Primer group for rapidly and visually identifying spodoptera frugiperda and application of primer group

Abstract

The invention discloses a primer group for rapidly and visually identifying spodoptera frugiperda and application of the primer group. The technical problem to be solved by the invention is to identify the spodoptera frugiperda. The invention discloses a primer composition, the primer composition comprises a primer pair Sf-1F / Sf-1R, and the primer pair Sf-1F / Sf-1R is composed of a primer Sf-1F and a primer Sf-1R. The invention further discloses a probe Sf-Probe1 matched with the primer group for use, the primer pair Sf-1F / Sf-1R or the primer pair Sf-1F / Sf-1R and the probe Sf-Probe1 are used for performing in-vitro amplification on a to-be-detected sample, and whether the to-be-detected sample contains the spodoptera frugiperda or not can be accurately judged according to an amplification result.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a primer set for rapid visual identification of fall armyworm and an application thereof. Background Art

[0002] Fall armyworm, scientific name Spodoptera frugiperda (Smith), English name Fall Armyworm, commonly known as Fall Armyworm in Chinese, Lepidoptera, Noctuidae, Spodoptera. Fall armyworm is native to tropical and subtropical regions of America. It mainly feeds on leaves, stems and reproductive organs of more than 350 kinds of plants. Its main hosts are Gramineae, Asteraceae and Leguminosae, which can cause serious damage to a variety of crops with economic value. In addition, the large-scale use of pesticides to control fall armyworm will affect the population of beneficial insects such as bees in corn fields, threatening the healthy development of agricultural ecosystems. Currently in my country, this insect mainly harms corn. It is estimated that even under the prevention and control scenario, the potential economic losses caused by the fall armyworm to my country's corn can reach 6.6 billion to 54.3 billion yuan each year. After the actual occurrence, it caused economic losses of about 13.9929 million yuan in Dehong Dai and Jingpo Autonomous Prefecture alone in 2019, posing a serious threat to my country's food security.

[0003] The fall armyworm first invaded Central and West Africa in early 2016, and has since spread throughout sub-Saharan Africa. In 2017, it was listed as one of the world's top ten plant pests by the International Center for Agriculture and Biosciences (CABI). In 2018, it landed on the Indian continent. Today, 122 countries and regions around the world, including Africa, Asia, Oceania, and Europe, have reported the invasion of the insect, posing a major threat to global food production security. It has been listed as a major migratory pest for global warning by the Food and Agriculture Organization of the United Nations. In December 2018, high-altitude monitoring lights in Lancang County, Yunnan Province, my country lured suspected fall armyworm individuals. In the same month, new pests were found in corn fields in Jiangcheng County. In January 2019, it was confirmed to be fall armyworm through morphological and molecular identification. This was the first time that the insect was reported to invade and cause damage in my country. It was subsequently reported to have spread to 1,518 counties (cities and districts) in 26 provinces across the country. According to data from the National Agricultural Technology Extension Center, as of April 20, 2023, the fall armyworm has occurred in a total of 2.77 million mu of land in 274 counties and districts in nine provinces, including Yunnan, Guangdong, Sichuan, Guangxi, Hainan, Fujian, Guizhou, Hunan and Jiangxi. Its field monitoring and identification has received more attention. Therefore, there is an urgent need to develop field monitoring technology suitable for the front line.

[0004] At present, the identification of fall armyworm is mainly based on traditional morphological identification and molecular biological identification technology. However, due to the existence of similar species, the morphological identification of its eggs, pupae, and young larvae is very difficult; and often the captured insect samples in actual situations are not necessarily easy to distinguish adults and older larvae. At the same time, adults and older larvae may also be difficult to accurately identify through traditional morphological methods because of the serious loss of scales on the wings or the damage to the body. It takes a long time to raise non-imaginal insects to adults and then identify the species, which seriously affects the speed of field monitoring and control and thus expands the harm of the insect. The existing molecular identification technology is mainly PCR, real-time fluorescence PCR technology and loop-mediated isothermal amplification technology. Although accurate identification can be achieved, it relies on expensive instruments and equipment, has high identification costs, and does not meet the current field and on-site monitoring and identification requirements. Therefore, it is very necessary for people in this field to develop multi-enzyme constant temperature rapid amplification identification technology for fall armyworm. Summary of the invention

[0005] The technical problem solved by the present invention is to rapidly detect fall armyworm at a constant temperature.

[0006] In order to solve the above technical problems, the present invention provides a primer composition.

[0007] The primer composition includes a primer pair Sf-1F / Sf-1R, and the primer pair Sf-1F / Sf-1R consists of a primer Sf-1F and a primer Sf-1R;

[0008] The primer Sf-1F is as follows A1) or A2):

[0009] A1) a single-stranded DNA molecule as shown in Sequence 1 in the sequence listing;

[0010] A2) a single-stranded DNA molecule having the same function as sequence 1 after one or more nucleotides are substituted and / or deleted and / or added;

[0011] The primer Sf-1R is as follows B1) or B2):

[0012] B1) a single-stranded DNA molecule as shown in Sequence 2 in the sequence listing;

[0013] B2) A single-stranded DNA molecule having the same function as sequence 2, wherein one or several nucleotides in sequence 2 are replaced and / or deleted and / or added.

[0014] In the above primer combination, the molar ratio of the primer Sf-1F to the primer Sf-1R is 1:1.

[0015] In order to solve the above technical problems, the present invention also provides biological materials for identifying or assisting in identifying whether a sample to be tested contains fall armyworm.

[0016] The biological material includes any of the following:

[0017] D1) an in vitro nucleic acid amplification reagent containing the primer combination;

[0018] D2) a kit containing the primer composition or the in vitro nucleic acid amplification reagent described in D1);

[0019] D3) A detection instrument comprising the above primer combination, the in vitro nucleic acid amplification reagent described in D1) or the kit described in D2).

[0020] In the above, the sample to be tested may further contain at least one of Spodoptera litura, Spodoptera exigua, Cotton bollworm, Asian corn borer, Concha sylvestris and armyworm.

[0021] The present application uses multi-enzyme constant temperature amplification as the amplification means to perform specific amplification.

[0022] Use of the primer composition or the biological material in any of the following:

[0023] E1) Use for assisting detection or detecting whether a sample to be tested contains fall armyworm and / or for preparing a product for assisting detection or detecting whether a sample to be tested contains fall armyworm;

[0024] E2) Use for assisting detection or detecting whether a sample to be tested is fall armyworm and / or for preparing a product for assisting detection or detecting whether a sample to be tested is fall armyworm;

[0025] E3) Use for distinguishing or assisting in distinguishing fall armyworm from other moths and / or for preparing a product for distinguishing or assisting in distinguishing fall armyworm from other moths;

[0026] E4) Use for identifying or assisting in identifying the fall armyworm and / or for preparing a product for identifying or assisting in identifying the fall armyworm.

[0027] In the above, the test sample described in E1) may further contain at least one of Spodoptera litura, Spodoptera exigua, Cotton bollworm, Asian corn borer, Concha sylvestris and armyworm.

[0028] In the above, the test sample in E2) may be Spodoptera litura, Spodoptera exigua, Cotton bollworm, Asian corn borer, Concha sylvestris or armyworm.

[0029] In the above, the other moths mentioned in E3) may be Spodoptera litura, Spodoptera exigua, Cotton bollworm, Asian corn borer, Concha pygmaeus or armyworm.

[0030] In order to solve the above technical problems, the present invention also provides a kit.

[0031] The kit contains the primer combination according to claim 1 or 2 and the probe Sf-Probe1; the structure of the probe Sf-Probe1 is SEQ ID No.3-tetrahydrofuran residue-SEQ ID No.4, the first cytosine deoxyribonucleotide of SEQ ID No.3 is labeled with a fluorescent group, and the 3' end of SEQ ID No.4 is blocked and modified; the 5' end of the primer Sf-1R is labeled with biotin.

[0032] In the above, the fluorescent group is selected from at least one of FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705 or Texas Red.

[0033] In the above, the 3' end of SEQ ID No. 4 is connected to C3-spacer.

[0034] In the above, the C3-spacer is a short 3-carbon spacer modification.

[0035] In the above, the short 3-carbon chain interarm modification refers to connecting a 3-carbon chain to the terminal 3' hydroxyl group of the oligonucleotide.

[0036] In the above, the FAM is 5-carboxyfluorescein. The molecular formula of the 5-carboxyfluorescein is C 21 H 12 O7.

[0037] In the above, the oxygen atom of tetrahydrofuran forms a covalent bond with the phosphorus atom of the phosphate group at the 5' end of SEQ ID No.4.

[0038] In the above, the lone pair of electrons on the oxygen atom of tetrahydrofuran will form a hydrogen bond with the hydrogen atom on the 3' terminal hydroxyl group of SEQ ID No.3.

[0039] In the above, the carboxyl group of the carbon atom at position 5 of 5-carboxyfluorescein and the amino group of the cytosine deoxyribonucleotide at position 1 of SEQ ID No. 3 form an amide bond through a condensation reaction.

