A set of marker genes for identifying the rice grain filling process and their applications

Abstract

The present invention belongs to the field of rice cultivation, and specifically relates to a set of marker genes for identifying the rice grain filling process and their applications. The marker genes screened in the present invention show monotonically increasing or decreasing expression during the rice grain filling period, and can be used as marker genes to accurately reflect the time course of rice grain filling. By detecting the expression levels of these marker genes, the grain filling process of rice can be molecularly identified, which helps to determine the duration of the rice grain filling process.

Description

Technical Field

[0001] The present invention belongs to the field of rice cultivation, and specifically relates to a set of marker genes for identifying the rice grain filling process and their applications. Background Art

[0002] Rice ( Oryza sativa L.) is an important staple food crop and is the main food for more than half of the world's population. Rice grain filling is the most important physiological process during cereal formation and is also a crucial stage determining grain weight, yield, and rice quality. Studying the molecular mechanism of grain filling will lay a foundation for improving grain yield and quality through improved cultivation methods or breeding.

[0003] Grain filling is a complex trait affected by internal and environmental factors, which makes it difficult to explore its underlying genetics, molecular regulation, and the application of these genes in breeding. The grain filling process involves the transport of carbohydrates produced by leaf photosynthesis to the endosperm of the seed. Here, these carbohydrates are converted from sucrose to starch through the action of various enzymes. Rice grain filling is affected by multiple factors. Some factors are involved in the biological pathways directly determining grain filling, including photosynthetic capacity (source), assimilate transport (flow), starch biosynthesis, and cell proliferation (sink). Other factors, such as phytohormone levels, nutrient levels, abiotic stresses, and grain morphology, indirectly affect grain filling through the above four biological processes.

[0004] At least 50 genes involved in rice grain filling have been cloned. These genes are involved in sugar transport, starch biosynthesis, and phytohormone regulation. However, the molecular mechanism of the dynamic network by which the grain filling process is affected by related factors has not been fully studied. With the development of biotechnology, research methods based on omics technologies have provided new opportunities for rice grain filling research. Summary of the Invention

[0005] The present invention provides a set of marker genes for identifying the rice grain filling process and their applications. During the grain filling process, the marker genes show a monotonically increasing or decreasing trend in expression, which can be used for molecular identification of the filling process. The expression level of the marker genes reflects the filling time, thus providing assistance for studying the dynamic process of filling and the relationship between rice yield and quality.

[0006] The technical solution of the present invention is achieved as follows:

[0007] The first aspect of the present invention is to provide a set of marker genes for identifying the rice grain filling process, including the following genes: AGIS_Os05g001120, and / or AGIS_Os12g003890, and / or AGIS_Os03g005010, and / or AGIS_Os01g005400; wherein,

[0008] The nucleotide sequence of the AGIS_Os05g001120 gene is shown as SEQ ID NO:1;

[0009] The nucleotide sequence of the AGIS_Os12g003890 gene is shown as SEQ ID NO:2;

[0010] The nucleotide sequence of the AGIS_Os03g005010 gene is shown as SEQ ID NO:3;

[0011] The nucleotide sequence of the AGIS_Os01g005400 gene is shown as SEQ ID NO:4.

[0012] Furthermore, as the rice grain filling process continues, the expression level of the AGIS_Os05g001120 gene gradually decreases, the expression level of the AGIS_Os12g003890 gene gradually decreases, the expression level of the AGIS_Os03g005010 gene gradually increases, and the expression level of the AGIS_Os01g005400 gene gradually increases.

[0013] The second aspect of the present invention is to provide primer pairs for amplifying the marker gene described in the first aspect of the present invention, including:

[0014] Forward sequence: GAAGAAAATGTGCAAGGAGGGTG and reverse sequence: CACCACTTAAAGCACCTCCAATC;

[0015] Forward sequence: GGAGGCTTGAAGTGCTATGAGAA and reverse sequence: TGAGGATTGTAGATCCTTCCACC;

[0016] Forward sequence: TGGAGTTTCCTGAGATGACCAG and reverse sequence: CCATTTGTGAATGGGGGAGTCTA;

[0017] Forward sequence: GAAGGGCGTAAGAAGGGAGG and reverse sequence: GGCCTCCTTGAGCATCTTGT.

