Construction method and application of A41L gene deleted oncolytic vaccinia virus vector

Abstract

The invention relates to a novel oncolytic vaccinia virus vector VVL [delta] TK [delta] N1L [delta] A41L-RFP and VVL [delta] TK [delta] N1L [delta] A41L-IL-27 with deletion of A41L genes and an application of the novel oncolytic vaccinia virus vector VVL [delta] TK [delta] N1L [delta] A41L-IL-27. The novel oncolytic vaccinia virus vector VVL [delta] TK [delta] N1L [delta] A41L-RFP is a vaccinia virus Lister strain, a TK gene, an N1L gene and an A41L gene are deleted at a fixed point, and the vector has tumor targeting, can carry an exogenous therapeutic gene, and is used for treating various solid tumors. The vaccinia virus vector VVL [delta] TK [delta] N1L [delta] A41L-IL-27 can kill tumor cells and express interleukin 27 at the same time, and the vaccinia virus vector VVL [delta] TK [delta] N1L [delta] A41L-IL-27 and the oncolytic vaccinia virus have a stronger anti-tumor effect. The virus vectors VVL [delta] TK [delta] N1L [delta] A41L-RFP and VVL [delta] TK [delta] N1L [delta] A41L-IL-27 provided by the invention can be used as a potential novel gene therapy drug for treating pancreatic cancer, colon cancer, lung cancer and other tumors.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering biotechnology, and in particular to a construction method and application of a novel oncolytic vaccinia virus vector with A41L gene deleted. Background Art

[0002] Oncolytic virus therapy is a new cancer immunotherapy strategy that has attracted much attention. Oncolytic viruses are a class of natural or genetically engineered viruses that can target and infect and kill tumor cells without damaging normal cells. Among many oncolytic virus studies, vaccinia virus has the advantages of high safety, wide host range, short replication cycle, no risk of host genome integration, large capacity for inserting exogenous genomes, and intravenous delivery, and has strong development potential. Among them, the oncolytic vaccinia virus Lister strain (VVL) can stably replicate and express exogenous therapeutic genes in a hypoxic environment, and is more suitable for the treatment of pancreatic cancer and other hypoxic tumors. The oncolytic vaccinia virus VVLΔTKΔN1L with thymidine kinase (TK) gene and N1L gene deletion has been constructed, which significantly improves the safety and anti-tumor activity of this type of oncolytic virus. However, the oncolytic vaccinia virus vector cannot completely cure the tumor, and further optimization is needed to improve its safety and anti-tumor effect.

[0003] The A41L gene of vaccinia virus encodes a 30 kDa glycoprotein that is similar to the viral chemokine binding protein (vCKB) and can interfere with chemokine-mediated leukocyte migration to the site of infection, mediating anti-inflammatory effects in vivo. Genome sequencing has shown that A41L is a highly conserved gene encoded by all studied orthopoxvirus species and strains (more than 70 in total). However, it is not a gene essential for viral replication. The vaccinia virus WR strain lacking the A41L gene can form normal-sized plaques with the same titer as the wild-type virus. In addition, in a rabbit intradermal infection model, the loss of the A41L gene increased immunopathology and infiltration of inflammatory cells into the site of infection. It has been reported that the immunogenicity and vaccine efficacy of WR strains and MVA strains lacking the A41L gene are enhanced and depend on CD8 + The infiltration of T cells increased. Therefore, deletion of the A41L gene is expected to enhance the anti-tumor effect and safety of vaccinia virus.

[0004] Interleukin 27 (IL-27) is a new member of the IL-12 family, mainly produced by activated dendritic cells, monocytes and macrophages and other antigen-presenting cells. It is a pleiotropic cytokine with both pro-inflammatory and anti-inflammatory functions, and can enhance the body's immune response by enhancing cellular and humoral immunity. Studies have shown that IL-27 has a strong anti-tumor effect in preclinical models, and its anti-tumor mechanism mainly depends on increasing the expression of tumor antigen-specific CD8 + T cell survival rate, promote NK cell activation, inhibit angiogenesis, increase M1 polarized tumor-associated macrophages, induce Treg exhaustion, and directly inhibit tumor proliferation. However, IL-27 has a short half-life in vivo. Therefore, how to arm IL-27 to a new oncolytic vaccinia virus vector to make it have a better anti-tumor effect is an important technical problem that needs to be solved. Summary of the invention

[0005] The present invention provides a method for constructing a novel oncolytic vaccinia virus vector with three genes deleted, namely, TK, N1L and A41L, and specifically provides a novel oncolytic vaccinia virus vector VVLΔTKΔN1LΔA41L-RFP with A41L gene deleted (hereinafter referred to as VVL-TD-RFP) and a novel oncolytic vaccinia virus vector VVLΔTKΔN1LΔA41L-m / hIL-27 expressing mouse or human IL-27 (hereinafter referred to as VVL-TD-m / hIL-27) and an application thereof.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] A method for constructing a novel oncolytic vaccinia virus vector, wherein the vaccinia virus vector is a vaccinia virus Lister strain, wherein the TK gene, the N1L gene and the A41L gene are site-specifically deleted, and a gene that helps treat tumors is inserted. The gene for treating tumors is a mouse IL-27 gene or a human IL-27 gene;