[0040] The use of the above-mentioned kit in any of the following;

[0041] E1) Use for assisting detection or detecting whether a sample to be tested contains fall armyworm and / or for preparing a product for assisting detection or detecting whether a sample to be tested contains fall armyworm;

[0042] E2) Use for assisting detection or detecting whether a sample to be tested is fall armyworm and / or for preparing a product for assisting detection or detecting whether a sample to be tested is fall armyworm;

[0043] E3) Use for distinguishing or assisting in distinguishing fall armyworm from other moths and / or for preparing a product for distinguishing or assisting in distinguishing fall armyworm from other moths;

[0044] E4) Use for identifying or assisting in identifying the fall armyworm and / or for preparing a product for identifying or assisting in identifying the fall armyworm.

[0045] In the above, the test sample described in E1) may further contain at least one of Spodoptera litura, Spodoptera exigua, Cotton bollworm, Asian corn borer, Concha sylvestris and armyworm.

[0046] In the above, the test sample in E2) may be Spodoptera litura, Spodoptera exigua, Cotton bollworm, Asian corn borer, Concha sylvestris or armyworm.

[0047] In the above, the other moths mentioned in E3) may be Spodoptera litura, Spodoptera exigua, Cotton bollworm, Asian corn borer, Concha pygmaeus or armyworm.

[0048] In the above-mentioned application species, the test sample in E1) further contains at least one of Spodoptera litura, Spodoptera exigua, Cotton bollworm, Asian corn borer, Concha sylvestris and armyworm;

[0049] and / or,

[0050] The test sample in E2) is Spodoptera litura, Spodoptera exigua, Cotton bollworm, Asian corn borer, Concha sylvestris or armyworm.

[0051] In order to solve the above technical problems, the present invention also provides a method for identifying or assisting in identifying whether a sample to be tested contains fall armyworm.

[0052] The method comprises method A or method B;

[0053] Method A is to use the above primer combination or the above biological material to perform the above in vitro nucleic acid amplification on any of the above test samples, and determine whether the test sample contains fall armyworm according to the specific product of the in vitro nucleic acid amplification;

[0054] Method B is to use the above primer combination and the above probe to perform the above in vitro nucleic acid amplification on any of the above test samples, use the amplification product on lateral flow chromatography test paper, and judge whether the fall armyworm is present in the test sample according to the color development result.

[0055] In the above, the specific product of in vitro nucleic acid amplification may be the sequence, size and / or presence or absence of the specific product of in vitro nucleic acid amplification.

[0056] In the above, the method A is specifically as follows: extract the nucleic acid of the sample to be tested, use the nucleic acid of the sample to be tested as a template, and use the above-mentioned primer pair to perform multi-enzyme isothermal amplification; after the multi-enzyme isothermal amplification reaction is completed, determine whether the sample to be tested contains the fall armyworm by detecting the reaction product: if the reaction product shows a clear and bright band near 274bp after electrophoresis, the sample to be tested contains or is a candidate to contain the fall armyworm; if the reaction product does not produce a band after electrophoresis, the sample to be tested does not contain or is a candidate to not contain the fall armyworm.

[0057] In the above, the method B is specifically as follows: extract the nucleic acid of the sample to be tested, take the nucleic acid of the sample to be tested as a template, and use the above-mentioned primer group to perform multi-enzyme constant temperature-lateral flow chromatography test strip system amplification; after the amplification reaction of the multi-enzyme constant temperature-lateral flow chromatography test strip system is completed, dilute the reaction product 10-20 times and then drop it into the lateral flow chromatography test strip sample pad for detection for 5-10 minutes, and after the detection is completed, observe whether the test line of the lateral flow chromatography test strip is colored to determine whether the moth to be tested is the fall armyworm: if the test line of the lateral flow chromatography test strip is red, the moth to be tested is or the candidate is the fall armyworm; if the test line of the lateral flow chromatography test strip is white, the moth to be tested is not or the candidate is not the fall armyworm.

[0058] In order to solve the above technical problems, the present invention also provides a method for identifying or assisting in identifying whether a sample to be tested is fall armyworm, characterized in that the method includes method C or method D;

[0059] Method C is to use the above primer combination or the above biological material to perform the in vitro nucleic acid amplification on any of the above test samples, and determine whether the test sample is fall armyworm according to the specific product of the in vitro nucleic acid amplification;

[0060] Method D is to use the above primer combination and the above probe to perform the above in vitro nucleic acid amplification on any of the above test samples, use the amplification product on lateral flow chromatography test paper, and judge whether the test sample is fall armyworm according to the color development result.

[0061] In the present application, the fall armyworm may originate from Fujian, Yunnan, Hainan, Jiangxi, Guangdong, or Jiangsu.

[0062] In the above, the detection line of the lateral flow chromatography test paper is coated with anti-biotin antibody.

[0063] In the above, the quality control line of the lateral flow chromatography test paper is coated with an antibody of an anti-fluorescent group antibody. The fluorescent group can be a fluorescent group selected from FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LCRED640, LC RED705, Quasar705 or Texas Red. Specifically in the embodiment of the present application, the fluorescent group is specifically a FAM fluorescent group.

[0064] In the above, the method C is specifically as follows: extract the nucleic acid of the moth to be tested, use the nucleic acid of the moth to be tested as a template, and use the above-mentioned primer pair to perform multi-enzyme isothermal amplification; after the multi-enzyme isothermal amplification reaction is completed, determine whether the moth to be tested is the fall armyworm by detecting the reaction product: if the reaction product shows a clear and bright band near 274bp after electrophoresis, the moth to be tested is or is a candidate for the fall armyworm; if the reaction product does not produce a band after electrophoresis, the moth to be tested is not or is not a candidate for the fall armyworm.

[0065] In the above, the method D is specifically as follows: extract the nucleic acid of the moth to be tested, take the nucleic acid of the moth to be tested as a template, and use the above-mentioned primer group to perform multi-enzyme constant temperature-lateral flow chromatography test strip system amplification; after the amplification reaction of the multi-enzyme constant temperature-lateral flow chromatography test strip system is completed, dilute the reaction product 10-20 times and then drop it into the lateral flow chromatography test strip sample pad for detection for 5-10 minutes. After the detection is completed, observe whether the test line of the lateral flow chromatography test strip is colored to determine whether the moth to be tested is the fall armyworm: if the test line of the lateral flow chromatography test strip is red, the moth to be tested is or the candidate is the fall armyworm; if the test line of the lateral flow chromatography test strip is white, the moth to be tested is not or the candidate is not the fall armyworm.

[0066] In order to solve the above technical problems, the present invention also provides a method for distinguishing or assisting in distinguishing the fall armyworm from other moths.

[0067] The method includes method E or method F;

[0068] Method E is to use the primer composition of claim 1 or the biological material of claim 3 to perform the in vitro nucleic acid amplification on the sample to be tested in any one of claims 4 to 7, and determine whether the sample to be tested is fall armyworm according to the specific product of the in vitro nucleic acid amplification;

[0069] Method F is to use the primer composition described in claim 5 and the probe described in claim 5 to perform the in vitro nucleic acid amplification on the sample to be tested in any one of claims 4-7, use the amplification product on lateral flow chromatography test paper, and judge whether the sample to be tested is fall armyworm according to the color development result.

[0070] The method E is specifically as follows: extracting the nucleic acid of the moth to be tested, using the nucleic acid of the moth to be tested as a template, and using the above primer pair to perform multi-enzyme constant temperature amplification; after the multi-enzyme constant temperature amplification reaction is completed, the reaction product is detected to determine whether the moth to be tested is the fall armyworm or other moths: if the reaction product shows a clear and bright band near 274 bp after electrophoresis, the moth to be tested is or is a candidate for the fall armyworm; if the reaction product does not produce a band after electrophoresis, the moth to be tested is or is a candidate for the other moths;

[0071] The method F is specifically as follows: extracting the nucleic acid of the moth to be tested, taking the nucleic acid of the moth to be tested as a template, and using the above-mentioned primer group to perform multi-enzyme constant temperature-lateral flow chromatography test strip system amplification; after the multi-enzyme constant temperature-lateral flow chromatography test strip system amplification reaction is completed, diluting the reaction product 10-20 times and then dropping it into the lateral flow chromatography test strip sample pad for detection for 5-10 minutes, and after the detection is completed, observing whether the test line of the lateral flow chromatography test strip is colored to determine whether the moth to be tested is the fall armyworm: if the test line of the lateral flow chromatography test strip is red, the moth to be tested is or the candidate is the fall armyworm; if the test line of the lateral flow chromatography test strip is white, the moth to be tested is not or the candidate is not the fall armyworm.

[0072] In the above method, the in vitro nucleic acid amplification is multi-enzyme isothermal amplification.

[0074] In the present application, the in vitro nucleic acid amplification may be multi-enzyme isothermal amplification.

[0075] In the present application, the multi-enzyme isothermal amplification reaction temperature is 37-39°C, specifically 37°C.

[0076] In the present application, the multi-enzyme isothermal amplification reaction time is 5-20 minutes, and can be specifically 15 minutes.

