Process for the enzymatic synthesis of 2'-fluoro-2'-deoxynucleoside-5'-triphosphates and uses thereof

A green synthesis of 2'-fluoro-2'-deoxynucleoside-5'-triphosphate was achieved through enzymatic reactions of deoxynucleoside kinase and polyphosphate kinase, solving the problems of cumbersome steps and environmental unfriendliness in traditional chemical synthesis and providing an efficient synthetic route.

CN119614654BActive Publication Date: 2025-11-21SOUTH CHINA UNIV OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411926714.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-25
Publication Date
2025-11-21
Estimated Expiration
2044-12-25

AI Technical Summary

Technical Problem

Existing chemical synthesis methods for synthesizing modified nucleoside triphosphates are cumbersome, have low stereoselectivity and yield, making it difficult to meet the needs of large-scale applications, and are also environmentally unfriendly.

Method used

2'-Fluoro-2'-deoxynucleoside-5'-triphosphate was synthesized under mild conditions using deoxynucleoside kinase and polyphosphate kinase and their mutants, achieving green synthesis through enzymatic reaction.

Benefits of technology

This provides an efficient and green synthetic route that overcomes the shortcomings of traditional chemical synthesis, and offers a convenient and economical source of raw materials for the synthesis of modified nucleoside triphosphates and non-natural nucleic acids.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119614654B_ABST
    Figure CN119614654B_ABST
Patent Text Reader

Abstract

The application discloses a synthesis method of 2'-fluoro-2'-deoxynucleoside-5'-triphosphate and application thereof. The synthesis method comprises the following steps: reacting in a system containing adenosine triphosphate, 2'-fluoro-2'-deoxynucleoside, metal ions and deoxynucleoside kinase to obtain 2'-fluoro-2'-deoxynucleoside-5'-monophosphate; and reacting in a system containing polyphosphoric acid, 2'-fluoro-2'-deoxynucleoside-5'-monophosphate, metal ions and polyphosphoric acid kinase to obtain 2'-fluoro-2'-deoxynucleoside-5'-triphosphate. The obtained 2'-fluoro-2'-deoxynucleoside-5'-triphosphate can be used for preparing heterologous nucleic acid. The application provides an economical and green new route for synthesizing 2'-fluoro-2'-deoxynucleoside-5'-triphosphate, solves the problems of complex steps, non-environmental protection reagents and high cost in the existing chemical synthesis method, and provides a train of thought for preparing nucleotide derivatives.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biochemistry, in particular to an enzymatic synthesis method of 2'-fluoro-2'-deoxynucleoside-5'-triphosphate and its application. BACKGROUND

[0002] Natural nucleic acids, deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), as carriers of genetic information storage and transmission, are indispensable components of life. In addition, single-stranded nucleic acids can fold to form stable tertiary structures with molecular binding ability and catalytic activity. These functional nucleic acid molecules, such as aptamers and ribozymes, have become valuable tools in various research fields such as chemical biology and molecular medicine. However, the four structural units limit the diversity of the intrinsic chemical structure of natural nucleic acids. Therefore, natural nucleic acid analogues containing various chemical modifications, i.e. XNA, have gradually attracted great attention from researchers. Due to these modifications, nucleic acids have different physical and chemical properties, expanding the application range of nucleic acids in the fields of biology, medicine and nanomaterials. Modification of the base can adjust the strength and specificity of base pairing and provide a site for coupling of nucleic acids with other molecules. Modification of the phosphodiester backbone can enhance resistance to nucleases and pharmacokinetic properties. Modification of the sugar group will have a significant impact on various properties of nucleic acids, such as double-stranded formation ability, nuclease resistance and toxicity to cells and animals. Through chemical synthesis methods, different substituent groups such as fluorine (2'-fluoro), chlorine (2'-chloro), azide (2'-azido), amino (2'-amino) and methoxy (2'-methoxy) can be introduced at the 2'-position of ribose. Among them, 2'-F modification is one of the most common modifications at the 2'-position of ribose. Currently, several nucleic acids containing 2'-F modification have been approved by FDA for the treatment of high cholesterol (Leqvio), macular degeneration (Macugen) and the like.

[0003] Currently, the synthesis of XNA mainly relies on chemical solid-phase synthesis, involving repeated coupling, capping, oxidation and deprotection steps and using a large amount of organic solvents in the synthesis and purification process, resulting in low atom efficiency and environmental unfriendliness, which is difficult to meet the needs of large-scale applications. As green and efficient biological catalysts, enzymes have been gradually applied to the production of various high-value compounds. In recent years, various polymerases have been developed for the synthesis of XNA, and the process of enzymatic synthesis of XNA cannot be separated from the use of modified nucleoside triphosphates. The traditional synthesis method of nucleoside triphosphates mainly relies on chemical synthesis, involving multiple protection, deprotection and purification steps, which are complicated and have low stereoselectivity and yield. Therefore, it is necessary to develop a green and efficient biosynthesis pathway for the synthesis of modified nucleoside triphosphates. SUMMARY

[0004] The primary purpose of the present application is to overcome the shortcomings and deficiencies of the prior art, and provide an enzymatic synthesis method of 2'-fluoro-2'-deoxyribonucleoside triphosphates. The method overcomes several shortcomings of traditional chemical synthesis, and realizes the enzymatic green synthesis of 2'-F-NTPs under green and mild reaction conditions.

[0005] The second purpose of the present application is to provide a method for synthesizing unnatural nucleic acids (XNA) by enzymatic synthesis of 2'-fluoro-2'-deoxyribonucleoside-5'-triphosphates.

