutation type of the mutant ωRNA backbone is any combination of one of the following cases b1, b2, b3 and a1 or a2: (a1) Deletion of nucleotides with a base of T at positions 105 bp, 106 bp, 112 bp, and 113 bp in the coding sequence of the parental ωRNA backbone; (a2) Deletion of nucleotides with a base of T at positions 104 bp, 105 bp, 106 bp, 112 bp, and 113 bp in the coding sequence of the parental ωRNA backbone; (b1) Substitution of the nucleotide with a base of T at position 97 bp to a nucleotide with a base of C and substitution of the nucleotide with a base of A at position 120 bp to a nucleotide with a base of G in the coding sequence of the parental ωRNA backbone; (b2) Substitution of the nucleotide with a base of A at position 103 bp to a nucleotide with a base of G and substitution of the nucleotide with a base of T at position 114 bp to a nucleotide with a base of C in the coding sequence of the parental ωRNA backbone; (b3) Deletion of the nucleotide with a base of A at position 103 bp and the nucleotide with a base of T at position 114 bp in the coding sequence of the parental ωRNA backbone; The coding sequence of the parental ωRNA backbone is as shown in SEQ.ID.NO.4; The amino acid sequence of the parental NlovFz2 protein is: Met Glu Pro Thr His Pro Pro Thr Asn Pro Ser Leu Ala His Gly Ile Ile ProPhe Trp Asp Glu Tyr Ser Gln Gln Val Ser Asp Lys Leu Trp Ala Cys Ser Arg AspSer Phe His Glu Phe Asn Gln Tyr Asn Asn Lys Gly Cys Thr Asp Gly Trp Phe AsnPhe Ser Gln Phe Thr Val Ile Glu Ser Gln Pro Val Phe Asp Val Pro Leu Asn ValHis His Ser Ile Thr Glu Asn Val Ala Phe Asp Asn Ser Lys Lys Pro Pro Gln LeuLys Lys Ala Lys Lys Gly Gln Lys Thr Pro Gln Lys Phe Gln Ala Asp Lys Ser MetLys Ile Arg Leu Tyr Pro Asn Glu Gln Glu Arg Thr Thr Leu Asn Gln Trp Met GlyThr Ala Arg Trp Ile Tyr Asn Lys Cys Leu Glu Phe Thr Asn Lys Ser Lys Gly ValLys Lys Asn Lys Lys Asn Phe Arg Thr Phe Val Val Asn Asn Asp Asn Tyr Gln ThrGlu Asn Gln Trp Val Val Asn Thr Pro Tyr Asp Val Arg Asp Ala Ala Ala Ile GluLeu Leu Thr Ala Phe Asn Thr Asn Phe Glu Lys Lys Lys Ala Gly Thr Ile Asp LysPhe Met Ile Arg Phe Arg Arg Lys Lys Asp Arg Lys Asp His Phe Val Leu Arg CysLys His Trp Lys Lys Lys Ser Gly Met Tyr Ser Phe Ile Arg Asn Ile Lys Ser AlaGlu Pro Leu Pro Glu Glu LeuGln Tyr Asp Ser Ile Ile Ile Lys Asn Lys Leu Asn His Tyr Tyr Leu Cys Ile Pro Gln Val Leu Asp Ile Arg Gly Glu Asn Gln Ala Pro Gln His Ser Gly Gln Val Val Ala Leu Asp Pro Gly Val Arg Thr Phe Gln Thr Thr Phe Asp Leu Asn Gly Tyr Ser Thr Lys Trp Gly Ser Gly Gly Ala Glu Arg Ile Gly Arg Leu Cys Cys Ala Tyr Asp Lys Leu Gln Ser Lys Trp Ser Gln Pro Glu Val Arg His Cys Lys Arg Tyr Lys Tyr Lys Arg Ala Gly Arg Arg Ile Gln Gln