[0077] In the present application, the primer concentration in the multi-enzyme isothermal amplification reaction system is 0.20 μM-1.00 μM, and can be specifically 0.40 μM.

[0078] In the present application, the probe concentration in the multi-enzyme isothermal amplification reaction system is 0.05 μM-0.20 μM, and can be specifically 0.20 μM.

[0079] In the present application, the sample to be tested is genomic DNA.

[0080] Beneficial Effects

[0081] The present invention discloses a primer set for rapid visual identification of fall armyworm and its application. The technical problem to be solved by the present application is to identify fall armyworm. The present application discloses a primer composition, which includes a primer pair Sf-1F / Sf-1R, and the primer pair Sf-1F / Sf-1R consists of a primer Sf-1F and a primer Sf-1R. Further disclosed is a probe Sf-Probe1 used in conjunction with the primer set. By using the primer pair Sf-1F / Sf-1R or the primer pair Sf-1F / Sf-1R and the probe Sf-Probe1 to perform in vitro amplification on the sample to be tested, it can be accurately determined whether the sample to be tested contains or is fall armyworm according to the amplification result.

[0082] In vitro amplification can be specifically a multi-enzyme isothermal rapid amplification reaction. MIRA (multi-enzyme isothermal rapid amplification reaction) is an isothermal amplification technology that relies on the synergistic action of multiple functional proteins (T4 bacteriophage DNA helicase gp41 protein, Streptomyces coelicolor recA protein, single-strand binding protein, Escherichia coli DNA polymerase I, etc.). The MIRA system requires two specific primers that recognize the target gene. At 37°C-42°C, the recombinase and primer form a protein / single-stranded nucleotide complex Rec / ssDNA, which invades the double-stranded DNA template with the help of auxiliary proteins and single-stranded binding proteins; a D-loop region is formed at the invasion site, and the DNA double strand is scanned; after finding the target region complementary to the primer, the complex Rec / ssDNA disintegrates, and DNA polymerase I also binds to the 3' end of the primer to start chain extension. This process is rapidly and efficiently cyclic, thereby completing the exponential amplification of the target fragment in 20 to 40 minutes. It has been widely used in the efficient detection of human, animal and plant pathogens.

[0083] It is further used in lateral flow dipsticks. MIRA combined with lateral flow dipstick (LFD) technology requires the design of a colloidal gold probe between the upstream and downstream primers. The probe is a sequence complementary to the target fragment of 46-52 nt in length, modified with an antigen label (such as FAM) at the 5' end, labeled with a dSpacer (tetrahydrofuran, THF) in the middle of the 5' end and the 3' end, and labeled with a modification group (such as C3-Spacer) at the 3' end. At the same time, the 5' end of the downstream primer needs to be labeled with a modification group (commonly used Biotin). When the target fragment, colloidal gold probe, primer and nuclease nfo co-exist in the system, the nfo enzyme can recognize the THF molecule in the probe and cut off the molecule, so that the probe produces a free hydroxyl end, becoming an upstream primer, and then amplified with the downstream primer labeled with biotin, and finally obtaining an amplification product with a FAM group at the 5' end and biotin at the 3' end. The FAM group on the amplified product binds to the anti-FAM antibody of the colloidal gold particles on the sample pad to form an immune complex. The biotin on the complex is captured by the biotin ligand on the detection line, causing the amplified product to aggregate with the colloidal gold particles, and a red band appears on the detection line.

[0084] The MIRA visual detection system combined with LFD (MIRA-LFD) has the advantages of rapidity, sensitivity, specificity, and portability, and can meet the needs of rapid and accurate detection on site. BRIEF DESCRIPTION OF THE DRAWINGS

[0085] Figure 1It is the specific detection result of the primer pair Sf-1F / Sf-1R in step 2 of Example 1, wherein M: D2000 DNA marker, N: ddH2O, and channels 1-12 are fall armyworm in Fujian, fall armyworm in Yunnan, fall armyworm in Hainan, fall armyworm in Jiangxi, fall armyworm in Guangdong, fall armyworm in Jiangsu, fall armyworm litura, beet armyworm, cotton bollworm, Asian corn borer, peach borer and armyworm, respectively.

[0086] Figure 2 It is the specific detection result of the primer pair Sf-1F / Sf-2R in step 2 of Example 1, wherein M: D2000 DNA marker, N: ddH2O, and channels 1-12 are fall armyworm in Fujian, fall armyworm in Yunnan, fall armyworm in Hainan, fall armyworm in Jiangxi, fall armyworm in Guangdong, fall armyworm in Jiangsu, fall armyworm litura, beet armyworm, cotton bollworm, Asian corn borer, peach borer and armyworm, respectively.

[0087] Figure 3 It is the specific detection result of the primer pair Sf-1F / Sf-3R in step 2 of Example 1, wherein M: D2000 DNA marker, N: ddH2O, and channels 1-12 are fall armyworm in Fujian, fall armyworm in Yunnan, fall armyworm in Hainan, fall armyworm in Jiangxi, fall armyworm in Guangdong, fall armyworm in Jiangsu, fall armyworm litura, beet armyworm, cotton bollworm, Asian corn borer, peach borer and armyworm, respectively.

[0088] Figure 4 It is the specific detection result of the primer pair Sf-2F / Sf-1R in step 2 of Example 1, wherein M: D2000 DNA marker, N: ddH2O, and channels 1-12 are fall armyworm in Fujian, fall armyworm in Yunnan, fall armyworm in Hainan, fall armyworm in Jiangxi, fall armyworm in Guangdong, fall armyworm in Jiangsu, fall armyworm litura, beet armyworm, cotton bollworm, Asian corn borer, peach borer and armyworm, respectively.

[0089] Figure 5 The specific detection results of primer pair Sf-2F / Sf-2R in step 2 of Example 1, wherein M: D2000 DNA marker, N: ddH2O, and channels 1-12 are fall armyworm in Fujian, fall armyworm in Yunnan, fall armyworm in Hainan, fall armyworm in Jiangxi, fall armyworm in Guangdong, fall armyworm in Jiangsu, fall armyworm, fall armyworm, beet armyworm, cotton bollworm, Asian corn borer, peach borer, and armyworm. .

[0090] Figure 6The specific detection results of primer pair Sf-2F / Sf-3R in step 2 of Example 1, wherein M: D2000 DNA marker, N: ddH2O, and channels 1-12 are fall armyworm in Fujian, fall armyworm in Yunnan, fall armyworm in Hainan, fall armyworm in Jiangxi, fall armyworm in Guangdong, fall armyworm in Jiangsu, fall armyworm, fall armyworm, beet armyworm, cotton bollworm, Asian corn borer, peach borer, and armyworm. .

[0091] Figure 7 The specific detection results of the primer pair Sf-3F / Sf-1R in step 2 of Example 1, wherein M: D2000 DNA marker, N: ddH2O, and channels 1-12 are fall armyworm in Fujian, fall armyworm in Yunnan, fall armyworm in Hainan, fall armyworm in Jiangxi, fall armyworm in Guangdong, fall armyworm in Jiangsu, fall armyworm, fall armyworm, beet armyworm, cotton bollworm, Asian corn borer, peach borer, and armyworm. .

[0092] Figure 8 It is the specific detection result of the primer pair Sf-3F / Sf-2R in step 2 of Example 1, wherein M: D2000 DNA marker, N: ddH2O, and channels 1-12 are fall armyworm in Fujian, fall armyworm in Yunnan, fall armyworm in Hainan, fall armyworm in Jiangxi, fall armyworm in Guangdong, fall armyworm in Jiangsu, fall armyworm litura, beet armyworm, cotton bollworm, Asian corn borer, peach borer and armyworm, respectively.

[0093] Fig. 9 It is the specific detection result of the primer pair Sf-3F / Sf-3R in step 2 of Example 1, wherein M: D2000 DNA marker, N: ddH2O, and channels 1-12 are fall armyworm in Fujian, fall armyworm in Yunnan, fall armyworm in Hainan, fall armyworm in Jiangxi, fall armyworm in Guangdong, fall armyworm in Jiangsu, fall armyworm litura, beet armyworm, cotton bollworm, Asian corn borer, peach borer and armyworm, respectively.

[0094] Fig.10 The detection results of the Sf-Probe1 group in Example 2, lane 1 is the fall armyworm template in Fujian, and lane N is the sterile ultrapure water template.

[0095] Fig.11 The test results of the Sf-Probe2 group in Example 2, lane 1 is the fall armyworm template in Fujian, and lane N is the sterile ultrapure water template.

[0096] Fig.12 The detection results of the Sf-Probe3 group in Example 2, lane 1 is the fall armyworm template in Fujian, and lane N is the sterile ultrapure water template.

[0097] Fig.13 The detection results of Sf-Probe1 group in Example 2. Among them, M: D2000 DNA marker, N: ddH2O, and channels 1-12 are fall armyworm in Fujian, fall armyworm in Yunnan, fall armyworm in Hainan, fall armyworm in Jiangxi, fall armyworm in Guangdong, fall armyworm in Jiangsu, fall armyworm, fall armyworm, beet armyworm, cotton bollworm, Asian corn borer, peach borer and armyworm, respectively.