[0008] The novel oncolytic vaccinia virus vector is VVLΔTKΔN1LΔA41L-RFP, and the construction method includes the following steps:

[0009] (1) Using gene synthesis technology, the upstream sequence of the A41L gene SEQ ID NO: 1, the reporter gene red fluorescent protein SEQ ID NO: 2, and the downstream sequence of the A41L gene SEQ ID NO: 3 were sequentially connected to the plasmid vector pUC57 to construct the pUC-A41L plasmid;

[0010] (2) Designing the sequence gRNA according to the A41L gene sequence: SEQ ID NO: 4, connecting the gRNA to the PB-gRNA vector to construct the PB-gRNA-A41L plasmid;

[0011] (3) CV1 cells in good condition were inoculated into 6-well plates, and when the cell confluence reached more than 90%, Cas9 plasmid and PB-gRNA-A41L plasmid were transfected at the same time; 24 hours later, oncolytic vaccinia virus VVLΔTKΔN1L lacking TK gene and N1L gene was added to the 6-well plate; 2 hours later, pUC-A41L plasmid was transfected; 48 hours later, the cell and supernatant mixture was collected, frozen and thawed 3 times, and added to the 6-well plate filled with CV1 cells at 1 μL / well, and cultured in an incubator containing 5% CO2 at 37°C for 48 hours; monoclonal virus emitting red fluorescence was picked under a fluorescence microscope, frozen and thawed 3 times, and 1 μL of monoclonal virus was added to the 6-well plate filled with CV1 cells; thereafter, monoclonal virus expressing red fluorescence was picked once every 48 hours until all wells expressed red fluorescence, indicating that the oncolytic vaccinia virus vector VVLΔTKΔN1LΔA41L-RFP screening was successful.

[0012] The oncolytic vaccinia virus vector is VVLΔTKΔN1LΔA41L-IL-27, and the construction method includes the following steps:

[0013] (1) Using gene synthesis technology, the upstream sequence of the A41L gene SEQ ID NO: 1, the reporter gene red fluorescent protein sequence SEQ ID NO: 2, and the downstream sequence of the A41L gene SEQ ID NO: 3 were sequentially connected to the plasmid vector pUC57 to construct the pUC-A41L plasmid;

[0014] (2) Designing the gRNA sequence according to the A41L gene sequence: SEQ ID NO: 4, connecting the gRNA sequence to the PB-gRNA vector to construct the PB-gRNA-A41L plasmid;

[0015] (3) synthesizing plasmids from the mouse IL-27 gene sequence SEQ ID NO: 5 and the human IL-27 gene sequence SEQ ID NO: 6 using gene synthesis technology to obtain mouse pUC-mIL-27 plasmid and human pUC-hIL-27 plasmid; digesting the pUC-A41L plasmid, pUC-mIL-27 plasmid and pUC-hIL-27 plasmid with SalⅠ and NheⅠ enzymes, respectively, to obtain A41L fragment, mIL-27 fragment and hIL-27 fragment; ligating the A41L fragment and the mIL-27 fragment with T4 ligase, and ligating the A41L fragment and the hIL-27 fragment with T4 ligase, respectively, to construct pUC-A41L-mIL-27 plasmid and pUC-A41L-hIL-27 plasmid;

[0016] (4) CV1 cells in good condition were inoculated into 6-well plates, and when the cell confluence reached more than 90%, Cas9 and PB-gRNA-A41L plasmids were transfected at the same time; 24 hours later, oncolytic vaccinia virus VVLΔTKΔN1L with TK gene and N1L gene deletion was added to the 6-well plate; 2 hours later, pUC-A41L-mIL-27 plasmid and pUC-A41L-hIL-27 plasmid were transfected respectively; 48 hours later, the cell and supernatant mixture was collected, frozen and thawed 3 times, and added to the 6-well plate filled with CV1 cells at 1 μL / well, with 6 wells for each virus, in a 5% The cells were cultured in a CO2-free 37°C incubator for 48 hours; monoclonal viruses emitting red fluorescence were picked up under a fluorescence microscope, frozen and thawed three times, and 1 μL was added to a 6-well plate filled with CV1 cells; thereafter, monoclonal viruses expressing red fluorescence were picked up once every 48 hours until all wells expressed red fluorescence, indicating that the oncolytic vaccinia virus vectors VVLΔTKΔN1LΔA41L-mIL-27 and VVLΔTKΔN1LΔA41L-hIL-27 were successfully screened.

[0017] The obtained novel oncolytic vaccinia virus vector VVLΔTKΔN1LΔA41L-RFP can be used in the preparation of tumor treatment drugs; the obtained novel oncolytic vaccinia virus vector VVLΔTKΔN1LΔA41L-IL-27 can be used in the preparation of tumor treatment drugs. The tumor is a solid tumor, including pancreatic cancer, colon cancer, esophageal cancer, lung cancer, kidney cancer, head and neck tumors, breast cancer, and ovarian cancer.