[0006] The purpose of the present application is achieved by the following technical solutions:

[0007] A synthesis method of 2'-fluoro-2'-deoxyribonucleoside-5'-triphosphates, comprising the following steps:

[0008] S1. Reactions in a system containing adenosine triphosphate (ATP), 2'-fluoro-2'-deoxyribonucleoside, divalent metal ions and deoxyribonucleoside kinase to obtain 2'-fluoro-2'-deoxyribonucleoside-5'-monophosphate;

[0009] S2. Reactions in a system containing polyphosphoric acid, 2'-fluoro-2'-deoxyribonucleoside-5'-monophosphate obtained in step S1, divalent metal ions and polyphosphoric acid kinase to obtain 2'-fluoro-2'-deoxyribonucleoside triphosphates (2'-F-NTPs).

[0010] Further, the 2'-fluoro-2'-deoxyribonucleoside-5'-triphosphates include at least one of 2'-fluoro-2'-deoxyadenosine-5'-triphosphate (2'-F-ATP), 2'-fluoro-2'-deoxyuridine-5'-triphosphate (2'-F-UTP), 2'-fluoro-2'-deoxycytidine-5'-triphosphate (2'-F-CTP) and 2'-fluoro-2'-deoxyguanosine-5'-triphosphate (2'-F-GTP).

[0011] Further, the concentration of ATP in the system in step S1 is 1-20 mM; and more further, 12 mM.

[0012] Further, the 2'-fluoro-2'-deoxynucleoside mentioned in step S1 includes at least one of 2'-fluoro-2'-deoxyadenosine (2'-FA), 2'-fluoro-2'-deoxyuridine (2'-FU), 2'-fluoro-2'-deoxycytidine (2'-FC), and 2'-fluoro-2'-deoxyguanosine (2'-FG).

[0013] Furthermore, the concentration of the 2'-fluoro-2'-deoxynucleotide described in step S1 in the system is 5–20 mM; even further, it is 10 mM.

[0014] Furthermore, the divalent metal ion mentioned in step S1 is a magnesium ion, provided by a magnesium salt, and even more specifically by magnesium chloride.

[0015] Furthermore, the concentration of the divalent metal ions in the system described in step S1 is 1–100 mM; even further, it is 50 mM.

[0016] Furthermore, the deoxynucleoside kinases mentioned in step S1 include, but are not limited to, those derived from Drosophila melanogaster (…). Drosophila melanogaster deoxynucleoside kinase ( Dm dNK) and mutant deoxynucleoside kinases whose enzyme activity is not downregulated; further, the deoxynucleoside kinases... Dm dNK is a C-terminal truncated form of wild-type deoxynucleoside kinase from Drosophila melanogaster, and its amino acid sequence is shown in SEQ ID No. 4; furthermore, the deoxynucleoside kinase... Dm The nucleotide sequence of the gene encoding dNK is shown in SEQ ID No. 1.

[0017] Furthermore, the deoxynucleoside kinase described in step S1 Dm The concentration of dNK in the system was 3–9 μM; and further reduced to 6 μM.

[0018] Furthermore, the system described in step S1 further includes 20–50 mM Tris-HCl with pH 5.0–10.0 and 1–150 mM KCl; even further, it includes 50 mM Tris-HCl with pH 8.0 and 100 mM KCl.

[0019] Furthermore, the system described in step S1 also includes water; even further, the water includes ddH2O.

[0020] Further, the reaction in step S1 is at a temperature of 30-37 °C for 1-10 h; further at a temperature of 37 °C for 3 h.

[0021] Further, the polyphosphate in step S2 is sodium hexametaphosphate (polyP6).

[0022] Further, the concentration of the polyphosphate in step S2 in the system is 1-10 mM; further 4 mM.

[0023] Further, the 2'-fluoro-2'-deoxynucleoside-5'-monophosphate in step S2 includes at least one of 2'-fluoro-2'-deoxyadenosine-5'-monophosphate (2'-F-AMP), 2'-fluoro-2'-deoxyuridine-5'-monophosphate (2'-F-UMP), 2'-fluoro-2'-deoxycytidine-5'-monophosphate (2'-F-CMP), and 2'-fluoro-2'-deoxyguanosine-5'-monophosphate (2'-F-GMP).

[0024] Further, the concentration of the 2'-fluoro-2'-deoxynucleoside monophosphate in step S2 in the system is 1-10 mM; further 2 mM.

[0025] Further, the divalent metal ion in step S2 is a magnesium ion, provided by a magnesium salt, further provided by magnesium chloride.

[0026] Further, the concentration of the magnesium ion in step S2 in the system is 20-100 mM; further 20 mM.

[0027] Further, the polyphosphate kinase in step S2 includes, but is not limited to, a polyphosphate kinase (PPK) derived from a red subterranean thermophiles (Thermus rubens) and a mutant polyphosphate kinase whose enzyme activity is not down-regulated; further, the polyphosphate kinase in step S2 includes a polyphosphate kinase PPK derived from a subterranean thermophiles and a polyphosphate kinase mutant Meiothermus ruber Mr Mr ​​​Mr at least one of PPK (D127N); the polyphosphate kinase mutant Mr the amino acid sequence of PPK is shown as SEQ ID No. 5, the polyphosphate kinase mutant Mr the amino acid sequence of PPK (D127N) is shown as SEQ ID No. 6; still further, the polyphosphate kinase mutant Mr the nucleotide sequence of the coding gene of PPK is shown as SEQ ID No. 2, the polyphosphate kinase mutant Mr the nucleotide sequence of the coding gene of PPK (D127N) is shown as SEQ ID No. 3.

[0028] Further, the concentration of the polyphosphate kinase in the system in step S2 is 1-5 μM; further 1 μM.

[0029] Further, the system in step S2 further comprises 10-100 mM Tris-HCl with pH 5.0-10.0; further comprises 20 mM Tris-HCl with pH 8.0.

[0030] Further, the system in step S2 further comprises water; further, the water comprises ddH2O.

[0031] Further, the reaction in step S2 is at a temperature of 30-80℃ for 1-12 h; further at a temperature of 37℃ for 4-12 h.

[0032] The 2'-fluoro-2'-deoxynucleoside-5'-triphosphates obtained by the above preparation method are used in the preparation of 2'-fluoro-modified heterologous nucleic acids.