[0098] Fig.14 The sensitivity test results in Example 3. Wherein, N is ddH2O, 1-4 are 10.0ng / μL, 1.0ng / μL, 1.0×10 -1 ng / μL, 1.0×10 -2 ng / μL.

[0099] Fig.15 The flowchart and principle diagram of the combination of multi-enzyme constant temperature rapid amplification and lateral flow chromatography test strips of Examples 2 and 3 are shown. DETAILED DESCRIPTION

[0100] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0101] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0102] In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology and laboratory operation procedures used herein are terms and routine procedures widely used in the corresponding fields. At the same time, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below.

[0103] The term "gene" refers to a segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer regions) that are involved in the transcription / translation of the gene product and the regulation of said transcription / translation, as well as intervening sequences (introns) between individual coding regions (exons).

[0104] The term "template" refers to any nucleic acid molecule that can be used for amplification according to the present invention. Non-natural double-stranded RNA or DNA can be made into double-stranded DNA and used as double-stranded DNA. Any double-stranded DNA or product containing a variety of different double-stranded DNA molecules can be used as template DNA to amplify one or more loci of interest contained in the template DNA.

[0105] The term "primer" refers to an oligonucleotide that can be used in an amplification method such as the polymerase chain reaction (PCR) for amplifying a nucleotide sequence based on a polynucleotide sequence that corresponds to a specific genomic sequence. At least one PCR primer used to amplify a polynucleotide sequence is sequence-specific for the sequence.

[0106] The term "probe" refers to a molecule that binds to a specific sequence or subsequence or other portion of another molecule. Unless otherwise indicated, the term "probe" generally refers to a polynucleotide probe that binds to another polynucleotide (commonly referred to as a "target polynucleotide") through complementary base pairing. The probe can bind to a target polynucleotide that lacks complete sequence complementarity with the probe, depending on the stringency of the hybridization conditions. The probe can be labeled directly or indirectly.

[0107] The term "amplification reaction" refers to a process for copying a nucleic acid one or more times. In embodiments, the amplification method includes, but is not limited to, polymerase chain reaction, self-sustained sequence reaction, ligase chain reaction, rapid amplification of cDNA ends, polymerase chain reaction and ligase chain reaction, Q-β phage amplification, strand displacement amplification, or overlap extension splicing polymerase chain reaction. In some embodiments, a single molecule nucleic acid is amplified, for example, by digital PCR.

[0108] The term "kit" refers to any delivery system used to deliver substances. In reaction assays, such delivery systems include systems that store, transport or deliver reaction reagents (e.g., oligonucleotides, enzymes, etc. in appropriate containers) and / or support materials (e.g., buffers, instructions for performing the assay, etc.) from one location to another. For example, a kit comprises one or more housings (e.g., boxes) containing the relevant reaction reagents and / or support materials.

[0109] The terms "include", "including", "have", "contain" and the like are all open terms, meaning including but not limited to.

[0110] The term "nucleic acid" refers to a polymer that exists in a single or double-stranded form and comprises at least two deoxynucleotides or nucleotides. Unless specifically limited, the term encompasses nucleic acids comprising known analogs of natural nucleotides that have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise noted, a specific nucleic acid sequence also implicitly encompasses variants (e.g., degenerate codon substitutions), alleles, orthologs, SNPs and complementary sequences and sequences that are clearly noted. Specifically, degenerate codon substitutions can be obtained by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Cassolet al. (1992); Rossolin et al., Mol. Cell. Probes 8:91-98 (1994)). "Nucleotide" comprises the sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked by the phosphate group. "Bases" include purines and pyrimidines, which further include the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs, as well as synthetic derivatives of purines and pyrimidines, which include, but are not limited to, modifications that substitute new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates, and halogenated alkyls. The DNA may be present as antisense, plasmid DNA, portions of plasmid DNA, pre-compressed DNA, products of polymerase chain reaction (PCR), vectors (P1, PAC, BAC, YAC, artificial chromosomes), expression cassettes, chimeric sequences, chromosomal DNA, or derivatives of these groups. The term nucleic acid is used interchangeably with gene, cDNA, mRNA encoded by a gene, and interfering RNA molecules.

[0111] The terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of the features. Further, in the description of the present invention, unless otherwise specified, "plurality" means two or more.

[0112] The terms "optionally," "optional," or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0113] When the term "identity" is used to describe an amino acid sequence or a nucleic acid sequence relative to a reference sequence, the percentage of identical amino acids or nucleotides between two amino acid sequences or nucleic acid sequences is determined by conventional methods, for example, see Ausubel et al., eds. (1995), Current Protocols in MolecμLar Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN program (Dayhoff (1978), Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research Foundation, Washington, DC). There are many algorithms for aligning sequences and determining sequence identity, including the homology alignment algorithm of Needleman et al. (1970) J. Mol. Biol. 48: 443; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2: 482; the local homology algorithm of Pearson et al. (1988) P. The similarity search method of Proc. Natl. Acad. Sci. 85: 2444; Smith-Waterman algorithm (Meth. Mol. Biol. 70: 173-187 (1997); and BLASTP, BLASTN, and BLASTX algorithms (see Altsch μL et al. (1990) J. Mol. Biol. 215: 403-410). Computer programs that utilize these algorithms are also available and include, but are not limited to, ALIGN or Megalign (DNASTAR) software, or WU-BLAS T-2 (Altsch μL et al., Meth. Enzym., 266:460-480 (1996)); or GAP, BESTFIT, BLAST Altsch μL et al., supra, FASTA, and TFASTA, available in the Genetics Computing Group (GCG) package, Version 8, Madison, Wisconsin, USA; and CLUSTAL in the PC / Gene program provided by Intelligenetics, Mountain View, California.

[0114] The terms "multienzyme isothermal rapid amplification technology" and "multienzyme isothermal amplification" refer to the same technology, both referring to "Multienzyme Isothermal Rapid Amplification (MIRA)", which is a constant temperature rapid nucleic acid amplification technology that relies on the synergistic action of multiple functional proteins (helicase, recombinase, single-stranded binding protein, DNA polymerase, etc.) to achieve rapid nucleic acid amplification at room temperature.

[0115] The term "expression cassette" refers to a DNA capable of expressing a target protein or nucleic acid in a host cell. The expression cassette may also include a single-stranded or double-stranded nucleic acid molecule containing all regulatory sequences necessary for expressing a nucleic acid molecule of any of the above proteins. The regulatory sequence can direct the coding sequence to express any of the above proteins in a suitable host cell under compatible conditions. The regulatory sequence includes, but is not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal sequence, and a transcription terminator. At a minimum, the regulatory sequence includes a promoter and termination signals for transcription and translation. In order to introduce specific restriction enzyme sites into the vector so as to connect the regulatory sequence to the coding region of the nucleic acid sequence encoding the protein, a regulatory sequence with a linker may be provided. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence that mediates protein expression. The promoter may be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutant, truncated, and hybrid promoters, and may be obtained from a gene encoding an extracellular or intracellular protein that is homologous or heterologous to the host cell. The regulatory sequence may also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell to terminate transcription. The termination sequence may be operably linked to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that can function in the selected host cell may be used in the present invention. The regulatory sequence may also be a suitable leader sequence, i.e., an untranslated region of mRNA that is important for translation of the host cell. The leader sequence may be operably linked to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that can function in the selected host cell may be used in the present invention. The regulatory sequence may also be a signal peptide coding region that encodes an amino acid sequence attached to the amino terminus of the protein that can guide the encoded protein into the cell secretory pathway. Signal peptide coding regions that can guide the expressed protein into the secretory pathway of the host cell used may be used in the present invention. It may also be desirable to add regulatory sequences that can regulate protein expression according to the growth of the host cell. Examples of regulatory systems are those that can respond to chemical or physical stimuli (including in the presence of regulatory compounds) to open or close gene expression. Other examples of regulatory sequences are those that can amplify genes. In these cases, the nucleic acid sequence encoding the protein should be operably linked to the regulatory sequences.

[0116] The blood / cell / tissue genomic DNA extraction kit (item number DP316) in the following examples is a product of Tiangen Company. A1 buffer comes from DNA constant temperature rapid amplification kit (item number WLB8201KIT, product of Anpu Future Biotechnology Co., Ltd.) or A2 buffer comes from DNA constant temperature rapid amplification kit (colloidal gold test strip type) (item number WLN8203KIT, product of Anpu Future Biotechnology Co., Ltd.). B buffer comes from DNA constant temperature rapid amplification kit (item number WLB8201KI, product T of Anpu Future Biotechnology Co., Ltd.) or DNA constant temperature rapid amplification kit (colloidal gold test strip type) (item number WLN8203KIT, product of Anpu Future Biotechnology Co., Ltd.). Lateral flow chromatography test strips come from HybriDetect colloidal gold test strips (item number WLFS8201, product of Anpu Future Biotechnology Co., Ltd.). The number, species name and collection location information of the moth samples tested in the following examples are shown in Table 1. The samples are all placed in anhydrous ethanol and stored at -20°C for standby use.