[0018] Beneficial effects of the present invention:

[0019] (1) The tumor-targeted vaccinia virus vectors VVL-TD-RFP and VVL-TD-m / hIL-27 provided by the present invention specifically delete the TK gene, N1L gene and A41L gene, and insert the IL-27 gene that helps treat tumors. They are targeted and can be used to treat various solid tumors.

[0020] (2) Compared with the oncolytic vaccinia virus vector VVLΔTKΔN1L, the novel oncolytic vaccinia virus vector VVL-TD-RFP of the present invention can effectively kill tumor cells and has a stronger anti-tumor effect in the mouse subcutaneous pancreatic cancer tumor model without obvious toxicity.

[0021] (3) The novel oncolytic vaccinia virus vector VVL-TD-IL-27 of the present invention is the first to arm the IL-27 gene on the oncolytic vaccinia virus. In vitro experiments have shown that it can kill tumor cells, and the oncolytic virus can express and produce IL-27 while replicating in tumor cells, and synergize with the oncolytic virus to induce a stronger anti-tumor immune response. Compared with VVL-TD-RFP, the vaccinia virus vector VVL-TD-IL-27 has enhanced anti-tumor effects in multiple mouse pancreatic cancer models and has no obvious toxicity.

[0022] (4) The oncolytic vaccinia virus vectors VVL-TD-RFP and VVL-TD-IL-27 of the present invention can be injected not only into the tumor, but also for intraperitoneal injection and intravenous injection, which is easy to use and expands the range of treatable patients.

[0023] (5) The oncolytic vaccinia virus of the present invention has an anti-tumor effect, laying a foundation for the clinical application of tumor-targeted genetic engineering drugs and providing an effective method for tumor treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a schematic diagram of the A41L region structure of the oncolytic vaccinia virus vector VVL-TD-RFP;

[0025] Figure 2 This is a schematic diagram of the A41L region structure of the oncolytic vaccinia virus vector VVL-TD-IL-27;

[0026] Figure 3 The killing effect of VVL-TD-RFP and VVLΔTKΔN1L on mouse pancreatic cancer cells and colon cancer cells;

[0027] Figure 4 The killing effect of VVL-TD-RFP and VVLΔTKΔN1L on hamster pancreatic cancer cells;

[0028] Figure 5 The killing effect of VVL-TD-RFP and VVLΔTKΔN1L on mouse lung cancer cells;

[0029] Figure 6 Comparison of the anti-tumor effects of VVL-TD-RFP and VVLΔTKΔN1L in the pancreatic cancer DT6606 subcutaneous transplant tumor model of C57BL / 6 mice;

[0030] Figure 7 Comparison of tumor clearance rates between VVL-TD-RFP and VVLΔTKΔN1L in the pancreatic cancer DT6606 subcutaneous xenograft tumor model of C57BL / 6 mice;

[0031] Figure 8Comparison of body weight changes between VVL-TD-RFP and VVLΔTKΔN1L in the pancreatic cancer DT6606 subcutaneous transplant tumor model of C57BL / 6 mice;

[0032] Fig. 9 The killing effect of VVL-TD-IL-27 and VVL-TD-RFP on mouse pancreatic cancer cells and colon cancer cells;

[0033] Fig.10 The killing effect of VVL-TD-IL-27 and VVL-TD-RFP on hamster pancreatic cancer cells;

[0034] Fig.11 The killing effect of VVL-TD-IL-27 and VVL-TD-RFP on mouse lung cancer cells;

[0035] Fig.12 The expression of mIL-27 in mouse pancreatic cancer cells after VVL-TD-mIL-27 and VVL-TD-RFP infection;

[0036] Fig.13 The expression of hIL-27 after VVL-TD-hIL-27 and VVL-TD-RFP infected hamster pancreatic cancer cells;

[0037] Fig.14 To compare the anti-tumor effects of VVL-TD-mIL-27 and VVL-TD-RFP in the pancreatic cancer DT6606 subcutaneous transplanted tumor model of C57BL / 6 mice;

[0038] Fig.15 Comparison of tumor clearance rates between VVL-TD-mIL-27 and VVL-TD-RFP in the pancreatic cancer DT6606 subcutaneous transplanted tumor model of C57BL / 6 mice;

[0039] Fig.16 Comparison of body weight changes between VVL-TD-mIL-27 and VVL-TD-RFP in the pancreatic cancer DT6606 subcutaneous transplant tumor model of C57BL / 6 mice;

[0040] Fig.17 To compare the anti-tumor effects of VVL-TD-mIL-27 and VVL-TD-RFP in the pancreatic cancer TB11381 subcutaneous transplant tumor model of C57BL / 6 mice;

[0041] Fig.18 Comparison of tumor clearance rates of VVL-TD-mIL-27 and VVL-TD-RFP in the pancreatic cancer TB11381 subcutaneous xenograft tumor model of C57BL / 6 mice;

[0042] Fig.19 Comparison of body weight changes between VVL-TD-mIL-27 and VVL-TD-RFP in the TB11381 pancreatic cancer subcutaneous transplant tumor model in C57BL / 6 mice. DETAILED DESCRIPTION

[0043] The present invention is further described below by way of examples.