[0033] Further, the use comprises the following steps:

[0034] S3. obtaining a non-natural nucleic acid by primer extension reaction in a system comprising a template, a primer, the 2'-fluoro-2'-deoxynucleoside-5'-triphosphates obtained by the above preparation method, and a Pfu DNA polymerase mutant.

[0035] Further, the 2'-fluoro-2'-deoxynucleoside-5'-triphosphates are prepared by the above method.

[0036] Further, the Pfu DNA polymerase mutant is Pfu DNA polymerase mutant P1 exo - has been disclosed in "2024101647614-Pfu DNA polymerase mutants with XNA recognition and synthesis activity and applications thereof".

[0037] The present application has the following advantages and effects relative to the prior art:

[0038] The present application provides an enzymatic synthesis method for synthesizing 2'-F-NTPs by using deoxyribonucleoside kinase and polyphosphate kinase and mutant strains thereof, which overcomes several shortcomings of traditional chemical synthesis. The method realizes the green enzymatic synthesis of 2'-F-NTPs under mild reaction conditions, provides a new technical approach for the synthesis of modified nucleoside triphosphates, and also provides a more convenient and economical source of raw materials for the synthesis of XNA. Among them, the synthesis of 2'-fluoro-2'-deoxyadenosine-5'-triphosphate and 2'-fluoro-2'-deoxycytidine-5'-triphosphate uses wild-type red sub-thermophilic polyphosphate kinase (PPK); the synthesis of 2'-fluoro-2'-deoxyuridine-5'-triphosphate and 2'-fluoro-2'-deoxyguanosine-5'-triphosphate uses mutant strain PPK (D127N) of wild-type red sub-thermophilic polyphosphate kinase (PPK). Mr PPK). Mr PPK (D127N). Mr PPK (D127N). BRIEF DESCRIPTION OF DRAWINGS

[0039] Figure 1 is the product HPLC analysis result graph of synthesizing four kinds of 2'-F-NTPs by using dNK and PPK. Dm dNK and PPK Mr PPK synthesis 2'-F-NTPs and part of the application of technical roadmap.

[0040] Figure 2 is the product HPLC analysis result graph of synthesizing four kinds of 2'-F-NTPs by using dNK and PPK. Dm dNK catalyzes 2'-F-A phosphorylation to generate 2'-F-AMP product HPLC analysis result graph; B is Dm dNK catalyzes 2'-F-U phosphorylation to generate 2'-F-UMP product HPLC analysis result graph; C is Dm dNK catalyzes 2'-F-C phosphorylation to generate 2'-F-CMP product HPLC analysis result graph; D is Dm dNK catalyzes 2'-F-G phosphorylation to generate 2'-F-GMP product HPLC analysis result graph. Dm dNK catalyzes 2'-F-G phosphorylation to generate 2'-F-GMP product HPLC analysis result graph.

[0041] Dm is the product HPLC analysis result graph of synthesizing four kinds of 2'-F-NTP by using PPK or PPK (D127N). Mr PPK or PPK (D127N) Mr PPK (D127N). Mr PPK catalyzes 2'-F-AMP phosphorylation to generate 2'-F-ATP product HPLC analysis result graph; B is MrPPK (D127N) catalyzed 2'-F-UMP phosphorylation to generate 2'-F-UTP Product HPLC analysis results chart; C is Mr PPK catalyzed 2'-F-CMP phosphorylation to generate 2'-F-CTP Product HPLC analysis results chart; D is Mr PPK (D127N) catalyzed 2'-F-GMP phosphorylation to generate 2'-F-GTP Product HPLC analysis results chart.

[0042] Dm is the gel electrophoresis analysis results chart of the product of synthesizing XNA with 2'-F-NTPs synthesized by the enzyme catalysis method in the patent as the substrate; wherein, A is the gel electrophoresis analysis results chart of the reaction product with T-A6, T-U6 as the template, B is the gel electrophoresis analysis results chart of the reaction product with T-C6, T-G6 as the template, C is the gel electrophoresis analysis results chart of the reaction product with T-X10 as the template; FAM-P8-R in charts A, B and C is the primer control, lanes 1 and 5 are the primer control, lanes 2 and 6 are the full-length DNA product synthesized with commercial dNTPs as the substrate; lanes 3 and 7 are the full-length XNA product synthesized with commercial 2'-F-NTPs as the substrate; lanes 4 and 8 are the full-length XNA product synthesized with 2'-F-NTPs synthesized by enzyme method as the substrate. DETAILED DESCRIPTION

[0043] The application will be further described in detail below in combination with examples and drawings, but the embodiments of the application are not limited thereto.

[0044] The biological materials used in the examples: Escherichia coli DH5α and Escherichia coli BL21 (DE3) pLysS can be purchased through conventional commercial channels; plasmid pET-28a(+) Figure 3 dNK and pET-28a(+) Mr PPK2-WT is synthesized by Jinweizhi Biological Company, pET28a(+) Figure 4 The sequence of dNK is shown in SEQ ID NO. 7; pET-28a(+) Mr The sequence of PPK2-WT is shown in SEQ ID NO. 8. The Pfu DNA polymerase mutant expression strain is BL21 (DE3) pLysS / pET-28a(+)-P1exo- disclosed in the patent application “2024101647614-Pfu DNA polymerase mutant with XNA recognition and synthesis activity and application thereof”; the Pfu DNA polymerase mutant (P1exo - ) is the DNA polymerase expressed by BL21 (DE3) pLysS / pET-28a(+)-P1exo-.Dm dNK is derived from Drosophila melanogaster, the sequence of the encoding gene is shown as SEQ ID No. 1, and the amino acid sequence is shown as SEQ ID No. 4. Mr PPK2 is derived from Thermus subtilis, the sequence of the encoding gene is shown as SEQ ID No. 2, and the amino acid sequence is shown as SEQ ID No. 5.