Lys Ile Arg Asn Ile Val Asp Asp Leu His Lys Lys Leu Cys Leu Trp Leu Cys Arg Asn Tyr Gln Val Ile Leu Leu Pro Ser Phe Glu Thr Gln Lys Met Val Lys Lys Leu His Arg Arg Ile Asn Ser Lys Thr Ala Arg Lys Met Leu Thr Trp Ser His Tyr Arg Phe Lys Gln Arg Leu Leu His Lys Ala Arg Glu His Pro Trp Thr His Ile Tyr Ile Val Asn Glu Ala Tyr Thr Ser Lys Thr Cys Ser Cys Cys Gly His Val Tyr Thr Val Gly Ser Ser Glu Val Phe Arg Cys Pro Ser Cys Gly Ser Ile Phe Asp Arg Asp Ile Asn Gly Ala Arg Asn Ile Leu Leu Arg Phe Leu Thr Thr His Arg Ile Ser Phe。 3. An optimized NlovFz2-ω RNA editing system, characterized in that: The editing system includes a recombinant vector for expressing an NlovFz2 mutant protein and a mutant ωRNA backbone; The coding sequence of the mutant ωRNA backbone is the nucleotide sequence shown in SEQ.ID.NO.5, and the NlovFz2 mutant protein has a mutation at the following amino acid site of the parental NlovFz2 protein: position 6, position 44, position 178, or position 285, and the amino acid site is mutated to arginine; or, The coding sequence of the mutant ωRNA backbone is the nucleotide sequence shown in SEQ.ID.NO.
11. The NlovFz2 mutant protein has a mutation at the following amino acid site of the parental NlovFz2 protein: the 6th position, and the amino acid at this site is mutated to arginine; or, The coding sequence of the mutant ωRNA backbone is the nucleotide sequence shown in SEQ.ID.NO.
12. The NlovFz2 mutant protein has a mutation at the following amino acid site(s) of the parental NlovFz2 protein: the 6th or 285th position, and the amino acid at this site is mutated to arginine; The amino acid sequence of the parental NlovFz2 protein is: Met Glu Pro Thr His Pro Pro Thr Asn Pro Ser Leu Ala His Gly Ile Ile ProPhe Trp Asp Glu Tyr Ser Gln Gln Val Ser Asp Lys Leu Trp Ala Cys Ser Arg AspSer Phe His Glu Phe Asn Gln Tyr Asn Asn Lys Gly Cys Thr Asp Gly Trp Phe AsnPhe Ser Gln Phe Thr Val Ile Glu Ser Gln Pro Val Phe Asp Val Pro Leu Asn ValHis His Ser Ile Thr Glu Asn Val Ala Phe Asp Asn Ser Lys Lys Pro Pro Gln LeuLys Lys Ala Lys Lys Gly Gln Lys Thr Pro Gln Lys Phe Gln Ala Asp Lys Ser MetLys Ile Arg Leu Tyr Pro Asn Glu Gln Glu Arg Thr Thr Leu Asn Gln Trp Met GlyThr Ala Arg Trp Ile Tyr Asn Lys Cys Leu Glu Phe Thr Asn Lys Ser Lys Gly ValLys Lys Asn Lys Lys Asn Phe Arg Thr Phe Val Val Asn Asn Asp Asn Tyr Gln ThrGlu Asn Gln Trp Val Val Asn Thr Pro Tyr Asp Val Arg Asp Ala Ala Ala Ile GluLeu Leu Thr Ala Phe Asn Thr Asn Phe Glu Lys Lys Lys Ala Gly Thr Ile Asp LysPhe Met Ile Arg Phe Arg Arg Lys Lys Asp Arg Lys Asp His Phe Val Leu Arg CysLys His Trp Lys Lys Lys Ser Gly Met Tyr Ser Phe Ile Arg Asn Ile Lys Ser AlaGlu Pro Leu Pro Glu Glu LeuGln