[0044] Example 1: Construction of a novel oncolytic vaccinia virus vector VVLΔTKΔN1LΔA41L-RFP

[0045] (1) Using gene synthesis technology, the upstream sequence of the A41L gene SEQ ID NO: 1, the reporter gene red fluorescent protein SEQ ID NO: 2, and the downstream sequence of the A41L gene SEQ ID NO: 3 were sequentially connected to the plasmid vector pUC57 to construct the pUC-A41L plasmid;

[0046] (2) Designing the sequence gRNA according to the A41L gene sequence: SEQ ID NO: 4, connecting the gRNA to the PB-gRNA vector to construct the PB-gRNA-A41L plasmid;

[0047] (3) CV1 cells in good condition were inoculated into 6-well plates. When the cells reached 90% confluence, Cas9 and PB-gRNA-A41L plasmids were transfected at the same time. After 24 hours, oncolytic vaccinia virus VVLΔTKΔN1L lacking TK gene and N1L gene was added to the 6-well plates. After 2 hours, pUC-A41L plasmid was transfected. After 48 hours, the cell and supernatant mixture was collected, frozen and thawed 3 times, and added to the 6-well plates filled with CV1 cells at 1 μL / well (6 wells in total). The cells were cultured in a CO2-free 37°C incubator for 48 hours. According to the characteristics of the newly constructed viral vector expressing red fluorescent protein, the monoclonal virus emitting red fluorescence was picked under a fluorescence microscope, frozen and thawed three times, and 1 μL was added to a 6-well plate full of CV1 cells. Thereafter, the monoclonal virus expressing red fluorescence was picked once every 48 hours until all wells expressed red fluorescence, indicating that the new oncolytic vaccinia virus vector VVLΔTKΔN1LΔA41L-RFP (VVL-TD-RFP) was successfully screened.

[0048] The regional structure of the viral vector VVL-TD-RFP is shown in Figure 1 .

[0049] Example 2: Construction of a novel oncolytic vaccinia virus vector VVLΔTKΔN1LΔA41L-IL-27

[0050] (1) Using gene synthesis technology, the upstream sequence of the A41L gene SEQ ID NO: 1, the reporter gene red fluorescent protein sequence SEQ ID NO: 2, and the downstream sequence of the A41L gene SEQ ID NO: 3 were sequentially connected to the plasmid vector pUC57 to construct the pUC-A41L plasmid;

[0051] (2) Designing the gRNA sequence according to the A41L gene sequence: SEQ ID NO: 4, connecting the gRNA sequence to the PB-gRNA vector to construct the PB-gRNA-A41L plasmid;

[0052] (3) The mouse IL-27 gene sequence SEQ ID NO: 5 and the human IL-27 gene sequence SEQ ID NO: 6 were synthesized by gene synthesis technology to obtain the plasmid pUC-mIL-27 containing the mouse IL-27 gene and the plasmid pUC-hIL-27 containing the human IL-27 gene; the pUC-A41L plasmid, pUC-mIL-27 plasmid and pUC-hIL-27 plasmid were digested with SalⅠ and NheⅠ enzymes to obtain the A41L fragment, the mIL-27 fragment and the hIL-27 fragment; the A41L fragment and the mIL-27 fragment were connected with T4 ligase, and the A41L fragment and the hIL-27 fragment were connected with T4 ligase to construct the pUC-A41L-mIL-27 plasmid and the pUC-A41L-hIL-27 plasmid.

[0053] (4) CV1 cells in good condition were inoculated into two wells of a 6-well plate. When the cells reached 90% confluency, Cas9 and PB-gRNA-A41L plasmids were transfected simultaneously. After 24 hours, oncolytic vaccinia virus VVLΔTKΔN1L with TK and N1L gene deletions was added to the 6-well plate. After 2 hours, two wells were transfected with pUC-A41L-mIL-27 plasmid and pUC-A41L-hIL-27 plasmid, respectively. After 48 hours, the cell and supernatant mixture was collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at 1 μL / well. Each virus had 6 wells and was incubated in a 5% The cells were cultured in a CO2-free 37°C incubator for 48 hours. According to the property of the newly constructed virus expressing red fluorescent protein, the monoclonal virus emitting red fluorescence was picked under a fluorescence microscope, frozen and thawed three times, and 1 μL was added to a 6-well plate full of CV1 cells. Thereafter, the monoclonal virus expressing red fluorescence was picked once every 48 hours until all wells expressed red fluorescence, which indicated that the new oncolytic vaccinia virus vectors VVLΔTKΔN1LΔA41L-mIL-27 and VVLΔTKΔN1LΔA41L-hIL-27 (VVL-TD-IL-27) were successfully screened.

[0054] The A41L region structure of the viral vector VVL-TD-IL-27 Figure 2 .