[0045] Example 1. Mr Construction of PPK (D127N) recombinant expression strain

[0046] 1 、 pET-28a(+) Mr Construction of PPK2-D127N plasmid

[0047] Mr PPK mutant strain Mr PPK (D127N) was amplified by using PrimeSTAR HS DNA polymerase, and the PCR reaction system included the following components: ® Mr PPK2-WT gene as a template, the upstream and downstream fragments of the mutation site were amplified respectively, and the PCR reaction system for amplifying the upstream fragment included the following components: Mr PPK (D127N) gene,

[0048] Specifically, the primer sequences used for overlap extension PCR site-directed mutation are as follows:

[0049] D127N-F: 5'- AACCGCAGCCATTATGAAAACGTGCTGGTGGTGCGCGTG-3';

[0050] D127N-R: 5'- CACGCGCACCACCAGCACGTTTTCATAATGGCTGCGGTT-3';

[0051] T7-F: 5'- CCGCGAAATTAATACGACTCACTATA -3';

[0052] T7-ter: 5'- AAGACCCGTTTAGAGGCCCCAAG -3'.

[0053] The specific steps of overlap extension PCR site-directed mutation are as follows:

[0054] (1) pET-28a(+)- Mr PPK2-WT as a template, the upstream and downstream fragments of the mutation site were amplified respectively, and the PCR reaction system for amplifying the upstream fragment included the following components:

[0055] 50 ng pET-28a(+)- Mr ​PPK2-WT, 0.2 µM T7-F, 0.2 µM D127N-R, 0.2 mM dATP, 0.2 mM dGTP, 0.2 mM dTTP, 0.2 mM dCTP, 1× PrimeSTAR GC Buffer, 0.025 U / µL PrimeSTAR ® HS DNA polymerase; ddH2O to 50 µL;

[0056] The PCR reaction system for amplifying the downstream fragment includes the following components:

[0057] 50 ng pET-28a(+) Mr PPK2-WT, 0.2 µM T7-ter, 0.2 µM D127N-F, 0.2 mM dATP, 0.2 mM dGTP, 0.2 mM dTTP, 0.2 mM dCTP, 1× PrimeSTAR GC Buffer, 0.025 U / µL PrimeSTAR ® HS DNA polymerase; ddH2O to 50 µL;

[0058] The PCR reaction procedure for amplifying the upstream fragment is as follows:

[0059] 98℃ 2 min; 98℃ 10 s, 68℃ 30 s, 30 cycles; 68℃ 5 min;

[0060] The PCR reaction procedure for amplifying the downstream fragment is as follows:

[0061] 98℃ 2 min; 98℃ 10 s, 68℃ 35 s, 30 cycles; 68℃ 5 min;

[0062] After the PCR reaction, the DNA fragment was recovered by cutting the gel using an agarose gel DNA recovery kit (Guangzhou Meiji Biological Technology Co., Ltd.), and was used for the next step of overlap extension PCR.

[0063] (2) Overlap extension PCR

[0064] 1) The initial reaction system of overlap extension PCR includes the following components:

[0065] 1× PrimeStar GC Buffer (Mg 2+(plus), 50 ng upstream fragment, 58 ng downstream fragment, 0.2 mM dATP, 0.2 mM dGTP, 0.2 mM dTTP, 0.2 mM dCTP and 0.025 U / μL PrimeSTAR HS DNAPolymeras; ddH2O to bring the total to 50 µL.

[0066] The reaction procedure is as follows: 98℃ for 2 min; 98℃ for 10 s, 68℃ for 35 s, 10 cycles; 68℃ for 5 min.

[0067] 2) Add T7-F and T7-ter primers to the reaction system, and then react according to the following program: 98℃ for 10 s, 68℃ for 1 min for 20 s, 25 cycles; 68℃ for 5 min.

[0068] 3) After the PCR reaction is completed, the target fragment is recovered by cutting the gel using an agarose gel DNA recovery kit.

[0069] (3) Mr PPK (D127N) gene insertion plasmid pET-28a(+)

[0070] Using restriction endonucleases Dm I and Dm dIII enzymes were used to digest the gene and vector. The digestion reaction system consisted of the following components: 3 µg DNA fragment / plasmid pET-28a(+)- Mr PPK2-WT, 20 U Nde I, 20 U Hin Add dIII and 5 µL of 10×Cutsmart buffer; bring the total to 50 µL with ddH2O.

[0071] After incubating the enzyme digestion system at 37°C for 3 h, the gene fragment was directly recovered using an agarose gel DNA recovery kit (Guangzhou Meiji Biotechnology Co., Ltd.); the vector fragment was recovered by gel excision using an agarose gel DNA recovery kit (Guangzhou Meiji Biotechnology Co., Ltd.).

[0072] The digested and recovered gene and vector DNA fragments were ligated using T4 DNA ligase. The ligation reaction system consisted of the following components: 200 ng of digested gene fragment, 200 ng of digested vector fragment, 200 U of T4 DNA ligase and 1 × T4 DNA ligase buffer; ddH2O was added to a final volume of 20 µL.

[0073] The enzyme ligation reaction system was incubated overnight at 16°C, and the enzyme ligation products were purified using an agarose gel DNA recovery kit (Guangzhou Meiji Biotechnology Co., Ltd.).

[0074] 2. Transform cells and extract plasmids.

[0075] The above enzyme-linked product pET28a(+)- Mr PPK2-D127N was transformed into E. coli DH5α competent cells via electroporation to obtain DH5α / pET-28a(+)-MrPPK2-D127N. Positive clones were identified by colony PCR, and selected positive clones were sequenced. Strains with correct sequencing results were cultured and the corresponding plasmids were extracted.

[0076] 3. Construct recombinant expression strains

[0077] pET28a(+)- through electroporation Nde dNK、pET28a(+)- Mr PPK2-WT and pET-28a(+)-MrPPK2-D127N were transformed into Escherichia coli BL21(DE3) pLysS to obtain the recombinant expression strain BL21(DE3) pLysS / pET-28a(+) Hin dNK, BL21(DE3) pLysS / pET-28a(+)- Mr PPK2-WT, BL21(DE3) pLysS / pET-28a(+)- Mr PPK (D127N).