Tyr Asp Ser Ile Ile Ile Lys Asn Lys Leu Asn His Tyr Tyr Leu Cys Ile Pro Gln Val Leu Asp Ile Arg Gly Glu Asn Gln Ala Pro Gln His Ser Gly Gln Val Val Ala Leu Asp Pro Gly Val Arg Thr Phe Gln Thr Thr Phe Asp Leu Asn Gly Tyr Ser Thr Lys Trp Gly Ser Gly Gly Ala Glu Arg Ile Gly Arg Leu Cys Cys Ala Tyr Asp Lys Leu Gln Ser Lys Trp Ser Gln Pro Glu Val Arg His Cys Lys Arg Tyr Lys Tyr Lys Arg Ala Gly Arg Arg Ile Gln Gln Lys Ile Arg Asn Ile Val Asp Asp Leu His Lys Lys Leu Cys Leu Trp Leu Cys Arg Asn Tyr Gln Val Ile Leu Leu Pro Ser Phe Glu Thr Gln Lys Met Val Lys Lys Leu His Arg Arg Ile Asn Ser Lys Thr Ala Arg Lys Met Leu Thr Trp Ser His Tyr Arg Phe Lys Gln Arg Leu Leu His Lys Ala Arg Glu His Pro Trp Thr His Ile Tyr Ile Val Asn Glu Ala Tyr Thr Ser Lys Thr Cys Ser Cys Cys Gly His Val Tyr Thr Val Gly Ser Ser Glu Val Phe Arg Cys Pro Ser Cys Gly Ser Ile Phe Asp Arg Asp Ile Asn Gly Ala Arg Asn Ile Leu Leu Arg Phe Leu Thr Thr His Arg Ile Ser Phe。 4. The optimized NlovFz2-ω RNA editing system according to claim 3, wherein: The sequence of the recombinant vector is as shown in SEQ.ID.NO.
21.
5. An NlovFz2-ωRNA efficient editing system based on a fusion protein, characterized in that: The editing system includes a recombinant vector for expressing a fusion protein and a mutant ωRNA backbone. The fusion protein is composed of an NlovFz2 mutant protein, linker XTEN, and a modification component for enhancing cleavage activity. The modification component is specifically T5 exonuclease, TREX1 exonuclease, or CasTX nuclease that is fused and expressed with the NlovFz2 mutant protein; The coding sequence of the mutant ωRNA backbone is the nucleotide sequence shown in SEQ.ID.NO.
5. The NlovFz2 mutant protein has a mutation at the following amino acid site of the parental NlovFz2 protein: the 285th position, and the amino acid at this site is mutated to arginine; The amino acid sequence of the parental NlovFz2 protein is: Met Glu Pro Thr His Pro Pro Thr Asn Pro Ser Leu Ala His Gly Ile Ile ProPhe Trp Asp Glu Tyr Ser Gln Gln Val Ser Asp Lys Leu Trp Ala Cys Ser Arg AspSer Phe His Glu Phe Asn Gln Tyr Asn Asn Lys Gly Cys Thr Asp Gly Trp Phe AsnPhe Ser Gln Phe Thr Val Ile Glu Ser Gln Pro Val Phe Asp Val Pro Leu Asn ValHis His Ser Ile Thr Glu Asn Val Ala Phe Asp Asn Ser Lys Lys Pro Pro Gln LeuLys Lys Ala Lys Lys Gly Gln Lys Thr Pro Gln Lys Phe Gln Ala Asp Lys Ser MetLys Ile Arg Leu Tyr Pro Asn Glu Gln Glu Arg Thr Thr Leu Asn Gln Trp Met GlyThr Ala Arg Trp Ile Tyr Asn Lys Cys Leu Glu Phe Thr Asn Lys Ser Lys Gly ValLys Lys Asn Lys Lys Asn Phe Arg Thr Phe Val Val Asn Asn Asp Asn Tyr Gln ThrGlu Asn Gln Trp Val Val Asn Thr Pro Tyr Asp Val Arg Asp Ala Ala Ala Ile