[0055] Example 3: Killing effect of oncolytic vaccinia virus vectors VVL-TD-RFP and VVLΔTKΔN1L on mouse and hamster tumor cells

[0056] The oncolytic vaccinia virus was diluted in multiples (1×10 3 PFU / cell-1×10 -5 PFU / cell) were used to infect mouse pancreatic cancer cells DT6606, TB11381, DT4994, TB32043, Panc02, mouse colon cancer cells MC38, hamster pancreatic cancer cells SHPC6, IPAN, Hap-T1, HPD1NR, and mouse lung cancer cells CMT64, CMT167, CMT170, LLC, KPL160302s and KPL160424s. After 144 hours, the absorbance at 490nm was detected by MTS method, and the half-effective concentration EC50 value was calculated, that is, the amount of virus required for the virus to kill 50% of the cells. The lower this value, the stronger the killing ability of the oncolytic virus on cells. The results are shown in Figure 3 , Figure 4 and Figure 5 .

[0057] Figure 3 , Figure 4 and Figure 5 The results showed that compared with VVLΔTKΔN1L, the novel oncolytic vaccinia virus vector VVL-TD-RFP with A41L gene deletion had enhanced killing effect on DT6606, DT4994, TB32043, IPAN, Hap-T1, CMT167, CMT170, LLC and KPL160302s cells, but slightly weakened the killing effect on TB11381 cells.

[0058] Example 3: Antitumor effects, tumor clearance rate and body weight changes of VVL-TD-RFP and VVLΔTKΔN1L in the pancreatic cancer DT6606 subcutaneous transplanted tumor model of C57BL / 6 mice

[0059] The experiment was divided into three groups: VVL-TD-RFP virus group, VVLΔTKΔN1L virus group and PBS group. In this study, 2×10 6 100 μL of DT6606 cells were inoculated into the right ventral back of male C57BL / 6 mice with normal immune function. When the average tumor volume reached 100 mm 3 The mice were divided into groups of 7 and each of the two virus groups was treated with 1×10 8PFU / 100μL of virus was injected into the tumor at multiple points. In the PBS group, 100μL of PBS was injected into each mouse's tumor at multiple points. The day of treatment was recorded as day 0. Treatment was performed on days 0, 2, 4, 11, 13, and 15, for a total of 6 treatments. The tumor growth curve, tumor clearance rate, and body weight changes were then observed. Results are shown in Figure 6 , Figure 7 and Figure 8 .

[0060] Figure 6 The results showed that both virus groups significantly inhibited tumor growth compared with the PBS group. VVL-TD-RFP treatment inhibited tumor growth to a greater extent than the VVLΔTKΔN1L group.

[0061] Figure 7 The results showed that the tumor clearance rate of the VVL-TD-RFP treatment group was 71.4%, while the tumor clearance rate of the VVLΔTKΔN1L treatment group was only 14.3% (the ratio of mice with tumors cleared in the group to the total number of mice in the group).

[0062] Figure 8 The results showed that on the 4th day after treatment, the body weight of the VVL-TD-RFP group decreased compared with the PBS group, but the body weight recovered quickly after treatment. Therefore, VVL-TD-RFP in vivo treatment is highly safe.

[0063] Example 4: Cytotoxic effect of VVL-TD-IL-27 on mouse and hamster tumor cells, and expression of mIL-27 and hIL-27 after infection of tumor cells

[0064] 1. Killing experiment: Use the oncolytic virus VVL-TD-mIL-27 diluted in multiple ratios (1×10 3 PFU / cell-1×10 - 5 PFU / cell) were used to infect mouse pancreatic cancer cells DT6606, TB11381, DT4994, TB32043, Panc02, mouse colon cancer cells MC38, and mouse lung cancer cells CMT64, CMT167, CMT170, LLC, KPL160302s, and KPL160424s. The oncolytic virus VVL-TD-hIL-27 was used to infect hamster pancreatic cancer cells SHPC6, IPAN, Hap-T1, and HPD1NR at the same dilution ratio. After 144 hours, the absorbance at 490nm was detected by the MTS method, and the half-effective concentration EC50 value was calculated, that is, the amount of virus required for the virus to kill 50% of the cells. The lower this value, the stronger the oncolytic virus's ability to kill cells. See the results. Fig. 9 , Fig.10 and Fig.11 .

[0065] The results showed that the new oncolytic vaccinia virus vectors can kill the above cells. Compared with VVL-TD-RFP in mouse cells, the insertion of mIL-27 gene significantly reduced its killing ability against mouse DT6606 cells and DT4994 cells ( Fig. 9 ), significantly enhancing its killing ability against mouse CMT164 cells and CMT167 cells ( Fig.11 There was no significant difference in the EC50 values ​​of the two oncolytic vaccinia viruses against other mouse cells. In hamster tumor cells, the insertion of the hIL-27 gene significantly reduced its ability to kill SHPC6, IPAN, Hap-T1 and HPD1NR cells ( Fig.10 ).

[0066] 2. Detection of mIL-27 and hIL-27 expression: According to the oncolytic virus amount of MOI = 1 PFU / cell, mouse pancreatic cancer cells DT6606 were infected with VVL-TD-mIL-27, and hamster pancreatic cancer cells SHPC6 were infected with VVL-TD-hIL-27. At 12, 24, 48 and 72 hours after infection, the supernatant was collected to detect the expression of IL-27. The results are shown in Fig.12 , Fig.13 .