[0078] Example 2. Dm dNK, Mr PPK, Mr PPK (D127N), P1 exo - Expression and purification

[0079] Select BL21(DE3) pLysS / pET-28a(+)- Dm dNK, BL21(DE3) pLysS / pET-28a(+)- Mr PPK2-WT, BL21(DE3) pLysS / pET-28a(+)- Mr Single colonies of PPK (D127N) and BL21(DE3) pLysS / pET-28a(+)-P1 exo- were inoculated into 10 mL of 2× YT medium containing 50 μg / mL kanamycin and 25 μg / mL chloramphenicol, respectively, and incubated overnight at 37°C and 220 rpm. 10 mL of the overnight culture was then transferred to 1 L of 2× YT medium containing 50 μg / mL kanamycin and 25 μg / mL chloramphenicol, and incubated at 37°C until the absorbance value reached OD0.05. 600For 0.6-0.8, 0.5 mM IPTG (isopropyl thiogalactoside) was added and induction was performed at 18°C for 16-20 h. After centrifugation, the bacterial pellet was resuspended in buffer A (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 5 mM imidazole, 0.1 mM EDTA, 0.1% Triton X-100) (P1 exo - buffer A pH 7.0) and the bacterial pellet was disrupted using a high-pressure homogenizer. After centrifugation at 4°C, 10000 rpm for 45 min, the supernatant was filtered through a 0.45 μm filter to remove cell debris and the filtered supernatant was applied to a nickel column for affinity chromatography purification. The protein of interest was eluted using 1 x elution buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 10-500 mM imidazole, 0.1 mM EDTA, 0.1% Triton X-100) containing different concentrations of imidazole.

[0080] The obtained eluate was verified by SDS-PAGE and the eluate containing the protein of interest was collected. The protein of interest was dialyzed and concentrated using 10 kDa Amicon-Ultra centrifugal ultrafiltration tubes and 1 x dialysis buffer (100 mM Tris-HCl, 0.1 mM EDTA, 2 mM DTT, 0.2% Tween 20, pH 7.0). Finally, an equal volume of 80% glycerol was added to the obtained purified protein and stored at -20°C; the protein was used for subsequent example experiments.

[0081] Example 3. Dm dNK-catalyzed synthesis of 2'-F-AMP and analysis and purification of the product

[0082] 2'-F-A was converted to 2'-F-AMP by dNK catalysis Dm The reaction mixture contained 50 mM Tris-HCl pH 8.0, 100 mM KCl, 12 mM ATP, 10 mM 2'-F-A, 50 mM MgCl2, and 6 μM dNK. The reaction was performed at 37°C for 16 h. The reaction mixture was analyzed and purified by HPLC. DmdNK. The reaction solution was incubated at 37°C for 3 h, followed by incubation at 95°C for 15 min to inactivate the enzyme. The reaction solution was diluted with 4 volumes of water, and the protein was removed by centrifugation at 6000 rpm using a 10 kDa ultrafiltration column. 50 μL of the filtrate was then analyzed by HPLC. The mobile phase A for HPLC was 10 mM tetrabutylammonium bisulfate (pH 6.0), and the mobile phase B was 75% acetonitrile. The injection volume for HPLC detection was 50 μL, the temperature was 30°C, the flow rate was 1 mL / min, and the detection wavelength was 254 nm using an HPLC UV detector. Different gradient elution programs were used to analyze each product. The 2'-F-AMP fraction was collected and lyophilized at -20°C. The crude yield and product concentration were calculated based on the initial substrate concentration and the peak area of ​​each component in the HPLC results.

[0083] Dm HPLC analysis results of dNK catalysis for the formation of 2'-F-AMP from 2'-FA are as follows: Dm As shown in A in the diagram.

[0084] Example 4. Dm dNK-catalyzed synthesis of 2'-F-UMP and analysis and purification of its products

[0085] 2'-FU Figure 2 The dNK-catalyzed reaction produces monophosphate, and the reaction product is then analyzed and purified by HPLC. The reaction system contains 50 mM Tris-HCl (pH 8.0), 100 mM KCl, 12 mM ATP, 10 mM 2'-FU, 50 mM MgCl2, and 6 μM... Dm dNK. The reaction solution was incubated at 37°C for 3 h, followed by incubation at 95°C for 15 min to inactivate the enzyme. The reaction solution was diluted with 4 volumes of water, and the protein was removed by centrifugation at 6000 rpm using a 10 kDa ultrafiltration column. 50 μL of the filtrate was then analyzed by HPLC. Mobile phase preparation: Mobile phase A was 10 mM tetrabutylammonium bisulfate (pH 6.0) solution, and mobile phase B was 75% acetonitrile solution. The assay temperature was 30°C, the flow rate was 1 mL / min, and the HPLC UV detector wavelength was 254 nm. Different gradient elution programs were used to analyze each product. The 2'-F-UMP fraction was collected and lyophilized at -20°C. The crude yield and product concentration were calculated based on the initial substrate concentration and the peak area of ​​each component in the HPLC analysis.

[0086] Dm HPLC analysis results of dNK catalysis for the formation of 2'-F-UMP from 2'-FU are as follows: Dm As shown in B in the diagram.

[0087] Example 5. Dm dNK-catalyzed synthesis of 2'-F-CMP and purification of its products

[0088] 2'-F-C Figure 2 dNK catalyzed reaction to monophosphate, and the reaction products were analyzed and purified by HPLC. The reaction system contained 50 mM Tris-HCl pH 8.0, 100 mM KCl, 12 mM ATP, 10 mM 2'-F-C, 50 mM MgCl2and 6 μM Dm dNK. Incubation at 37°C for 3 h, followed by incubation at 95°C for 15 min to inactivate the enzyme. The reaction was diluted with 4 volumes of water, and the protein was removed by centrifugation at 6000 rpm through a 10 kDa ultrafiltration column. Then 50 μL of the filtrate was analyzed by HPLC. The mobile phase was prepared as follows: mobile phase A was 10 mM tetrabutylammonium bisulfate (pH 6.0) solution, and mobile phase B was 75% acetonitrile solution. The assay temperature was 30°C, the flow rate was 1 mL / min, and the UV detector detection wavelength was 254 nm. Different gradient elution procedures were used to analyze each product, and the 2'-F-CMP fractions were collected and lyophilized and stored at -20°C. The crude yield and product concentration were calculated according to the initial substrate concentration and the peak area of each fraction in HPLC.