[0018] The third aspect of the present invention is to provide a kit for amplifying the marker gene described in the first aspect of the present invention, which contains the primer pairs described in the second aspect of the present invention.

[0019] The fourth aspect of the present invention is to provide the application of the marker gene described in the first aspect of the present invention, or the primer pair combination described in the second aspect of the present invention, or the kit described in the third aspect of the present invention in marking the rice grain filling process.

[0020] Furthermore, the lower the relative expression level of the AGIS_Os05g001120 gene, the longer the duration of the rice grain filling process; the lower the relative expression level of the AGIS_Os12g003890 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os03g005010 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os01g005400 gene, the longer the duration of the rice grain filling process.

[0021] The fifth aspect of the present invention is to provide a method for marking the rice grain filling process, comprising the following steps:

[0022] During different periods of the rice grain filling process, take grain samples respectively and use the primer pair described in the second aspect of the present invention to amplify cDNA, and detect the expression level of the marker gene described in the first aspect of the present invention; determine the rice grain filling process according to the level of the marker gene expression.

[0023] Furthermore, calculate the relative expression levels of the AGIS_Os05g001120 gene, the AGIS_Os12g003890 gene, the AGIS_Os03g005010 gene and / or the AGIS_Os01g005400 gene with respect to the internal reference, and determine the rice grain filling process according to the magnitude of the relative expression levels.

[0024] Furthermore, relative expression level = expression level of the gene / expression level of the internal reference. Take the AGIS_Os03g007920 gene as the internal reference, and the nucleotide sequence of the AGIS_Os03g007920 gene is as shown in SEQ ID NO:5.

[0025] Furthermore, the lower the relative expression level of the AGIS_Os05g001120 gene, the longer the duration of the rice grain filling process; the lower the relative expression level of the AGIS_Os12g003890 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os03g005010 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os01g005400 gene, the longer the duration of the rice grain filling process.

[0026] Advantages of the present invention:

[0027] Rice grain filling is a key physiological process that affects yield and quality. The marker genes screened in the present invention show monotonic increasing or decreasing expression during rice grain filling and can be used as marker genes to accurately reflect the time course of rice grain filling. By detecting the expression levels of these marker genes, the grain filling process of rice can be molecularly identified, which helps to determine the duration of the rice grain filling process. For example, for samples collected at different grain filling stages of the same material, if the order of sample collection cannot be distinguished, by detecting the changes in the expression levels of these marker genes, calculating the relative expression levels of the marker genes, and comparing the high and low of the gene expression levels, the order of sample collection can be accurately judged, thereby determining the grain filling stage, providing a reliable molecular marker for the research of the grain filling process and breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It shows the change trend of the gene expression level (TPM value) of the selected marker genes for the rice grain filling process in the gene expression transcriptome data at 5, 10, 15, 20, and 25 days after rice flowering.

[0029] Figure 2 It shows the change trend of the qPCR relative expression levels of the selected marker genes for the rice grain filling process at 5, 10, 15, 20, and 25 days after rice flowering. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0030] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the drawings of the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts fall within the scope of protection of the present invention.

[0031] The methods used in the following embodiments are all conventional methods unless otherwise specified.

[0032] 1 Rice materials

[0033] Internationally recognized high-quality rice, Thai jasmine rice (RD15), and high-quality conventional rice in Hainan Province, Haixiu Zhan 9 (HXZ9).

[0034] 2 Planting

[0035] The two varieties were planted in Hainan from August to December 2023.

[0036] 3 Grain transcriptome analysis

[0037] For each of the two varieties, 5 periods (5, 10, 15, 20, 25 days after pollination and maturity) during the grain filling process were selected, and sufficient grain samples were taken for transcriptome (RNA-seq) sequencing.