[0117] Table 1

[0118]

[0119]

[0120] Using DNA barcoding technology for species identification:

[0121] The DNA of various moth samples in Table 1 was extracted using a blood / cell / tissue genomic DNA extraction kit (DP316, Tiangen Company) to obtain genomic DNA of moth samples (1 Spodoptera frugiperda genomic DNA, 2 Spodoptera frugiperda genomic DNA, 3 Spodoptera frugiperda genomic DNA, 4 Spodoptera frugiperda genomic DNA, 5 Spodoptera frugiperda genomic DNA, 6 Spodoptera frugiperda genomic DNA, 7 Spodoptera litura genomic DNA, 8 Spodoptera exigua genomic DNA, 9 Helicoverpa armigera genomic DNA, 10 Asian corn borer genomic DNA, 11 Concha oleracea genomic DNA, and 12 Armyworm genomic DNA). The DNA was amplified by PCR using the universal primer pair LCO1490 / HCO2198, wherein the forward primer was LCO1490 (5'-GGTCAACAAATCATAAAGATATTGG-3') and the rear primer was HCO2198 (5'-TAAACTTCAGGGTGACCAAAAAATCA-3'). The PCR system used was a 25 μL system: 2×Taq PCR MasterMix (KT201, Tiangen Biochemical Technology (Beijing) Co., Ltd.) 12.5 μL, ddH2O 9.5 μL, 1.0 μL of each of the front and rear primers, and 1.0 μL of the genomic DNA template. The amplification conditions were: 95°C pre-denaturation for 3 min, then 94°C denaturation for 30 sec, 50°C annealing for 30 sec, 72°C extension for 1 min as one cycle, 34 cycles were set, 72°C extension for 10 min, and PCR products were stored at 4°C. If the electrophoresis results showed that bright bands could be amplified, it meant that the DNA sample could be used for subsequent sequencing identification.

[0122] The corresponding PCR products with bright bands amplified by electrophoresis results were sent to Beijing Liuhe BGI Biotechnology Co., Ltd. for double-end sequencing. The sequencing results obtained were actually the mtDNA COI sequences of each moth sample. The obtained COI sequences were compared in the core nt database using the BLAST function on the NCBI (https: / / www.ncbi.nlm.nih.gov / ) website. The COI sequences with a similarity of more than 99% and a phylogenetic tree of the first 100 results were made, and the COI sequences were considered to be the same species. The results are shown in Table 1.

[0123] Example 1 Primer pair specificity experiment and kit acquisition for identifying fall armyworm

[0124] 1. Design of primer pairs for identification of Fall Armyworm

[0125] 1. The present invention has designed and synthesized three primers for identification of fall armyworm: Sf-1F, Sf-2F, Sf-3F / Sf-1R, Sf-2R, Sf-3R. The sequences of each primer are shown in Table 2.

[0126] Table 2

[0127] Primer name Nucleotide sequence (5'→3') and its position in the sequence listing Primer Sf1-F CCATCTTTAACTTTATTAATTTCTAGTAGC (sequence 1) Primer Sf1-R GATAATAATAATAAGAATGCGGTAATACCTACAGC (sequence 2) Primer Sf2-F CCCCCATCTTTAACTTTATTAATTTCTAGTAGC Primer Sf2-R TACCTACAGCTCAAATAAATAAAGGTATTTGATC Primer Sf3-F ATCTTTAACTTTATTAATTTCTAGTAGCATTGTAG Primer Sf3-R TACCTACAGCTCAAATAAATAAAGGTATTTGATC

[0128] 2. Validation of primer pairs for identification of Spodoptera frugiperda

[0129] 1. Take one portion of each of the genomic DNA of the moth samples prepared above (No. 1 fall armyworm genomic DNA, No. 2 fall armyworm genomic DNA, No. 3 fall armyworm genomic DNA, No. 4 fall armyworm genomic DNA, No. 5 fall armyworm genomic DNA, No. 6 fall armyworm genomic DNA, No. 7 fall armyworm genomic DNA, No. 8 beet armyworm genomic DNA, No. 9 cotton bollworm genomic DNA, No. 10 Asian corn borer genomic DNA, No. 11 peach borer genomic DNA and No. 12 armyworm genomic DNA).

[0130] 2. Using the genomic DNA of the above moth samples as templates, various primer combinations were used for multi-enzyme constant temperature amplification to obtain MIRA amplification products. The specific method is as follows:

[0131] The three pairs of upstream primers and the three pairs of downstream primers in Table 2 were freely combined and used to amplify the genomic DNA of each moth sample, that is, the experiment was divided into 9 groups: primer Sf1-F / primer Sf1-R group, primer Sf1-F / primer Sf2-R group, primer Sf1-F / primer Sf3-R group, primer Sf2-F / primer Sf1-R group, primer Sf2-F / primer Sf2-R group, primer Sf2-F / primer Sf3-R group, primer Sf3-F / primer Sf1-R group, primer Sf3-F / primer Sf2-R group, primer Sf3-F / primer Sf2-R group.

[0132] Primer Sf1-F / Primer Sf1-R set:

[0133] The reaction system was 50 μL, consisting of 29 μL A1 buffer (product in the kit (Cat. No. WLN8201KIT), a product of Anpu Future Biotechnology Co., Ltd.), 5 μL DNA template (300 ng / μL), 2 μL primer Sf1-F (final concentration 0.40 μM), 2 μL primer Sf1-R (final concentration 0.40 μM), 2.5 μL B buffer and 9.5 μL sterile ultrapure water. The reaction conditions were: 37°C constant temperature for 15 min.

[0134] The above reaction system was used to amplify with the genomic DNA of fall armyworm No. 1, fall armyworm No. 2, fall armyworm No. 3, fall armyworm No. 4, fall armyworm No. 5, fall armyworm No. 6, fall armyworm No. 7, fall armyworm No. 8, beet armyworm No. 9, cotton bollworm No. 10, Asian corn borer No. 11, peach borer No. 12, armyworm No. 12 and sterile ultrapure water as amplification templates.

[0135] Primer Sf1-F / Primer Sf2-R set:

[0136] The only difference from the primer Sf1-F / primer Sf1-R set is that primer Sf1-R is replaced by primer Sf2-R, and the other operations are the same as the primer Sf1-F / primer Sf1-R set.

[0137] Primer Sf1-F / Primer Sf3-R set:

[0138] The only difference from the primer Sf1-F / primer Sf1-R set is that primer Sf1-R is replaced by primer Sf3-R, and the other operations are the same as the primer Sf1-F / primer Sf1-R set.

[0139] Primer Sf2-F / Primer Sf1-R set:

[0140] The only difference from the primer Sf1-F / primer Sf1-R set is that primer Sf1-F is replaced by primer Sf2-F, and the other operations are the same as the primer Sf1-F / primer Sf1-R set.

[0141] Primer Sf2-F / Primer Sf2-R set:

[0142] The difference from the primer Sf1-F / primer Sf1-R set is that the primer Sf1-F is replaced by the primer Sf2-F, and the primer Sf1-R is replaced by the primer Sf2-R. The other operations are the same as the primer Sf1-F / primer Sf1-R set.

[0143] Primer Sf2-F / Primer Sf3-R set:

[0144] The only difference from the primer Sf1-F / primer Sf1-R set is that primer Sf1-F is replaced by primer Sf2-F, and primer Sf1-R is replaced by primer Sf3-R. Other operations are the same as the primer Sf1-F / primer Sf1-R set.

[0145] Primer Sf3-F / Primer Sf1-R set:

[0146] The only difference from the primer Sf1-F / primer Sf1-R set is that primer Sf1-F is replaced by primer Sf3-F, and the other operations are the same as the primer Sf1-F / primer Sf1-R set.

[0147] Primer Sf3-F / Primer Sf2-R set:

[0148] The only difference from the primer Sf1-F / primer Sf1-R set is that primer Sf1-F is replaced by primer Sf3-F, and primer Sf1-R is replaced by primer Sf2-R. Other operations are the same as the primer Sf1-F / primer Sf1-R set.

[0149] Primer Sf3-F / Primer Sf3-R set:

[0150] The only difference from the primer Sf1-F / primer Sf1-R set is that primer Sf1-F is replaced by primer Sf3-F, and primer Sf1-R is replaced by primer Sf3-R. Other operations are the same as the primer Sf1-F / primer Sf1-R set.

[0151] 3. The amplified product in step 2 was subjected to 1% agarose gel electrophoresis and detected under ultraviolet light.