[0089] Dm The HPLC analysis results of dNK catalyzed 2'-F-C to 2'-F-CMP are shown in FIG. 4C. Dm

[0090] Example 6. Dm dNK-catalyzed synthesis of 2'-F-GMP and purification of its products

[0091] 2'-F-G Figure 2 dNK catalyzed reaction to monophosphate, and the reaction products were analyzed and purified by HPLC. The reaction system contained 50 mM Tris-HCl pH 8.0, 100 mM KCl, 12 mM ATP, 10 mM 2'-F-G, 50 mM MgCl2and 6 μM Dm ​dNK. Incubate at 37°C for 3 h, then at 95°C for 15 min to deactivate the enzyme. Dilute the reaction with 4 volumes of water, remove the protein by centrifugation through a 10 kDa ultrafiltration column at 6000 rpm, and then take 50 μL of the filtrate for HPLC analysis. The mobile phase was prepared as follows: mobile phase A was 10 mM tetrabutylammonium bisulfate (pH 6.0) solution, and mobile phase B was 75% acetonitrile solution. The assay temperature was 30°C, the flow rate was 1 mL / min, and the UV detector detection wavelength was 254 nm. Different gradient elution programs were used to analyze each product. The 2'-F-GMP fractions were collected and stored at -20°C after lyophilization. The crude yield and product concentration were calculated according to the initial substrate concentration and the peak area of each component in HPLC.

[0092] Dm The HPLC analysis results of dNK catalyzing 2'-F-G to generate 2'-F-GMP are shown in FIG. 6D. Dm

[0093] Example 7. Mr PPK and Mr PPK (D127N) activity detection on four monophosphate substrates

[0094] 2'-F-NMPs were subjected to Mr PPK and Mr PPK (D127N) catalyzed reactions to generate triphosphates, and the reaction products were analyzed by HPLC. The reaction system contained 20 mM Tris-HCl pH 8.0, 4 mM polyP6, 2 mM 2'-F-NMP, 20 mM MgCl2, 1 μM Mr PPK or 1 μM Mr PPK (D127N). After incubating the reaction solution for 3 h, it was diluted with 4 volumes of water, and then the protein was removed by centrifugation through a 10 kDa ultrafiltration column at 6000 rpm. Finally, the reaction products were analyzed by HPLC. The mobile phase A of HPLC was 10 mM tetrabutylammonium bisulfate (pH 6.0) solution, and the mobile phase B was 75% acetonitrile solution. The injection volume for HPLC detection was 50 μL, the detection temperature was 30°C, the flow rate of the mobile phase was 1 mL / min, the detection wavelength of the UV detector was 254 nm, and different gradient elution programs were used to analyze each product. The experimental results showed that, Mr PPK (D127N) had higher activity on 2'-F-UMP and 2'-F-GMP than PPK, and the product yield was increased by 0.8 times and 3.5 times, respectively. Mr Mr PPK had better activity on 2'-F-AMP and 2'-F-CMP than PPK, and the product yield was increased by​​Mr PPK (D127N) was 20% and 31% higher.

[0095] Example 8. Mr PPK-catalyzed 2'-F-ATP synthesis and its product analysis and purification

[0096] 2'-F-AMP Mr The PPK-catalyzed reaction produces triphosphate, and the reaction product is then analyzed by HPLC. The reaction system contains 20 mM Tris-HCl (pH 8.0), 4 mM polyP6, 2 mM 2'-F-AMP, 20 mM MgCl2, and 1 μM... Mr PPK. The reaction solution was incubated at 37°C for 10 h, then diluted with 4 times its volume of water, and centrifuged at 6000 rpm using a 10 kDa ultrafiltration column to remove proteins. The reaction products were then analyzed by HPLC. The mobile phase A for HPLC was 10 mM tetrabutylammonium bisulfate (pH 6.0), and the mobile phase B was 75% acetonitrile. The injection volume for HPLC detection was 50 μL, the detection temperature was 30°C, the mobile phase flow rate was 1 mL / min, and the detection wavelength was 254 nm using a UV detector. Different gradient elution programs were used to analyze each product. The 2'-F-ATP fraction was collected and lyophilized at -20°C. The crude yield and product concentration were calculated based on the initial substrate concentration and the peak areas of each component in the HPLC analysis.

[0097] Mr HPLC analysis results of PPK-catalyzed 2'-F-AMP reaction to generate 2'-F-ATP are as follows: Dm As shown in A in the diagram.

[0098] Example 9. Mr PPK (D127N)-catalyzed synthesis of 2'-F-UTP and its product analysis and purification

[0099] 2'-F-UMP Mr PPK (D127N) catalyzed the reaction to produce triphosphate, and the reaction products were analyzed by HPLC. The reaction system contained 20 mM Tris-HCl pH 8.0, 4 mM polyP6, 2 mM 2'-F-UMP, 20 mM MgCl2, and 1 μM... MrPPK (D127N). The reaction solution was incubated at 37°C for 8 h, then diluted with 4 volumes of water, and then centrifuged at 6000 rpm using a 10 kDa ultrafiltration column to remove proteins. The reaction products were finally analyzed by HPLC. The injection volume for HPLC detection was 50 μL, the detection temperature was 30°C, the mobile phase flow rate was 1 mL / min, and the detection wavelength was 254 nm using a UV detector. Different gradient elution programs were used to analyze each product. The 2'-F-UTP fraction was collected and lyophilized at -20°C. The crude yield and product concentration were calculated based on the initial substrate concentration and the peak area of ​​each component in the HPLC results.