[0038] The data was quality controlled using fastp (Chen, S., Zhou, Y., Chen, Y., and Gu, J. (2018). Fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34:i884-i890. 10.1093 / bioinformatics / bty560.), and then the sequences were aligned to the Nipponbare T2T genome (Shang, L., He, W., Wang, T., Yang, Y., Xu, Q., Zhao, X., Yang, L., Zhang, H., Li, X., Lv, Y., et al. (2023). A complete assembly of the rice Nipponbare reference genome. Molecular Plant 16:1232-1236. 10.1016 / j.molp.2023.08.003.) using hisat2. FeatureCounts (Liao, Y., Smyth, G.K., and Shi, W. (2014). FeatureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30:923-930. 10.1093 / bioinformatics / btt656.) was used to calculate the counts matrix, and finally the TPM values of gene expression were calculated using the counts matrix.

[0039] Differentially expressed genes at the same time between two seasons in Sanya were analyzed using DESeq2 (Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15:550. 10.1186 / s13059-014-0550-8.). Genes with a differential expression of 1.5-fold and an adjusted p-value less than 0.05 were considered significantly differentially expressed genes.

[0040] The genes with TPM values higher than 1 at all stages were subjected to expression pattern clustering using clust (Abu-Jamous, B., and Kelly, S. (2018). Clust: automatic extraction of optimal co-expressed gene clusters from gene expression data. Genome Biology 19:172. 10.1186 / s13059-018-1536-8.), and the monotonically up-regulated and down-regulated expression modules were selected. Among the selected modules, genes related to the grain filling process were further screened by expression curves and TPM values. This included genes with TPM values greater than 100 at at least 4 time points and a monotonically increasing or decreasing expression trend throughout grain development. An appropriate reference gene for grain development was screened by TPM value, which needed to have relatively stable expression and a TPM value of approximately 500 to ensure that the CT value was close to 20.

[0041] As shown in Table 1 and Figure 1 as indicated, 4 marker genes (1 - 4 in Table 1) and 1 reference gene (5 in Table 1) were finally screened.

[0042] (II) Determination of the grain filling process

[0043] qPCR primers were designed for the transcripts of marker genes 1 - 5 in Table 1 (see Table 1), and cDNA of two varieties, RD15 and HXZ9, at multiple stages was amplified respectively (pre-denaturation at 95°C for 30 s, 95°C for 5 s, 60°C for 15 s, 40 cycles, extension at 72°C for 30 s). The relative expression levels of the 4 marker genes were calculated using the reference gene (AGIS_Os03g007920 gene) as follows:

[0044] Relative expression level = expression level of the gene / expression level of the reference gene

[0045] Table 1 Primer sequences for qPCR quantification

[0046] Number Name Forward sequence Reverse sequence 1 AGIS_Os05g001120 GAAGAAAATGTGCAAGGAGGGTG CACCACTTAAAGCACCTCCAATC 2 AGIS_Os12g003890 GGAGGCTTGAAGTGCTATGAGAA TGAGGATTGTAGATCCTTCCACC 3 AGIS_Os03g005010 TTGGAGTTTCCTGAGATGACCAG CCATTTGTGAATGGGGGAGTCTA 4 AGIS_Os01g005400 GAAGGGCGTAAGAAGGGAGG GGCCTCCTTGAGCATCTTGT 5 AGIS_Os03g007920 GCTCAATGACACAATGGAGAACC GTGTTCTGAGGACTCCCGTTAAT

[0047] The results are as Figure 2 shown.

[0048] During the grain filling process of two rice varieties, RD15 and HXZ9, as the duration of the grain filling process extends, the relative expression level of the AGIS_Os05g001120 gene gradually decreases, and the relative expression level of the AGIS_Os12g003890 gene also gradually decreases. However, the relative expression levels of the AGIS_Os03g005010 gene and the AGIS_Os01g005400 gene gradually increase. Therefore, the duration of the rice grain filling process can be determined by detecting the expression levels of the above four genes.

[0049] Since the genes AGIS_Os05g001120, AGIS_Os12g003890, AGIS_Os03g005010, and AGIS_Os01g005400 are monotonically increasing or decreasing during the grain filling process, if the sampling order before and after cannot be determined for grain samples of the same rice variety at different grain filling stages, the expression level of at least one of the genes AGIS_Os05g001120, AGIS_Os12g003890, AGIS_Os03g005010, or AGIS_Os01g005400, as well as the expression level of the internal reference AGIS_Os03g007920, can be detected. Then, the relative gene expression level can be calculated, and by comparing the relative expression levels of each marker gene in different samples, the sampling order before and after of each grain sample can be finally determined.