GluLeu Leu Thr Ala Phe Asn Thr Asn Phe Glu Lys Lys Lys Ala Gly Thr Ile Asp LysPhe Met Ile Arg Phe Arg Arg Lys Lys Asp Arg Lys Asp His Phe Val Leu Arg CysLys His Trp Lys Lys Lys Ser Gly Met Tyr Ser Phe Ile Arg Asn Ile Lys Ser AlaGlu Pro Leu Pro Glu Glu LeuGln Tyr Asp Ser Ile Ile Ile Lys Asn Lys Leu Asn His Tyr Tyr Leu Cys Ile Pro Gln Val Leu Asp Ile Arg Gly Glu Asn Gln Ala Pro Gln His Ser Gly Gln Val Val Ala Leu Asp Pro Gly Val Arg Thr Phe Gln Thr Thr Phe Asp Leu Asn Gly Tyr Ser Thr Lys Trp Gly Ser Gly Gly Ala Glu Arg Ile Gly Arg Leu Cys Cys Ala Tyr Asp Lys Leu Gln Ser Lys Trp Ser Gln Pro Glu Val Arg His Cys Lys Arg Tyr Lys Tyr Lys Arg Ala Gly Arg Arg Ile Gln Gln Lys Ile Arg Asn Ile Val Asp Asp Leu His Lys Lys Leu Cys Leu Trp Leu Cys Arg Asn Tyr Gln Val Ile Leu Leu Pro Ser Phe Glu Thr Gln Lys Met Val Lys Lys Leu His Arg Arg Ile Asn Ser Lys Thr Ala Arg Lys Met Leu Thr Trp Ser His Tyr Arg Phe Lys Gln Arg Leu Leu His Lys Ala Arg Glu His Pro Trp Thr His Ile Tyr Ile Val Asn Glu Ala Tyr Thr Ser Lys Thr Cys Ser Cys Cys Gly His Val Tyr Thr Val Gly Ser Ser Glu Val Phe Arg Cys Pro Ser Cys Gly Ser Ile Phe Asp Arg Asp Ile Asn Gly Ala Arg Asn Ile Leu Leu Arg Phe Leu Thr Thr His Arg Ile Ser Phe。 6. A composition of an RNA-guided nuclease system derived from eukaryotes, characterized in that: The composition includes a first nucleic acid and a second nucleic acid. The first nucleic acid is a vector for expressing the parental NlovFz2 protein, and the second nucleic acid is a vector for expressing a mutant ωRNA backbone. The mutant ωRNA backbone includes any one of the following mutation types that cause the parental ωRNA backbone to form an ωRNA backbone mutant: (a1) Deletion of nucleotides with bases T at positions 105 bp, 106 bp, 112 bp, and 113 bp in the coding sequence of the parental ωRNA backbone; or, (a2) Deletion of nucleotides with bases T at positions 104 bp, 105 bp, 106 bp, 112 bp, and 113 bp in the coding sequence of the parental ωRNA backbone; The coding sequence of the parental ωRNA backbone is as shown in SEQ.ID.NO.4; The amino acid sequence of the parental NlovFz2 protein is: Met Glu Pro Thr His Pro Pro Thr Asn Pro Ser Leu Ala His Gly Ile Ile ProPhe Trp Asp Glu Tyr Ser Gln Gln Val Ser Asp Lys Leu Trp Ala Cys Ser Arg AspSer Phe His Glu Phe Asn Gln Tyr Asn Asn Lys Gly Cys Thr Asp Gly Trp Phe AsnPhe Ser Gln Phe Thr Val Ile Glu Ser Gln Pro Val Phe Asp Val Pro Leu Asn ValHis His Ser Ile Thr Glu Asn Val Ala Phe Asp Asn Ser Lys Lys Pro Pro Gln LeuLys Lys Ala Lys Lys Gly Gln Lys Thr Pro Gln Lys Phe Gln Ala Asp Lys Ser MetLys Ile Arg Leu Tyr Pro Asn Glu Gln Glu Arg Thr Thr Leu Asn Gln Trp Met GlyThr Ala Arg Trp Ile Tyr Asn Lys Cys Leu