[0152] Test results see Figure 1-9 ( Figure 1 Primer Sf1-F / primer Sf1-R set, Figure 2 Primer Sf1-F / primer Sf2-R set, Figure 3 Primer Sf1-F / primer Sf3-R set, Figure 4 Primer Sf2-F / primer Sf1-R set, Figure 5 Primer Sf2-F / Primer Sf2-R set, Figure 6 Primer Sf2-F / primer Sf3-R set, Figure 7 Primer Sf3-F / primer Sf1-R set, Figure 8 Primer Sf3-F / Primer Sf2-R set and Fig. 9The primer Sf3-F / primer Sf3-R set. Among them, lane M is a DNA marker (marker sizes are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom), lane 1 is the fall armyworm in Fujian (No. 1 fall armyworm), lane 2 is the fall armyworm in Yunnan (No. 2 fall armyworm), lane 3 is the fall armyworm in Hainan (No. 3 fall armyworm), lane 4 is the fall armyworm in Jiangxi (No. 4 fall armyworm), lane 5 is the fall armyworm in Fujian (No. 1 fall armyworm), lane 6 is the fall armyworm in Fujian (No. 1 fall armyworm), lane 7 is the fall armyworm in Fujian (No. 1 fall armyworm), lane 8 is the fall armyworm in Fujian (No. 1 fall armyworm), lane 9 is the fall armyworm in Fujian (No. 1 fall armyworm), lane 10 is the fall armyworm in Fujian (No. 1 fall armyworm), lane 11 is the fall armyworm in Fujian (No. 1 fall armyworm), lane 12 is the fall armyworm in Fujian (No. 1 fall armyworm), lane 13 is the fall armyworm in Fujian (No. 1 fall armyworm), lane 14 is the fall armyworm in Fujian (No. 1 fall armyworm), lane 15 is the fall armyworm in Fujian (No. Lane 6 is the fall armyworm from Guangdong (Spodoptera: No. 5), lane 6 is the fall armyworm from Jiangsu (Spodoptera: No. 6), lane 7 is the fall armyworm (Spodoptera: No. 7), lane 8 is the beet armyworm (Spodoptera: No. 8), lane 9 is the cotton bollworm (Hermaphroditia: No. 9), lane 10 is the Asian corn borer (Ostrinia: No. 10), lane 11 is the peach borer (Cenopoda: No. 11), lane 12 is the armyworm (Sepharose amygdalus: No. 12), and lane N is sterile ultrapure water.

[0153] The results showed that only the primer combination Sf-1F / Sf-1R showed a clear and bright band at 274bp when identifying the fall armyworm, and no band appeared in the negative control. Other primer pairs failed to show high specificity in specific detection. Therefore, the primer pair Sf-1F / R can be used to identify the fall armyworm.

[0154] The results further showed that when the moth to be tested was the fall armyworm, a clear, bright band appeared at around 274 bp; when the moth to be tested was not the fall armyworm, there was no band (i.e., no clear, bright band appeared at around 274 bp); the negative control also had no band.

[0155] 3. Preparation of a kit for identifying fall armyworm

[0156] The kit for identifying Spodoptera frugiperda includes the primer pair Sf-1F / R.

[0157] Example 2 Identification of the detection capability of a kit for identifying fall armyworm

[0158] 1. Identify whether the moth to be tested is or is a candidate for fall armyworm through agarose gel electrophoresis results

[0159] Samples to be tested:

[0160] 1. Take the genomic DNA of the moth samples not used in Example 1 (No. 1 fall armyworm genomic DNA, No. 2 fall armyworm genomic DNA, No. 3 fall armyworm genomic DNA, No. 4 fall armyworm genomic DNA, No. 5 fall armyworm genomic DNA, No. 6 fall armyworm genomic DNA, No. 7 Spodoptera litura genomic DNA, No. 8 beet armyworm genomic DNA, No. 9 cotton bollworm genomic DNA, No. 10 Asian corn borer genomic DNA, No. 11 peach borer genomic DNA and No. 12 armyworm genomic DNA) The genomic DNA of the moths to be tested was taken as the genomic DNA of the moths to be tested, and was numbered in sequence as No. 1 genomic DNA of the moths to be tested, No. 2 genomic DNA of the moths to be tested, No. 3 genomic DNA of the moths to be tested, No. 4 genomic DNA of the moths to be tested, No. 5 genomic DNA of the moths to be tested, No. 6 genomic DNA of the moths to be tested, No. 7 genomic DNA of the moths to be tested, No. 8 genomic DNA of the moths to be tested, No. 9 genomic DNA of the moths to be tested, No. 10 genomic DNA of the moths to be tested, No. 11 genomic DNA of the moths to be tested, and No. 12 genomic DNA of the moths to be tested. Three copies of the genomic DNA of each moth sample were taken.

[0161] 2. Using the genomic DNA of the moth to be tested as a template, use the primer pair Sf-1F / R to perform multi-enzyme isothermal amplification to obtain the MIRA amplification product. The specific method is as follows:

[0162] The experiment was divided into 14 groups: moth group No. 1, moth group No. 2, moth group No. 3, moth group No. 4, moth group No. 5, moth group No. 6, moth group No. 7, moth group No. 8, moth group No. 9, moth group No. 10, moth group No. 11, moth group No. 12, negative control group and positive control group.

[0163] Moth group No. 1:

[0164] The reaction system was 50 μL, consisting of 29 μL A1 buffer (Cat. No. WLB8201KIT, product of Anpu Future Biotechnology Co., Ltd.), 5 μL No. 1 moth genomic DNA to be tested (300 ng / μL), 2 μL primer Sf1-F (final concentration 0.40 μM), 2 μL primer Sf1-R (final concentration 0.40 μM), 2.5 μL B buffer and 9.5 μL sterile ultrapure water. The reaction conditions were: 37°C constant temperature for 15 min.

[0165] Moth group No. 2:

[0166] The only difference from the moth group No. 1 is that the genomic DNA of the moth No. 1 is replaced by the genomic DNA of the moth No. 2, and the other operations are the same as those of the moth group No. 1.

[0167] Moth group No. 3:

[0168] The only difference from the moth group No. 1 is that the genomic DNA of the moth No. 1 is replaced by the genomic DNA of the moth No. 3, and the other operations are the same as those of the moth group No. 1.

[0169] Moth group No. 4:

[0170] The only difference from the moth group No. 1 is that the genomic DNA of the moth No. 1 is replaced by the genomic DNA of the moth No. 4, and the other operations are the same as those of the moth group No. 1.

[0171] Moth group No. 5:

[0172] The only difference from the moth group No. 1 is that the genomic DNA of the moth No. 1 is replaced by the genomic DNA of the moth No. 5, and the other operations are the same as those of the moth group No. 1.

[0173] Moth group No. 6:

[0174] The only difference from the moth group No. 1 is that the genomic DNA of the moth No. 1 is replaced by the genomic DNA of the moth No. 6, and the other operations are the same as those of the moth group No. 1.

[0175] Moth group No. 7:

[0176] The only difference from the moth group No. 1 is that the genomic DNA of the moth No. 1 is replaced by the genomic DNA of the moth No. 7, and the other operations are the same as those of the moth group No. 1.

[0177] Moth group No. 8:

[0178] The only difference from the moth group No. 1 is that the genomic DNA of the moth No. 1 is replaced by the genomic DNA of the moth No. 8, and the other operations are the same as those of the moth group No. 1.

[0179] Moth group No. 9:

[0180] The only difference from the moth group No. 1 is that the genomic DNA of the moth No. 1 is replaced by the genomic DNA of the moth No. 9, and the other operations are the same as those of the moth group No. 1.

[0181] Moth group No. 10:

[0182] The only difference from the moth group No. 1 is that the genomic DNA of the moth No. 1 is replaced by the genomic DNA of the moth No. 10, and the other operations are the same as those of the moth group No. 1.

[0183] Moth group No. 11:

[0184] The only difference from the moth group No. 1 is that the genomic DNA of the moth No. 1 is replaced by the genomic DNA of the moth No. 11, and the other operations are the same as those of the moth group No. 1.

[0185] Moth group No. 12:

[0186] The only difference from the moth group No. 1 is that the genomic DNA of the moth No. 1 is replaced by the genomic DNA of the moth No. 12, and the other operations are the same as those of the moth group No. 1.

[0187] Negative control group:

[0188] The only difference from the moth group No. 1 is that the genomic DNA of the moth group No. 1 is replaced with sterile ultrapure water, and other operations are the same as those of the moth group No. 1.

[0189] Positive control group:

[0190] The only difference from the moth group No. 1 to be tested is that the genomic DNA of the moth group No. 1 to be tested is replaced by the genomic DNA of the fall armyworm No. 1 used in Example 1, and the other operations are the same as those of the moth group No. 1 to be tested.

[0191] 3. The MIRA amplification product was subjected to 1% agarose gel electrophoresis and detected under ultraviolet light.

[0192] 4. Make the following judgments based on the electrophoresis results:

[0193] When the positive control presents a clear, bright band at about 274 bp and the negative control has no band, if the moth to be tested presents a clear, bright band at about 274 bp, the moth to be tested is or is a candidate for fall armyworm; if the moth to be tested does not present a clear, bright band at about 274 bp (such as no band), the moth to be tested is not or is not a candidate for fall armyworm;

[0194] When the positive control does not show a clear, bright band at around 274 bp or the negative control has a band, the identification result of the moth to be tested is invalid.

[0195] 2. Visual identification of fall armyworm

[0196] 1. Using the MIRA amplification product sequence of Spodoptera frugiperda as the target, three probes were designed and synthesized. The probe sequences are detailed in Table 3.