[0050] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of a primer pair for amplifying marker genes or a kit containing the primer pair in marking the grain filling process of rice, wherein the marker genes include the following genes: AGIS_Os05g001120, AGIS_Os12g003890, AGIS_Os03g005010 and AGIS_Os01g005400; wherein, The nucleotide sequence of the AGIS_Os05g001120 gene is shown in SEQ ID NO: 1; The nucleotide sequence of the AGIS_Os12g003890 gene is shown in SEQ ID NO: 2; The nucleotide sequence of the AGIS_Os03g005010 gene is shown in SEQ ID NO: 3; The nucleotide sequence of the AGIS_Os01g005400 gene is shown in SEQ ID NO:4; The primer pair comprises: Forward sequence: GAAGAAAATGTGCAAGGAGGGTG and reverse sequence: CACCACTTAAAGCACCTCCAATC; Forward sequence: GGAGGCTTGAAGTGCTATGAGAA and reverse sequence: TGAGGATTGTAGATCCTTCCACC; Forward sequence: TGGAGTTTCCTGAGATGACCAG and reverse sequence: CCATTTGTGAATGGGGGAGTCTA; Forward sequence: GAAGGGCGTAAGAAGGGAGG and reverse sequence: GGCCTCCTTGAGCATCTTGT; The primer pair is used to quantitatively detect the expression levels of marker genes AGIS_Os05g001120, AGIS_Os12g003890, AGIS_Os03g005010 and AGIS_Os01g005400; the AGIS_Os03g007920 gene is used as an internal reference, and the nucleotide sequence of the AGIS_Os03g007920 gene is shown in SEQ ID NO:

5.

2. The use according to claim 1, characterized in that The lower the relative expression level of the AGIS_Os05g001120 gene, the longer the duration of the rice grain filling process; the lower the relative expression level of the AGIS_Os12g003890 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os03g005010 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os01g005400 gene, the longer the duration of the rice grain filling process.

3. A method for marking the progress of rice grain filling, characterized in that: The following steps are involved: At different stages of rice grain filling, grain samples were taken and cDNA was amplified using primer pairs to detect the expression of marker genes; The rice grain filling process is determined based on the expression level of the marker gene; The marker genes include the following genes: AGIS_Os05g001120, AGIS_Os12g003890, AGIS_Os03g005010 and AGIS_Os01g005400; wherein, The nucleotide sequence of the AGIS_Os05g001120 gene is shown in SEQ ID NO: 1; The nucleotide sequence of the AGIS_Os12g003890 gene is shown in SEQ ID NO: 2; The nucleotide sequence of the AGIS_Os03g005010 gene is shown in SEQ ID NO: 3; The nucleotide sequence of the AGIS_Os01g005400 gene is shown in SEQ ID NO:4; The primer pair comprises: Forward sequence: GAAGAAAATGTGCAAGGAGGGTG and reverse sequence: CACCACTTAAAGCACCTCCAATC; Forward sequence: GGAGGCTTGAAGTGCTATGAGAA and reverse sequence: TGAGGATTGTAGATCCTTCCACC; Forward sequence: TGGAGTTTCCTGAGATGACCAG and reverse sequence: CCATTTGTGAATGGGGGAGTCTA; Forward sequence: GAAGGGCGTAAGAAGGGAGG and reverse sequence: GGCCTCCTTGAGCATCTTGT; The AGIS_Os03g007920 gene was used as an internal reference, and the nucleotide sequence of the AGIS_Os03g007920 gene was shown in SEQ ID NO:

5.

4. The method according to claim 3, characterized in that The relative expression levels of AGIS_Os05g001120, AGIS_Os12g003890, AGIS_Os03g005010 and AGIS_Os01g005400 genes and the internal reference were calculated, and the rice grain filling process was determined according to the relative expression levels.

5. The method according to claim 4, characterized in that The lower the relative expression level of the AGIS_Os05g001120 gene, the longer the duration of the rice grain filling process; the lower the relative expression level of the AGIS_Os12g003890 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os03g005010 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os01g005400 gene, the longer the duration of the rice grain filling process.

Images