Glu Phe Thr Asn Lys Ser Lys Gly ValLys Lys Asn Lys Lys Asn Phe Arg Thr Phe Val Val Asn Asn Asp Asn Tyr Gln ThrGlu Asn Gln Trp Val Val Asn Thr Pro Tyr Asp Val Arg Asp Ala Ala Ala Ile GluLeu Leu Thr Ala Phe Asn Thr Asn Phe Glu Lys Lys Lys Ala Gly Thr Ile Asp LysPhe Met Ile Arg Phe Arg Arg Lys Lys Asp Arg Lys Asp His Phe Val Leu Arg CysLys His Trp Lys Lys Lys Ser Gly Met Tyr Ser Phe Ile Arg Asn Ile Lys Ser AlaGlu Pro Leu Pro Glu Glu LeuGln Tyr Asp Ser Ile Ile Ile Lys Asn Lys Leu Asn His Tyr Tyr Leu Cys Ile Pro Gln Val Leu Asp Ile Arg Gly Glu Asn Gln Ala Pro Gln His Ser Gly Gln Val Val Ala Leu Asp Pro Gly Val Arg Thr Phe Gln Thr Thr Phe Asp Leu Asn Gly Tyr Ser Thr Lys Trp Gly Ser Gly Gly Ala Glu Arg Ile Gly Arg Leu Cys Cys Ala Tyr Asp Lys Leu Gln Ser Lys Trp Ser Gln Pro Glu Val Arg His Cys Lys Arg Tyr Lys Tyr Lys Arg Ala Gly Arg Arg Ile Gln Gln Lys Ile Arg Asn Ile Val Asp Asp Leu His Lys Lys Leu Cys Leu Trp Leu Cys Arg Asn Tyr Gln Val Ile Leu Leu Pro Ser Phe Glu Thr Gln Lys Met Val Lys Lys Leu His Arg Arg Ile Asn Ser Lys Thr Ala Arg Lys Met Leu Thr Trp Ser His Tyr Arg Phe Lys Gln Arg Leu Leu His Lys Ala Arg Glu His Pro Trp Thr His Ile Tyr Ile Val Asn Glu Ala Tyr Thr Ser Lys Thr Cys Ser Cys Cys Gly His Val Tyr Thr Val Gly Ser Ser Glu Val Phe Arg Cys Pro Ser Cys Gly Ser Ile Phe Asp Arg Asp Ile Asn Gly Ala Arg Asn Ile Leu Leu Arg Phe Leu Thr Thr His Arg Ile Ser Phe。 7. A composition of an RNA-guided nuclease system derived from eukaryotes, characterized in that: The composition includes a first nucleic acid and a second nucleic acid. The first nucleic acid is a vector for expressing the NlovFz2 mutant protein, and the second nucleic acid is a vector for expressing a mutant ωRNA backbone; The coding sequence of the mutant ωRNA backbone is the nucleotide sequence shown in SEQ.ID.NO.
5. The NlovFz2 mutant protein has a mutation at the following amino acid site(s) of the parental NlovFz2 protein: the 6th, 44th, 178th, or 285th position, and the amino acid at this site is mutated to arginine; or, The coding sequence of the mutant ωRNA backbone is the nucleotide sequence shown in SEQ.ID.NO.11, and the NlovFz2 mutant protein has a mutation at the following amino acid site of the parental NlovFz2 protein: position 6, and the amino acid site is mutated to arginine; or, The coding sequence of the mutant ωRNA backbone is the nucleotide sequence shown in SEQ.ID.NO.12, and the NlovFz2 mutant protein has a mutation at the following amino acid site of the parental NlovFz2 protein: position 6 or position 285, and the amino acid site is mutated to arginine; The amino acid sequence of the parental NlovFz2 protein is: Met Glu Pro Thr His Pro Pro