[0067] Fig.12 , Fig.13 The results showed that compared with VVL-TD-RFP, the expression of mIL-27 was significantly increased after VVL-TD-mIL-27 infected mouse pancreatic cancer cells DT6606, and the expression of hIL-27 was significantly increased after VVL-TD-hIL-27 infected hamster pancreatic cancer cells SHPC6.

[0068] Example 5: Antitumor effects, tumor clearance rate and body weight changes of VVL-TD-RFP and VVL-TD-mIL-27 in the pancreatic cancer DT6606 subcutaneous transplanted tumor model of C57BL / 6 mice

[0069] 2×10 6 100 μL of DT6606 cells were inoculated into the right ventral back of male C57BL / 6 mice with normal immune function. When the average tumor volume reached 100 mm 3 The mice were divided into three groups: PBS, VVL-TD-RFP and VVL-TD-mIL-27, with 7 mice / group. Each mouse was treated with 1×10 8 PFU / 100 μL of virus or 100 μL of PBS was injected into the tumor, and treatment was performed on days 0, 2, and 4 for a total of 3 times. The mouse body weight and tumor volume were measured twice a week. Fig.14 , Fig.15 and Fig.16 .

[0070] Fig.14 The results showed that compared with the PBS group, the VVL-TD-RFP group and the VVL-TD-mIL-27 group could significantly inhibit tumor growth, and the anti-tumor effect of VVL-TD-mIL-27 was significantly better than that of VVL-TD-RFP.

[0071] Fig.15 The results showed that the tumor clearance rate was 100% in the VVL-TD-mIL-27 treatment group and 57.1% in the VVL-TD-RFP treatment group.

[0072] Fig.16 The results showed that on the 7th day after treatment, the body weight of the VVL-TD-mIL-27 group decreased transiently compared with the PBS group, and then gradually increased.

[0073] In summary, VVL-TD-mIL-27 showed stronger anti-tumor effect and good safety in the DT6606 subcutaneous tumor model.

[0074] Example 7: Antitumor effects, tumor clearance rate and body weight changes of VVL-TD-RFP and VVL-TD-mIL-27 in the pancreatic cancer TB11381 subcutaneous transplanted tumor model of C57BL / 6 mice

[0075] 1×10 6 100 μL of TB11381 cells were inoculated into the right ventral back of female C57BL / 6 mice with normal immune function. When the average tumor volume reached 100 mm 3 The mice were divided into three groups: PBS, VVL-TD-RFP and VVL-TD-mIL-27, with 7 mice / group. Each mouse was treated with 1×10 8 PFU / 100μL of virus or 100μL of PBS was injected into the tumor, and treatment was performed on days 0, 2, and 4, for a total of 3 treatments. The mouse body weight and tumor volume were measured twice a week. Fig.17 , Fig.18 and Fig.19 .

[0076] Fig.17 The results showed that compared with the PBS group, both the VVL-TD-RFP group and the VVL-TD-mIL-27 group could significantly inhibit tumor growth, and compared with the VVL-TD-RFP treatment, the VVL-TD-mIL-27 treatment could better inhibit tumor growth.

[0077] Fig.18The results showed that the tumor clearance rate was 71.4% in the VVL-TD-mIL-27 treatment group and 42.9% in the VVL-TD-RFP treatment group.

[0078] Fig.19 The results showed that the weight gain of the VVL-TD-RFP group and the VVL-TD-mIL-27 group was slower than that of the PBS group. Compared with the VVL-TD-RFP group, the weight gain of the VVL-TD-mIL-27 group was slower, but from the overall curve, the weight of the mice was gradually increasing.

[0079] In summary, VVL-TD-mIL-27 has better antitumor effect than VVL-TD-RFP in the TB11381 subcutaneous tumor model and has good safety.

[0080] Sequence in the manual:

[0081] A41L gene upstream sequence SEQ ID NO: 1

[0082] .

[0083] Reporter gene red fluorescent protein sequence SEQ ID NO: 2

[0084] ATGGCCTCCTCCGAGGACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTTCAGGACGGCTCCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACTATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATGGCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCGCCGAGGGCCGCCACCACCTGTTCCTGTAG。

[0085] Downstream sequence of A41L gene, SEQ ID NO: 3

[0086] TCTGCAATATTGTTATCGTAATTGGAAAAATAGTGTTCGAGTGAGTTGGATTATGTGAGTATTGGATTGTATATTTTATTTTATATTTTGTAATAAGAATAAAATGCTAATGTCAAGTTTATTCCAATAGATGTCTTATTAAAAACATATATAATAAATAACAATGGCTGAATGGCATAAAATTATCGAGGATATCTCAAAAAATAATAAGTTCGAGGATGCCGCCATCGTTGATTACAAGACTACAAAGAATGTTCTAGCTGCTATTCCTAACAGAACATTTGCCAAGATTAATCCGGGTGAAATTATTCCTCTCATCACTAATCGTAATATTCTAAAACCTCTTATTGGTCAGAAATATTGTATTGTATATACTAACTCTCTAATGGATGAGAACACGTATGCTATGGAGTTGCTTACTGGGTACGCCCCTGTATCTCCGATCGTTATAGCGAGAACTCATACCGCACTTATATTTTTGATGGGTAAGCCAACAACATCCAGACGTGACGTGTATAGACTCGAG。