[0197] Table 3

[0198]

[0199]

[0200] 2. Using the genomic DNA of fall armyworm (the genomic DNA of fall armyworm No. 1 used in Example 1) as a template, various probes, primers Sf-1F, and Sf-1R labeled with Biotin at the 5' end (sequence 5'-Biotin-GATAATAATAATAAGAATGCGGTAATACCTACAGC-3') were used for multi-enzyme constant temperature-lateral flow chromatography test strip amplification to obtain MIRA-LFD amplification products. Sf-1R labeled with Biotin at the 5' end (sequence 5'-Biotin-GATAATAATAATAAGAATGCGGTAATACCTACAGC-3'), Biotin is biotin, and its chemical formula is C 10 H 16 N2O3S, its structural formula is as follows:

[0201]

[0202] The carboxyl group of Biotin is covalently linked to the amino group of guanine deoxyribonucleotide.

[0203] The specific operations are as follows:

[0204] The experiment was divided into Sf-Probe1 group, Sf-Probe2 group and Sf-Probe1 group.

[0205] Sf-Probe1 group:

[0206] The reaction system was 50 μL, consisting of 29 μL A2 buffer (product number WLN8203KIT, Anpu Future Biotechnology Co., Ltd.), 5 μL DNA template (final concentration 0.046 μM), 2 μL primer Sf1-F (final concentration 0.40 μM), 2 μL 5'-end Biotin-labeled Sf-1R (final concentration 0.40 μM), 1 μL Sf-Probe1 (final concentration 0.20 μM), 2.5 μL Bbuffer and 8.5 μL sterile ultrapure water, and kept at 37°C for 15 min.

[0207] The above reaction system was used to perform amplification using the No. 1 fall armyworm genomic DNA and sterile ultrapure water as amplification templates.

[0208] Sf-Probe2 Group:

[0209] The only difference from the Sf-Probe1 group is that Sf-Probe1 is replaced by Sf-Probe2, and other operations are the same as the Sf-Probe1 group.

[0210] Sf-Probe3 Group:

[0211] The only difference from the Sf-Probe1 group is that Sf-Probe1 is replaced by Sf-Probe3, and other operations are the same as the Sf-Probe1 group.

[0212] 3. Dilute the amplified product obtained in step 2 10 times, add 100 μL to the sample pad of the lateral flow chromatography test strip (product of Anpu Future Biotechnology Co., Ltd., product number WLFS8201) and detect for 5 minutes. After the reaction, observe the test line of the lateral flow chromatography test strip with the naked eye to see if it is colored (the reaction process and principle are as follows Fig.15 Then make the following judgment:

[0213] When the test line of the lateral flow chromatography test strip of the positive control is red and the test line of the lateral flow chromatography test strip of the negative control is white, if the test line of the lateral flow chromatography test strip of the amplified product of the No. 1 fall armyworm genomic DNA is red, the probe can be used for visual detection of fall armyworm;

[0214] When the test line of the positive control lateral flow chromatography test strip is not red or the test line of the negative control lateral flow chromatography test strip is red, the probe cannot be used for visual detection of fall armyworm.

[0215] Test results see Figure 10-12 ( Fig.10 For the Sf-Probe1 group, Fig.11 For the Sf-Probe2 group, Fig.12 The results show that only Sf-Probe1 can detect fall armyworms in red on the lateral flow chromatography test strip, while the negative control lateral flow chromatography test strip is white. Therefore, Sf-Probe1 can be used for visual detection of fall armyworms.

[0216] 4. Take the genomic DNA of moth samples not used in Example 1 and the above (1 Spodoptera frugiperda genomic DNA, 2 Spodoptera frugiperda genomic DNA, 3 Spodoptera frugiperda genomic DNA, 4 Spodoptera frugiperda genomic DNA, 5 Spodoptera frugiperda genomic DNA, 6 Spodoptera frugiperda genomic DNA, 7 Spodoptera litura genomic DNA, 8 Spodoptera exigua genomic DNA, 9 Helicoverpa armigera genomic DNA, 10 Asian corn borer genomic DNA, 11 Concha oleracea genomic DNA and 12 Armyworm genomic DNA) The genomic DNA of the moths to be tested was taken as the genomic DNA of the moths to be tested, and was numbered in sequence as No. 1 genomic DNA of the moths to be tested, No. 2 genomic DNA of the moths to be tested, No. 3 genomic DNA of the moths to be tested, No. 4 genomic DNA of the moths to be tested, No. 5 genomic DNA of the moths to be tested, No. 6 genomic DNA of the moths to be tested, No. 7 genomic DNA of the moths to be tested, No. 8 genomic DNA of the moths to be tested, No. 9 genomic DNA of the moths to be tested, No. 10 genomic DNA of the moths to be tested, No. 11 genomic DNA of the moths to be tested, and No. 12 genomic DNA of the moths to be tested. Three copies of the genomic DNA of each moth sample were taken.

[0217] 5. Using the genomic DNA of the moth to be tested and sterile ultrapure water as templates, use the probe Sf-Probe1, primer Sf-1F, and Sf-1R labeled with 5'-Biotin (sequence 5'-Biotin-GATAATAATAATAAGAATGCGGTAATACCTACAGC-3') to perform multi-enzyme constant temperature-lateral flow chromatography test strip amplification to obtain the MIRA-LFD amplification product. The specific operation is as follows:

[0218] The reaction system was 50 μL, consisting of 29 μL A2 buffer (product number WLN8203KIT, Anpu Future Biotechnology Co., Ltd.), 5 μL DNA template (final concentration 0.046 μM), 2 μL primer Sf1-F (final concentration 0.40 μM), 2 μL 5'-end Biotin-labeled Sf-1R (final concentration 0.40 μM), 1 μL Sf-Probe1 (final concentration 0.20 μM), 2.5 μL Bbuffer and 8.5 μL sterile ultrapure water, and kept at 37°C for 15 min.

[0219] 6. Dilute the amplification product obtained in step 5 10 times, add 100 μL to the sample pad of the lateral flow chromatography test strip and detect for 5 minutes. After the reaction, observe the test line of the lateral flow chromatography test strip by naked eyes to see if it is colored, and then make the following judgment: when the test line of the lateral flow chromatography test strip of the positive control is red and the test line of the lateral flow chromatography test strip of the negative control is white, if the test line of the lateral flow chromatography test strip of the moth to be tested is red, the moth to be tested is or the candidate is fall armyworm; if the test line of the lateral flow chromatography test strip of the moth to be tested is white, the moth to be tested is not or the candidate is not fall armyworm;

[0220] When the test line of the positive control lateral flow chromatography test strip is not red or the test line of the negative control lateral flow chromatography test strip is red, the identification result of the moth to be tested is invalid.

[0221] According to the above method, whether the moth to be tested is fall armyworm is identified. The moths to be tested are fall armyworm numbered 1-6 in Table 1, Spodoptera litura numbered 7, beet armyworm numbered 8, cotton bollworm numbered 9, Asian corn borer numbered 10, peach borer numbered 11, and armyworm numbered 12, and N is sterile ultrapure water.

[0222] Test results see Fig.13 (Test strip 1 is the moth template No. 1 to be tested, test strip 2 is the moth template No. 2 to be tested, test strip 3 is the moth template No. 3 to be tested, test strip 4 is the moth template No. 4 to be tested, test strip 5 is the moth template No. 5 to be tested, test strip 6 is the moth template No. 6 to be tested, test strip 7 is the moth template No. 7 to be tested, test strip 8 is the moth template No. 8 to be tested, test strip 9 is the moth template No. 9 to be tested, test strip 10 is the moth template No. 10 to be tested, test strip 11 is the moth template No. 11 to be tested, test strip 12 is the moth template No. 12 to be tested, and test strip N is the sterile ultrapure water template). The results showed that the test line of Sf-Probe1 was red only in the lateral flow chromatography test strip of fall armyworm. The test lines of the lateral flow chromatography test strips of non-fall armyworm and negative control were all white.

[0223] Example 3 Sensitivity Experiment

[0224] 1. Take the genomic DNA of Spodoptera frugiperda No. 1 used in the above Example 1.

[0225] 2. The genomic DNA obtained in step 1 was diluted with sterile water to obtain 10.0 ng / μL fall armyworm genomic DNA dilution, 1.0 ng / μL fall armyworm genomic DNA dilution, 1.0×10 -1 ng / μL Spodoptera frugiperda genomic DNA dilution, 1.0×10 -2 ng / μL Spodoptera frugiperda genomic DNA dilution.

[0226] 3. Using the dilution obtained in step 2 as a template, use probe Sf-Probe1, primer Sf-1F, and Sf-1R labeled with 5'-Biotin (sequence 5'-Biotin-GATAATAATAATAAGAATGCGGTAATACCTACAGC-3') to perform multi-enzyme constant temperature-lateral flow chromatography test strip amplification to obtain MIRA-LFD amplification products. The specific method is as follows:

[0227] The experiment was divided into 10.0ng / μL fall armyworm genomic DNA dilution group, 1.0ng / μL fall armyworm genomic DNA dilution group, 1.0×10 -1 ng / μL Spodoptera frugiperda genomic DNA dilution set, 1.0×10 -2 ng / μL Spodoptera frugiperda genomic DNA dilution group and negative control group.