Thr Asn Pro Ser Leu Ala His Gly Ile Ile ProPhe Trp Asp Glu Tyr Ser Gln Gln Val Ser Asp Lys Leu Trp Ala Cys Ser Arg AspSer Phe His Glu Phe Asn Gln Tyr Asn Asn Lys Gly Cys Thr Asp Gly Trp Phe AsnPhe Ser Gln Phe Thr Val Ile Glu Ser Gln Pro Val Phe Asp Val Pro Leu Asn ValHis His Ser Ile Thr Glu Asn Val Ala Phe Asp Asn Ser Lys Lys Pro Pro Gln LeuLys Lys Ala Lys Lys Gly Gln Lys Thr Pro Gln Lys Phe Gln Ala Asp Lys Ser MetLys Ile Arg Leu Tyr Pro Asn Glu Gln Glu Arg Thr Thr Leu Asn Gln Trp Met GlyThr Ala Arg Trp Ile Tyr Asn Lys Cys Leu Glu Phe Thr Asn Lys Ser Lys Gly ValLys Lys Asn Lys Lys Asn Phe Arg Thr Phe Val Val Asn Asn Asp Asn Tyr Gln ThrGlu Asn Gln Trp Val Val Asn Thr Pro Tyr Asp Val Arg Asp Ala Ala Ala Ile GluLeu Leu Thr Ala Phe Asn Thr Asn Phe Glu Lys Lys Lys Ala Gly Thr Ile Asp LysPhe Met Ile Arg Phe Arg Arg Lys Lys Asp Arg Lys Asp His Phe Val Leu Arg CysLys His Trp Lys Lys Lys Ser Gly Met Tyr Ser Phe Ile Arg Asn Ile Lys Ser AlaGlu Pro Leu Pro Glu Glu LeuGln Tyr Asp Ser Ile Ile Ile Lys Asn Lys Leu Asn His Tyr Tyr Leu Cys Ile Pro Gln Val Leu Asp Ile Arg Gly Glu Asn Gln Ala Pro Gln His Ser Gly Gln Val Val Ala Leu Asp Pro Gly Val Arg Thr Phe Gln Thr Thr Phe Asp Leu Asn Gly Tyr Ser Thr Lys Trp Gly Ser Gly Gly Ala Glu Arg Ile Gly Arg Leu Cys Cys Ala Tyr Asp Lys Leu Gln Ser Lys Trp Ser Gln Pro Glu Val Arg His Cys Lys Arg Tyr Lys Tyr Lys Arg Ala Gly Arg Arg Ile Gln Gln Lys Ile Arg Asn Ile Val Asp Asp Leu His Lys Lys Leu Cys Leu Trp Leu Cys Arg Asn Tyr Gln Val Ile Leu Leu Pro Ser Phe Glu Thr Gln Lys Met Val Lys Lys Leu His Arg Arg Ile Asn Ser Lys Thr Ala Arg Lys Met Leu Thr Trp Ser His Tyr Arg Phe Lys Gln Arg Leu Leu His Lys Ala Arg Glu His Pro Trp Thr His Ile Tyr Ile Val Asn Glu Ala Tyr Thr Ser Lys Thr Cys Ser Cys Cys Gly His Val Tyr Thr Val Gly Ser Ser Glu Val Phe Arg Cys Pro Ser Cys Gly Ser Ile Phe Asp Arg Asp Ile Asn Gly Ala Arg Asn Ile Leu Leu Arg Phe Leu Thr Thr His Arg Ile Ser Phe。 8. A composition of an RNA-guided nuclease system derived from eukaryotes, characterized in that: The composition comprises a first nucleic acid and a second nucleic acid. The first nucleic acid is a vector for expressing a fusion protein, and the second nucleic acid is a vector for expressing a mutant ωRNA backbone; the fusion protein is composed of an NlovFz2 mutant protein, a linker XTEN, and a modification component for enhancing cleavage activity, and the modification component is specifically a T5 exonuclease, a TREX1 exonuclease, or a CasTX nuclease that is fused and expressed with the NlovFz2 mutant protein; The coding sequence of the mutant ωRNA backbone is the nucleotide sequence shown in SEQ.ID.NO.5, and the NlovFz2 mutant protein has a