[0087] gRNA sequence: SEQ ID NO: 4

[0088] ATGCTTCCTACATCAGAAGG

[0089] Mouse IL-27 gene sequence SEQ ID NO: 5

[0090] ATGTCCAAGCTGCTCTTCCTGTCACTTGCCCTCTGGGCCAGCCGCTCCCCTGGTTACACTGAAACAGCTCTCGTGGCTCTAAGCCAGCCCAGAGTGCAATGCCATGCTTCTCGGTATCCCGTGGCCGTGGACTGCTCCTGGACTCCTCTCCAGGCTCCCAACTCCACCAGATCCACGTCCTTCATTGCCACTTACAGGCTCGGTGTGGCCACCCAGCAGCAGAGCCAGCCCTGCCTACAACGGAGCCCCCAGGCCTCCCGATGCACCATCCCCGACGTGCACCTGTTCTCCACGGTGCCCTACATGCTAAATGTCACTGCAGTGCACCCAGGCGGCGCCAGCAGCAGCCTCCTAGCCTTTGTGGCTGAGCGAATCATCAAGCCGGACCCTCCGGAAGGCGTGCGCCTGCGCACAGCGGGACAGCGCCTGCAGGTGCTCTGGCATCCCCCTGCTTCCTGGCCCTTCCCGGACATCTTCTCTCTCAAGTACCGACTCCGCTACCGGCGCCGAGGAGCCTCTCACTTCCGCCAGGTGGGACCCATTGAAGCCACGACTTTCACCCTCAGGAACTCGAAACCCCATGCCAAGTATTGCATCCAGGTGTCAGCTCAGGACCTCACAGATTATGGGAAACCAAGTGACTGGAGCCTCCCTGGGCAAGTAGAAAGTGCACCCCATAAGCCCGTTCCTGGAGTAGGGGTACCTGGAGTGGGCTTCCCAACAGACCCCCTGAGCCTTCAAGAGCTGCGCAGGGAGTTCACAGTCAGCCTGTACCTTGCCAGGAAGCTGCTCTCTGAGGTTCAGGGCTATGTCCACAGCTTTGCTGAATCTCGATTGCCAGGAGTGAACCTGGACCTCCTGCCCCTGGGATACCATCTTCCCAATGTTTCCCTGACTTTCCAGGCATGGCATCACCTCTCTGACTCTGAGAGACTCTGCTTCCTCGCTACCACACTTCGGCCCTTCCCTGCCATGCTGGGAGGGCTGGGGACCCAGGGGACCTGGACCAGCTCAGAGAGGGAGCAGCTGTGGGCCATGAGGCTGGATCTCCGGGACCTGCACAGGCACCTCCGCTTTCAGGTGCTGGCTGCAGGATTCAAATGTTCAAAGGAGGAGGAGGACAAGGAGGAAGAGGAAGAGGAGGAAGAAGAAGAAAAGAAGCTGCCCCTAGGGGCTCTGGGTGGCCCCAATCAGGTGTCATCCCAAGTGTCCTGGCCCCAGCTGCTCTATACCTACCAGCTCCTTCACTCCCTGGAGCTTGTCCTGTCTCGGGCTGTTCGGGACCTGCTGCTGCTGTCCCTGCCCAGGCGCCCAGGCTCAGCCTGGGATTCCTAA。

[0091] Human IL-27 gene sequence SEQ ID NO: 6

[0092]

[0093] TTCAACCTCCCGGAGGAGGAGGAGGAGGAAGAGGAGGAGGAGGAGGAG

[0094] GAGAGGAAGGGGCTGCTCCCAGGGGCACTGGGCAGCGCCTTACAGGGCC

[0095] CGGCCCAGGTGTCCTGGCCCCAGCTCCTCTCCACCTACCGCCTGCTGCACT

[0096] CCTTGGAGCTCGTCTTATCTCGGGCCGTGCGGGAGTTGCTGCTGCTGTCCA

[0097] AGGCTGGGCACTCAGTCTGGCCCTTGGGGTTCCCAACATTGAGCCCCCAG

[0098] CCCTGA。

Claims

1. A method for constructing a novel oncolytic vaccinia virus vector, characterized in that: The vaccinia virus vector is a vaccinia virus Lister strain, which has site-specific deletions of the TK gene, the N1L gene and the A41L gene, and inserts genes that are helpful for treating tumors.

2. The method for constructing a novel oncolytic vaccinia virus vector according to claim 1, characterized in that: The gene for treating tumors is mouse IL-27 gene or human IL-27 gene.