[0100] Mr The HPLC analysis results of PPK (D127N) catalysis for the formation of 2'-F-UTP from 2'-F-UMP are as follows: Figure 2 As shown in B in the diagram.

[0101] Example 10. Mr PPK-catalyzed synthesis of 2'-F-CTP and analysis and purification of its products

[0102] 2'-F-CMP passed through Mr The PPK-catalyzed reaction produces triphosphate, and the reaction product is then analyzed by HPLC. The reaction system contains 20 mM Tris-HCl pH 8.0, 4 mM polyP6, 2 mM 2'-F-CMP, 20 mM MgCl2, and 1 μM... Mr PPK. The reaction solution was incubated at 37°C for 4 h, then diluted with 4 times its volume of water, and then centrifuged at 6000 rpm using a 10 kDa ultrafiltration column to remove proteins. The reaction products were finally analyzed by HPLC. The injection volume for HPLC detection was 50 μL, the detection temperature was 30°C, the mobile phase flow rate was 1 mL / min, and the detection wavelength was 254 nm using a UV detector. Different gradient elution programs were used to analyze each product. The 2'-F-CTP fraction was collected and lyophilized at -20°C. The crude yield and product concentration were calculated based on the initial substrate concentration and the peak area of ​​each component in the HPLC results.

[0103] Mr HPLC analysis results of PPK catalysis for the formation of 2'-F-CTP from 2'-F-CMP are as follows: Figure 3 As shown in C.

[0104] Example 11. Mr PPK (D127N)-catalyzed synthesis of 2'-F-GTP and analysis and purification of its products

[0105] 2'-F-GMP passed MrPPK (D127N) catalyzed the reaction to produce triphosphate, and the reaction products were then analyzed by HPLC. The reaction system contained 20 mM Tris-HCl pH 8.0, 4 mM polyP6, 2 mM 2'-F-GMP, 20 mM MgCl2, and 1 μM... Mr PPK (D127N). The reaction solution was incubated at 37°C for 12 h, then diluted with 4 volumes of water, and centrifuged at 6000 rpm using a 10 kDa ultrafiltration column to remove proteins. The reaction products were then analyzed by HPLC. The injection volume for HPLC detection was 50 μL, the detection temperature was 30°C, the mobile phase flow rate was 1 mL / min, and the detection wavelength was 254 nm using a UV detector. Different gradient elution programs were used to analyze each product. The 2'-F-GTP fraction was collected and lyophilized at -20°C. The crude yield and product concentration were calculated based on the initial substrate concentration and the peak areas of each component in the HPLC results.

[0106] Mr The HPLC analysis results of PPK (D127N) catalysis for the formation of 2'-F-GMP from 2'-F-GTP are as follows: Figure 3 As shown in D in the diagram.

[0107] Example 12. XNA was synthesized from four 2'-F-NTPs prepared by the above enzymatic method via primer extension reaction.

[0108] The template and primers were mixed in a 2:1 ratio, denatured at 95°C for 10 min, slowly cooled to room temperature, and incubated on ice for 5 min. The remaining reagents were then added to the mixture, and the mixture was placed in a PCR instrument to synthesize XNA at the specified reaction temperature and time. The sequences of the DNA templates T-A6, T-U6, T-C6, T-G6, and T-X10 are as follows:

[0109] T-A6: 5'-TTTTTTGCTAGCCTGGAGAGCA-3';

[0110] T-U6: 5'-AAAAAAGCTAGCCTGGAGAGCA-3';

[0111] T-C6: 5'-GGGGGGGCTAGCCTGGAGAGCA-3';

[0112] T-G6: 5'-CCCCCCGCTAGCCTGGAGAGCA-3';

[0113] T-X10: 5'-TGCATGATCTGCTAGCCTGGAGAGCA-3'.

[0114] The sequence of primer FAM-P8-R is as follows:

[0115] FAM-P8-R 5'-FAM-TGCTCTCCAGGCTAGC-3'.

[0116] Pfu DNA polymerase mutant P1 exo - The reaction system for synthesizing 6 bp DNA or XNA full-length product with DNA as template includes the following components:

[0117] 100 nM DNA template, 50 nM primer FAM-P8-R, 1x Pfu buffer, 0.5 mM dATP or 0.5 mM dGTP or 0.5 mM dTTP or 0.5 mM dCTP, 1 μM P1 exo - ; ddH2O to 50 μL. Or:

[0118] 100 nM DNA template, 50 nM primer FAM-P8-R, 1x Pfu buffer, commercially available 0.5 mM 2'-F-ATP or 0.5 mM 2'-F-GTP or 0.5 mM 2'-F-UTP or 0.5 mM 2'-F-CTP, 1 μM P1 exo - ; ddH2O to 50 μL. Or:

[0119] 100 nM DNA template, 50 nM primer FAM-P8-R, 1x Pfu buffer, 0.5 mM 2'-F-ATP or 0.5 mM 2'-F-GTP or 0.5 mM 2'-F-UTP or 0.5 mM 2'-F-CTP synthesized by enzyme catalytic reaction and HPLC separation and purification, 1 μM P1 exo - ; ddH2O to 50 μL.

[0120] P1 exo - The reaction system for synthesizing 10 bp mixed base sequence DNA or XNA full-length product with DNA as template is as follows:

[0121] 40 nM DNA template, 20 nM primer FAM-P8-R, 1x Pfu buffer, 0.5 mM dATP, 0.5 mM dGTP, 0.5 mM dTTP, 0.5 mM dCTP, 1 μM P1 exo - ; ddH2O to 50 μL. Or:

[0122] 40 nM DNA template, 20 nM primer FAM-P8-R, 1x Pfu buffer, commercial 0.5 mM 2'-F-ATP, 0.5 mM 2'-F-GTP, 0.5 mM 2'-F-UTP, 0.5 mM 2'-F-CTP, 1 μΜ P1 exo - ; ddH2O to 50 μL.

