An enrofloxacin aptamer sensor based on screen-printed electrode and rapid detection method

By using a screen-printed electrode and aptamer sensor method, Fe/Co two-dimensional MOF nanosheets are combined with enrofloxacin aptamers, solving the problems of expensive equipment and complicated operation in the existing technology for detecting enrofloxacin residues in aquatic products, and achieving rapid, simple and highly sensitive detection results.

CN119619253BActive Publication Date: 2026-02-06WUHAN ACADEMY OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510058693.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-15
Publication Date
2026-02-06
Estimated Expiration
2045-01-15

AI Technical Summary

Technical Problem

Existing technologies for detecting enrofloxacin residues in aquatic products suffer from problems such as expensive equipment, complex operation, high cost, and difficulty in achieving rapid screening. Furthermore, existing methods cannot meet the needs of grassroots units for simple and highly sensitive detection.

Method used

A method based on screen-printed electrodes and aptamer sensors was adopted, which utilizes Fe/Co two-dimensional MOF nanosheets to combine with enrofloxacin aptamers. Catalytic active sites are released through target induction, and differential pulse voltammetry is used to achieve rapid, simple and highly sensitive detection of enrofloxacin.

Benefits of technology

It enables on-site, rapid, and highly sensitive detection of enrofloxacin in aquatic products. It is simple to operate, low in cost, and requires no large instruments or professional personnel, making it suitable for grassroots use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119619253B_ABST
    Figure CN119619253B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of electrochemical detection, and particularly relates to an enrofloxacin aptamer sensor based on a screen-printed electrode and a rapid detection method. The present application first prepares Fe / Co two-dimensional MOF nanosheets with a sheet structure by a room temperature stirring method, then incubates the nanosheets with enrofloxacin aptamer to prepare nanosheet / aptamer probes, further incubates the probes with enrofloxacin, and mixes with acetic acid-sodium acetate buffer, o-phenylenediamine and H2O2 to form a catalytic reaction system. In combination with a screen-printed electrode-differential pulse voltammetry method, the enrofloxacin concentration of a sample to be tested is quickly tested by drawing a quantitative analysis standard working curve, so that rapid, simple and high-sensitivity detection of enrofloxacin is realized. The present application is simple and rapid to operate, does not require expensive reagents, large instruments and professional operators, has high sensitivity, and can realize on-site, rapid, high-sensitivity and quantitative detection of enrofloxacin in fish and shrimp and other aquatic products at the grassroots level in combination with a portable electrochemical detector.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of electrochemical detection, and particularly relates to an aptamer sensor for enrofloxacin based on a screen-printed electrode and a rapid detection method. BACKGROUND

[0002] Enrofloxacin (ENR) is an artificial chemical synthetic quinolone antibacterial drug. Because it has good bactericidal effect on a variety of gram-negative bacteria, and is low in price, it has become one of the commonly used antibiotics in aquaculture. However, due to the fact that uncontrolled and unreasonable use of drugs occurs from time to time, the problem of enrofloxacin drug residues in aquatic products has become increasingly prominent in recent years. These contaminated aquatic products enter the human body through the food chain, which can cause human poisoning, allergy, and even serious consequences such as carcinogenesis, teratogenesis, and mutagenesis, thereby causing great threat to human health and environmental health. In view of this, governments of various countries attach great importance to enrofloxacin residues and have formulated strict limit standards. The European Commission stipulates that the maximum residue limit of ENR and its active metabolite ciprofloxacin in animal muscle tissue is 100 ppb, and the United States has banned its use in aquaculture. At present, the detection methods of quinolone drug residues mainly include instrument analysis methods such as high performance liquid chromatography-mass spectrometry and turbulent chromatography-mass spectrometry, and immunological analysis methods such as fluorescence and colorimetry. Although these methods can meet the requirements of sensitivity and specificity detection, there are certain limitations in practical application. For example, chromatography can be used for qualitative and quantitative detection, and the detection results are relatively accurate, reliable, high in sensitivity and good in reproducibility. However, the instrument used is expensive, the operation is complex, professional technical personnel are needed, and it cannot be used for rapid screening of a large number of samples. The immunological analysis method has the advantages of high throughput, high sensitivity, and high selectivity, but the molecular weight of enrofloxacin is small, and there are many structural analogues. Therefore, it is difficult to prepare antibodies, the cost is high, the cycle is long, and the application is limited. Therefore, it is urgent to develop a new type of simple, low-cost, high-sensitivity, and suitable for primary use of enrofloxacin drug residue rapid detection technology.