3. The method for constructing a novel oncolytic vaccinia virus vector according to claim 1, characterized in that: The viral vector is VVLΔTKΔN1LΔA41L-RFP, and the construction method comprises the following steps: (1) Using gene synthesis technology, the upstream sequence of the A41L gene SEQ ID NO: 1, the reporter gene red fluorescent protein SEQ ID NO: 2, and the downstream sequence of the A41L gene SEQ ID NO: 3 were sequentially connected to the plasmid vector pUC57 to construct the pUC-A41L plasmid; (2) Designing the sequence gRNA according to the A41L gene sequence: SEQ ID NO: 4, connecting the gRNA to the PB-gRNA vector to construct the PB-gRNA-A41L plasmid; (3) CV1 cells in good condition were inoculated into 6-well plates, and when the cell confluence reached more than 90%, Cas9 plasmid and PB-gRNA-A41L plasmid were transfected at the same time; 24 hours later, oncolytic vaccinia virus VVLΔTKΔN1L lacking TK gene and N1L gene was added to the 6-well plate; 2 hours later, pUC-A41L plasmid was transfected; 48 hours later, the cell and supernatant mixture was collected, frozen and thawed 3 times, and added to the 6-well plate filled with CV1 cells at 1 μL / well, and cultured in an incubator containing 5% CO2 at 37°C for 48 hours; monoclonal virus emitting red fluorescence was picked under a fluorescence microscope, frozen and thawed 3 times, and 1 μL of monoclonal virus was added to the 6-well plate filled with CV1 cells; thereafter, monoclonal virus expressing red fluorescence was picked once every 48 hours until all wells expressed red fluorescence, indicating that the oncolytic vaccinia virus vector VVLΔTKΔN1LΔA41L-RFP screening was successful.

4. The method for constructing an oncolytic vaccinia virus vector according to claim 1 or 2, characterized in that: The viral vector is VVLΔTKΔN1LΔA41L-IL-27, and the construction method comprises the following steps: (1) Using gene synthesis technology, the upstream sequence of the A41L gene SEQ ID NO: 1, the reporter gene red fluorescent protein sequence SEQ ID NO: 2, and the downstream sequence of the A41L gene SEQ ID NO: 3 were sequentially connected to the plasmid vector pUC57 to construct the pUC-A41L plasmid; (2) Designing the gRNA sequence according to the A41L gene sequence: SEQ ID NO: 4, connecting the gRNA sequence to the PB-gRNA vector to construct the PB-gRNA-A41L plasmid; (3) synthesizing plasmids from the mouse IL-27 gene sequence SEQ ID NO: 5 and the human IL-27 gene sequence SEQ ID NO: 6 using gene synthesis technology to obtain mouse pUC-mIL-27 plasmid and human pUC-hIL-27 plasmid; digesting the pUC-A41L plasmid, pUC-mIL-27 plasmid and pUC-hIL-27 plasmid with Sal I and Nhe I enzymes, respectively, to obtain A41L fragment, mIL-27 fragment and hIL-27 fragment; ligating the A41L fragment and the mIL-27 fragment with T4 ligase, and ligating the A41L fragment and the hIL-27 fragment with T4 ligase, respectively, to construct pUC-A41L-mIL-27 plasmid and pUC-A41L-hIL-27 plasmid; (4) CV1 cells in good condition were inoculated into 6-well plates, and when the cell confluence reached more than 90%, Cas9 and PB-gRNA-A41L plasmids were transfected at the same time; 24 hours later, oncolytic vaccinia virus VVLΔTKΔN1L with TK gene and N1L gene deletion was added to the 6-well plate; 2 hours later, pUC-A41L-mIL-27 plasmid and pUC-A41L-hIL-27 plasmid were transfected respectively; 48 hours later, the cell and supernatant mixture was collected, frozen and thawed 3 times, and 1 μL / well was added to the CV1 confluent. In a 6-well plate of cells, 6 wells for each virus were cultured in an incubator at 37°C containing 5% CO2 for 48 hours; monoclonal viruses emitting red fluorescence were picked under a fluorescence microscope, frozen and thawed 3 times, and 1 μL was added to a 6-well plate full of CV1 cells; thereafter, monoclonal viruses expressing red fluorescence were picked once every 48 hours until all wells expressed red fluorescence, indicating that the oncolytic vaccinia virus vectors VVLΔTKΔN1LΔA41L-mIL-27 and VVLΔTKΔN1LΔA41L-hIL-27 were successfully screened.

5. Use of the novel oncolytic vaccinia virus vector VVLΔTKΔN1LΔA41L-RFP obtained by the construction method according to claim 3 in the preparation of drugs for treating tumors.

6. Use of the novel oncolytic vaccinia virus vector VVLΔTKΔN1LΔA41L-IL-27 obtained by the construction method according to claim 4 in the preparation of drugs for treating tumors.

7. The use according to claim 5 or 6, characterized in that The tumor is a solid tumor.

8. The use according to claim 7, characterized in that The solid tumors include pancreatic cancer, colon cancer, esophageal cancer, lung cancer, kidney cancer, head and neck tumors, breast cancer, and ovarian cancer.

Images