[0123] 40 nM DNA template, 20 nM primer FAM-P8-R, 1x Pfu buffer, enzymatically synthesized and HPLC purified 0.5 mM 2'-F-ATP, 0.5 mM 2'-F-GTP, 0.5 mM 2'-F-UTP, 0.5 mM 2'-F-CTP, 1 μΜ P1 exo - ; ddH2O to 50 μL.

[0124] The reaction was incubated at 72 °C for 2 h. After the reaction was completed, twice the volume of 2x TBE-Urea loading buffer of the reaction system was added to the product, denatured at 95 °C for 10 min, and finally the reaction product was analyzed by urea polyacrylamide gel electrophoresis.

[0125] The electrophoresis results of each reaction product are shown in Figure 3 .

[0126] Figure 3 Lane 1, 5 in A are primer controls; lane 2 is P1 exo - DNA full-length product synthesized with T-A6 as template and commercial dATP as substrate; lane 3 is P1 exo - XNA full-length product synthesized with T-A6 as template and commercial 2'-F-ATP as substrate; lane 4 is P1 exo - XNA full-length product synthesized with T-A6 as template and enzymatically synthesized and HPLC purified 2'-F-ATP as substrate. - DNA full-length product synthesized with T-U6 as template and commercial dTTP as substrate; lane 7 is P1 exo - XNA full-length product synthesized with T-U6 as template and commercial 2'-F-UTP as substrate; lane 8 is P1 exo - XNA full-length product synthesized with T-U6 as template and enzymatically synthesized and HPLC purified 2'-F-UTP as substrate.

[0127] Figure 4 Lane 1, 5 in B are primer controls; lane 2 is P1 exo -Lane 1: DNA full-length product synthesized with T-C6 as template and commercial dCTP as substrate; Lane 2: P1 exo - Lane 3: XNA full-length product synthesized with T-C6 as template and commercial 2'-F-CTP as substrate; Lane 4: P1 exo - Lane 5: XNA full-length product synthesized with T-C6 as template and enzymatically synthesized 2'-F-CTP as substrate, which was separated and purified by HPLC. Lane 6: P1 exo - Lane 7: DNA full-length product synthesized with T-G6 as template and commercial dGTP as substrate; Lane 8: P1 exo - Lane 9: XNA full-length product synthesized with T-G6 as template and commercial 2'-F-GTP as substrate; Lane 10: P1 exo - Lane 11: XNA full-length product synthesized with T-G6 as template and enzymatically synthesized 2'-F-GTP as substrate, which was separated and purified by HPLC.

[0128] Figure 4 Figure 4 Figure 4 Lane 1: Primer control; Lane 2: P1 exo - Lane 3: DNA full-length product synthesized with T-X10 as template and commercial dNTPs as substrate; Lane 4: P1 exo - Lane 5: XNA full-length product synthesized with T-X10 as template and commercial 2'-F-NTPs as substrate; Lane 6: P1 exo - Lane 7: XNA full-length product synthesized with T-X10 as template and enzymatically synthesized 2'-F-NTPs as substrate, which was separated and purified by HPLC.

[0129] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application are equivalent replacement methods, which are all included in the protection scope of the present application.

Claims

1. A method for synthesizing 2'-fluoro-2'-deoxynucleoside-5'-triphosphate, characterized in that, Includes the following steps: S1. 2'-Fluoro-2'-deoxynucleoside-5'-monophosphate was obtained by reacting in a system containing adenosine triphosphate, 2'-fluoro-2'-deoxynucleoside, magnesium ions and deoxynucleoside kinase; S2. Separate and purify the 2'-fluoro-2'-deoxynucleoside-5'-monophosphate obtained in step S1, and react it in a system containing polyphosphate, magnesium ions and polyphosphate kinase to obtain 2'-fluoro-2'-deoxynucleoside-5'-triphosphate; The deoxynucleoside kinase mentioned in step S1 is derived from Drosophila melanogaster (… Drosophila melanogaster deoxynucleoside kinase Dm dNK; The polyphosphokinase mentioned in step S2 is derived from *Thermus rubrum* (…). Meiothermus ruber polyphosphokinase Mr PPK or its mutants Mr PPK-D127N.

2. The synthesis method according to claim 1, characterized in that, The concentration of adenosine triphosphate in the system mentioned in step S1 is 1–20 mM; The concentration of the 2'-fluoro-2'-deoxynucleotide in the system described in step S1 is 5–20 mM; The concentration of magnesium ions in the system mentioned in step S1 is 1–100 mM; The deoxynucleoside kinase described in step S1 Dm The concentration of dNK in the system was 3–9 μM.

3. The synthesis method according to claim 1, characterized in that, The system described in step S1 also includes 20–50 mM Tris-HCl with pH 5.0–10.0 and 1–150 mM KCl.

4. The synthesis method according to claim 1, characterized in that, The reaction described in step S1 is carried out at a temperature of 30–37°C for 1–10 h.

5. The synthesis method according to claim 1, characterized in that, The polyphosphate mentioned in step S2 is sodium hexametaphosphate; The concentration of polyphosphoric acid in the system mentioned in step S2 is 1-10 mM; The concentration of 2'-fluoro-2'-deoxynucleotide monophosphate in the system described in step S2 is 1–10 mM; The concentration of magnesium ions in the system mentioned in step S2 is 20–100 mM; The concentration of the polyphosphokinase described in step S2 in the system is 1–5 μM.

6. The synthesis method according to claim 1, characterized in that, The system described in step S2 also includes 10–100 mM Tris-HCl with a pH of 5.0–10.

0.

7. The synthesis method according to claim 1, characterized in that, The reaction described in step S2 is carried out at a temperature of 30–80°C for 1–15 h.

8. The use of the synthetic method according to any one of claims 1 to 7 in the preparation of 2'-fluorine modified heterologous nucleic acids.