[0228] 10.0ng / μL Spodoptera frugiperda genomic DNA dilution set:

[0229] The reaction system was 50 μL, consisting of 29 μL A2 buffer (product number WLN8203KIT, Anpu Future Biotechnology Co., Ltd.), 5 μL 10.0 ng / μL fall armyworm genomic DNA dilution, 2 μL primer Sf-1F (final concentration 0.40 μM), 2 μL 5' end Biotin labeled Sf-1R (final concentration 0.40 μM, 1 μL Sf-Probe1 (final concentration 0.20 μM), 2.5 μL B buffer and 8.5 μL sterile ultrapure water, and kept at 37°C for 15 min.

[0230] 1.0ng / μL Spodoptera frugiperda genomic DNA dilution set:

[0231] The only difference from the 10.0 ng / μL Spodoptera frugiperda genomic DNA dilution solution group is that the 10.0 ng / μL Spodoptera frugiperda genomic DNA dilution solution is replaced with 1.0 ng / μL Spodoptera frugiperda genomic DNA dilution solution, and other operations are the same as the 10.0 ng / μL Spodoptera frugiperda genomic DNA dilution solution group.

[0232] 1.0×10 -1 ng / μL Fall Armyworm Genomic DNA Dilution Set:

[0233] The only difference between the 10.0 ng / μL Spodoptera frugiperda genomic DNA diluent group and the 10.0 ng / μL Spodoptera frugiperda genomic DNA diluent group is that the 10.0 ng / μL Spodoptera frugiperda genomic DNA diluent group is replaced with 1.0×10 -1 ng / μL Spodoptera frugiperda genomic DNA dilution solution, and other operations were the same as those for the 10.0ng / μL Spodoptera frugiperda genomic DNA dilution solution group.

[0234] 1.0×10 -2 ng / μL Fall Armyworm Genomic DNA Dilution Set:

[0235] The only difference between the 10.0 ng / μL Spodoptera frugiperda genomic DNA diluent group and the 10.0 ng / μL Spodoptera frugiperda genomic DNA diluent group is that the 10.0 ng / μL Spodoptera frugiperda genomic DNA diluent group is replaced with 1.0×10 -2 ng / μL Spodoptera frugiperda genomic DNA dilution solution, and other operations were the same as those for the 10.0ng / μL Spodoptera frugiperda genomic DNA dilution solution group.

[0236] Negative control group:

[0237] The only difference from the 10.0 ng / μL Spodoptera frugiperda genomic DNA dilution solution group is that the template is replaced with sterile ultrapure water, and other operations are the same as the 10.0 ng / μL Spodoptera frugiperda genomic DNA dilution solution group.

[0238] 4. Dilute the MIRA amplification product obtained in step 3 10 times, add 100 μL to the sample pad of the lateral flow chromatography test strip and test for 5 minutes. After the reaction, observe the test line of the lateral flow chromatography test strip with the naked eye to see if it is colored, and then make the following judgment:

[0239] If the test line of the lateral flow chromatography test strip is red, it indicates that the corresponding genome content in the reaction system can be detected. If the test line of the lateral flow chromatography test strip is white, it indicates that the corresponding genome content in the reaction system cannot be detected.

[0240] Test results see Fig.14 ( Fig.14 In the test strip, 1 was a 10.0 ng / μL Spodoptera frugiperda genomic DNA dilution group, 2 was a 1.0 ng / μL Spodoptera frugiperda genomic DNA dilution group, and 3 was a 1.0×10 -1 ng / μL Spodoptera frugiperda genomic DNA dilution set, 4 test strips for 1.0×10 -2 ng / μL fall armyworm genomic DNA dilution group, N test strip as negative control group). The results showed that the sensitivity of primer pair Sf-1F / R for identifying fall armyworm was 1.0ng / μL.

[0241] The results showed that the primer pair Sf-1F / R had a high sensitivity in identifying Spodoptera frugiperda.

[0242] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A primer composition, characterized in that The primer composition includes a primer pair Sf-1F / Sf-1R, and the primer pair Sf-1F / Sf-1R consists of a primer Sf-1F and a primer Sf-1R; The primer Sf-1F is as follows A1) or A2): A1) a single-stranded DNA molecule as shown in Sequence 1 in the sequence listing; A2) a single-stranded DNA molecule having the same function as sequence 1 after one or more nucleotides are substituted and / or deleted and / or added; The primer Sf-1R is as follows B1) or B2): B1) a single-stranded DNA molecule as shown in Sequence 2 in the sequence listing; B2) A single-stranded DNA molecule having the same function as sequence 2, wherein one or several nucleotides in sequence 2 are replaced and / or deleted and / or added.

2. The primer composition according to claim 1, characterized in that The molar ratio of the primer Sf-1F to the primer Sf-1R is 1:

1.

3. Identify or assist in identifying whether a sample to be tested contains biological material of fall armyworm, characterized in that: The biological material includes any of the following: D1) an in vitro nucleic acid amplification reagent containing the primer composition according to claim 1; D2) a kit containing the primer composition according to claim 1 or the in vitro nucleic acid amplification reagent according to D1); D3) A detection instrument comprising the primer composition of claim 1, the in vitro nucleic acid amplification reagent of D1) or the kit of D2).

4. Use of the primer composition according to claim 1 or 2 or the biomaterial according to claim 3 in any of the following; E1) Use for assisting detection or detecting whether a sample to be tested contains fall armyworm and / or for preparing a product for assisting detection or detecting whether a sample to be tested contains fall armyworm; E2) Use for assisting detection or detecting whether a sample to be tested is fall armyworm and / or for preparing a product for assisting detection or detecting whether a sample to be tested is fall armyworm; E3) Use for distinguishing or assisting in distinguishing fall armyworm from other moths and / or for preparing a product for distinguishing or assisting in distinguishing fall armyworm from other moths; E4) Use for identifying or assisting in identifying the fall armyworm and / or for preparing a product for identifying or assisting in identifying the fall armyworm.

5. A kit, characterized in that: The kit contains the primer combination according to claim 1 or 2 and the probe Sf-Probe1; the structure of the probe Sf-Probe1 is SEQ ID No.3-tetrahydrofuran residue-SEQ ID No.4, the first cytosine deoxyribonucleotide of SEQ ID No.3 is labeled with a fluorescent group, and the 3' end of SEQ ID No.4 is blocked and modified; the 5' end of the primer Sf-1R is labeled with biotin.

6. Use of the kit according to claim 5 in any of the following; E1) Use for assisting detection or detecting whether a sample to be tested contains fall armyworm and / or for preparing a product for assisting detection or detecting whether a sample to be tested contains fall armyworm; E2) Use for assisting detection or detecting whether a sample to be tested is fall armyworm and / or for preparing a product for assisting detection or detecting whether a sample to be tested is fall armyworm; E3) Use for distinguishing or assisting in distinguishing fall armyworm from other moths and / or for preparing a product for distinguishing or assisting in distinguishing fall armyworm from other moths; E4) Use for identifying or assisting in identifying the fall armyworm and / or for preparing a product for identifying or assisting in identifying the fall armyworm.

7. The use according to claim 4 or 6, characterized in that: E1) The test sample further contains at least one of Spodoptera litura, Spodoptera exigua, Cotton bollworm, Asian corn borer, Concha sylvestris and armyworm; and / or, The test sample in E2) is Spodoptera litura, Spodoptera exigua, Cotton bollworm, Asian corn borer, Concha sylvestris or armyworm.

8. A method for identifying or assisting in identifying whether a sample to be tested contains fall armyworm, characterized in that: The method comprises method A or method B; Method A is to use the primer composition of claim 1 or the biological material of claim 3 to perform the in vitro nucleic acid amplification on the sample to be tested in any one of claims 4 to 7, and determine whether the sample to be tested contains fall armyworm according to the specific product of the in vitro nucleic acid amplification; Method B is to use the primer composition described in claim 5 and the probe described in claim 5 to perform in vitro nucleic acid amplification on the sample to be tested in any one of claims 4-7, use the amplification product for lateral flow chromatography test paper, and judge whether the fall armyworm is present in the sample to be tested based on the color development result.

9. A method for identifying or assisting in identifying whether a sample to be tested is fall armyworm, characterized in that: The method includes method C or method D; Method C is to use the primer composition of claim 1 or the biological material of claim 3 to perform the in vitro nucleic acid amplification on the sample to be tested in any one of claims 4 to 7, and determine whether the sample to be tested is fall armyworm according to the specific product of the in vitro nucleic acid amplification; Method D is to use the primer composition described in claim 5 and the probe described in claim 5 to perform the in vitro nucleic acid amplification on the sample to be tested in any one of claims 4-7, use the amplification product on lateral flow chromatography test paper, and judge whether the sample to be tested is fall armyworm according to the color development result.

10. The method according to claim 8 or 9, characterized in that The in vitro nucleic acid amplification is multi-enzyme isothermal amplification.

Images