mutation at the following amino acid site of the parental NlovFz2 protein: position 285, and the amino acid site is mutated to arginine; The amino acid sequence of the parental NlovFz2 protein is: Met Glu Pro Thr His Pro Pro Thr Asn Pro Ser Leu Ala His Gly Ile Ile ProPhe Trp Asp Glu Tyr Ser Gln Gln Val Ser Asp Lys Leu Trp Ala Cys Ser Arg AspSer Phe His Glu Phe Asn Gln Tyr Asn Asn Lys Gly Cys Thr Asp Gly Trp Phe AsnPhe Ser Gln Phe Thr Val Ile Glu Ser Gln Pro Val Phe Asp Val Pro Leu Asn ValHis His Ser Ile Thr Glu Asn Val Ala Phe Asp Asn Ser Lys Lys Pro Pro Gln LeuLys Lys Ala Lys Lys Gly Gln Lys Thr Pro Gln Lys Phe Gln Ala Asp Lys Ser MetLys Ile Arg Leu Tyr Pro Asn Glu Gln Glu Arg Thr Thr Leu Asn Gln Trp Met GlyThr Ala Arg Trp Ile Tyr Asn Lys Cys Leu Glu Phe Thr Asn Lys Ser Lys Gly ValLys Lys Asn Lys Lys Asn Phe Arg Thr Phe Val Val Asn Asn Asp Asn Tyr Gln ThrGlu Asn Gln Trp Val Val Asn Thr Pro Tyr Asp Val Arg Asp Ala Ala Ala Ile GluLeu Leu Thr Ala Phe Asn Thr Asn Phe Glu Lys Lys Lys Ala Gly Thr Ile Asp LysPhe Met Ile Arg Phe Arg Arg Lys Lys Asp Arg Lys Asp His Phe Val Leu Arg CysLys His Trp Lys Lys Lys Ser Gly Met Tyr Ser Phe Ile Arg Asn Ile Lys Ser AlaGlu Pro Leu Pro Glu Glu LeuGln Tyr Asp Ser Ile Ile Ile Lys Asn Lys Leu Asn His Tyr Tyr Leu Cys Ile Pro Gln Val Leu Asp Ile Arg Gly Glu Asn Gln Ala Pro Gln His Ser Gly Gln Val Val Ala Leu Asp Pro Gly Val Arg Thr Phe Gln Thr Thr Phe Asp Leu Asn Gly Tyr Ser Thr Lys Trp Gly Ser Gly Gly Ala Glu Arg Ile Gly Arg Leu Cys Cys Ala Tyr Asp Lys Leu Gln Ser Lys Trp Ser Gln Pro Glu Val Arg His Cys Lys Arg Tyr Lys Tyr Lys Arg Ala Gly Arg Arg Ile Gln Gln Lys Ile Arg Asn Ile Val Asp Asp Leu His Lys Lys Leu Cys Leu Trp Leu Cys Arg Asn Tyr Gln Val Ile Leu Leu Pro Ser Phe Glu Thr Gln Lys Met Val Lys Lys Leu His Arg Arg Ile Asn Ser Lys Thr Ala Arg Lys Met Leu Thr Trp Ser His Tyr Arg Phe Lys Gln Arg Leu Leu His Lys Ala Arg Glu His Pro Trp Thr His Ile Tyr Ile Val Asn Glu Ala Tyr Thr Ser Lys Thr Cys Ser Cys Cys Gly His Val Tyr Thr Val Gly Ser Ser Glu Val Phe Arg Cys Pro Ser Cys Gly Ser Ile Phe Asp Arg Asp Ile Asn Gly Ala Arg Asn Ile Leu Leu Arg Phe Leu Thr Thr His Arg Ile Ser Phe。 9. Use of the editing system according to claims 1, 2, 3, 5 or the composition according to claims 6, 7, 8 in gene editing.
10. Use of the editing system according to claims 1, 2, 3, 5 or the composition according to claims 6, 7, 8 in the preparation of a preparation.
Citation Information
Patent Citations
TnpB editing system and application thereof
CN117737034A
Reprogrammable fanzor polynucleotides and uses thereof
WO2024259295A2
Deaminase, fusion protein, nucleic acid, pharmaceutical composition and use thereof
WO2025119295A1