[0003] Nanoprotease has similar activity to natural enzyme, and has higher stability, more flexible structure and composition design, and adjustable catalytic activity compared with natural enzyme. In recent years, it has attracted the keen attention of researchers. Among them, two-dimensional metal organic framework (MOF) nanosheet has a huge surface area and an ultrathin lateral size, which can effectively improve the adsorption amount of substrate molecules in the color reaction system, shorten the diffusion distance, and accelerate the catalytic response to substrate molecules. It is a very ideal nanoprotease material. At the same time, the nanoprotease has a sheet-like structure similar to graphene, which can effectively load single-stranded DNA, aptamer and the like through hydrogen bonding, π-π interaction, electrostatic interaction and the like, so as to give more possibilities for analysis and sensing. In addition, based on the electrochemical detection of the screen-printed electrode, the operation is simple, the technical threshold is low, and the sensitivity is high. If it can be combined with the above aptamer probe, it is expected to well meet the needs of the existing grassroots for rapid screening of enrofloxacin. SUMMARY

[0004] In order to overcome the shortcomings of the prior art, the present application provides a method for rapid detection of enrofloxacin based on a screen-printed electrode and an aptamer sensor. The method is based on the blocking effect of enrofloxacin aptamer on the active sites of Fe / Co two-dimensional MOF nanosheet. The target induces the aptamer to fall off from the surface of the nanosheet, releases the catalytic active sites of the nanosheet, and then makes the color reaction more sufficient. Finally, combined with the screen-printed electrode-differential pulse voltammetry, the on-site, rapid, simple and high-sensitivity detection of enrofloxacin is realized.

[0005] In order to achieve the above purpose, the technical scheme adopted by the present application is:

[0006] The present application provides a method for rapid detection of enrofloxacin based on a screen-printed electrode and an aptamer sensor. The method comprises the following steps:

[0007] S1, first dissolve cobalt salt and iron salt in N,N-dimethylformamide solvent, then add terephthalic acid, fully dissolve, and then add water, ethanol and triethylamine under room temperature stirring conditions, continue to stir for 6-24h, and finally obtain Fe / Co two-dimensional MOF nanosheet after washing and resuspension;

[0008] S2, mix the Fe / Co two-dimensional MOF nanosheet obtained in step S1 with enrofloxacin aptamer, incubate to obtain two-dimensional MOF nanosheet / aptamer probe;

[0009] S3, mix the two-dimensional MOF nanosheet / aptamer probe obtained in step S2 with enrofloxacin standard solution of different concentrations, incubate to obtain two-dimensional MOF nanosheet / aptamer / enrofloxacin complex solution;

[0010] S4, the two-dimensional MOF nanosheet / adapter / enrofloxacin complex solution obtained in S3 is mixed with acetic acid-sodium acetate buffer solution, o-phenylenediamine solution and H2O2 to prepare a catalytic reaction system, after reaction, a screen-printed electrode is used as a base electrode, a differential pulse voltammetry method is used to test the current signal of the o-phenylenediamine oxidation product at-0.54V in the catalytic reaction system, and a standard working curve for quantitative analysis is drawn with the logarithm of the enrofloxacin concentration as the abscissa and the current change value at-0.54V as the ordinate;

[0011] S5, a sample containing enrofloxacin is incubated with the two-dimensional MOF nanosheet / adapter probe obtained in S2 to prepare a two-dimensional MOF nanosheet / adapter / enrofloxacin complex solution, and then a catalytic reaction system is further prepared, after reaction, the current signal change value thereof at-0.54V is detected, and the concentration of enrofloxacin in the sample to be tested is calculated according to the standard working curve for quantitative analysis drawn in S3.

[0012] The application first prepares Fe / Co bimetallic two-dimensional MOF nanosheets with excellent peroxidase activity by a room temperature stirring method, and then modifies enrofloxacin adapters on the surface of the nanosheets through hydrogen bonds, π-π interactions and electrostatic interactions, so as to close the catalytic active sites of the nanosheets; then the nanosheets are co-incubated with a solution containing enrofloxacin with different concentrations, because the interaction between enrofloxacin and the adapter will cause the adapter to fall off from the surface of the nanosheet, thereby releasing the catalytic active sites of the nanosheet and restoring the catalytic activity thereof; then the above solution is mixed with acetic acid-sodium acetate buffer solution, o-phenylenediamine solution and H2O2 to react, a screen-printed electrode is used as a three-electrode system, and a differential pulse voltammetry method is used to test the current signal of the o-phenylenediamine oxidation product in the above process; finally, the concentration of enrofloxacin in aquatic products is quickly tested by drawing a standard working curve for quantitative analysis. The method for quickly detecting enrofloxacin based on a screen-printed electrode is simple and fast, does not require expensive reagents, large instruments and professional operators, has high sensitivity, and can realize on-site, rapid, high-sensitivity and quantitative detection of enrofloxacin in fish and shrimp and other aquatic products at the grassroots level in combination with a portable electrochemical detector.

[0013] Preferably, in S1, the cobalt salt includes cobalt chloride, cobalt oxalate, cobalt carbonate, cobalt sulfate, cobalt nitrate and cobalt acetate; and the iron salt includes ferric chloride, ferric sulfate, ferric chloride and ferric nitrate.

[0014] Preferably, in S1, the use amount ratio of the cobalt salt, the iron salt, N,N-dimethylformamide, terephthalic acid and triethylamine is 20mg-1.5g:10mg-0.35g:10-50mL:0.25-0.65g:2-10mL; and the volume ratio of the water, ethanol and triethylamine is 5:5:0.5-6.

[0015] Preferably, in S1, the solution used for washing is acetone and ethanol, the solvent used for resuspension is water, and the concentration of the obtained Fe / Co two-dimensional MOF nanosheet after resuspension is 0.4-2 mg / mL.

[0016] Preferably, in S2, the enrofloxacin aptamer has a nucleotide sequence as shown in SEQ ID No: 1.

[0017] Preferably, in S2, the concentration of the Fe / Co two-dimensional MOF nanosheet used is 0.05-1 mg / mL, the concentration of the enrofloxacin aptamer used is 5-50 µM, the volume ratio of the Fe / Co two-dimensional MOF nanosheet to the enrofloxacin aptamer is 5-20:1-5; and the incubation is room temperature oscillation incubation, and the incubation time is 5-60 min.

[0018] Preferably, in S3, the concentration of the enrofloxacin standard solution is 0.1, 1, 10, 100, 1000, 10000, 100000, 1000000 ppb, respectively, the volume ratio of the two-dimensional MOF nanosheet / aptamer probe to the enrofloxacin standard solution is 4-8:1-4; and the incubation is room temperature oscillation incubation, and the incubation time is 5-60 min.

[0019] Preferably, in the catalytic reaction system of S4, the concentration of the acetic acid-sodium acetate buffer is 0.05-0.2 M, the pH is 2-5, the concentration of the o-phenylenediamine solution is 10-300 mM, and the concentration of H2O2 is 0.5-2 M; and the volume ratio of the two-dimensional MOF nanosheet / aptamer / enrofloxacin complex solution, the acetic acid-sodium acetate buffer, the o-phenylenediamine solution, and H2O2 is 5-20:985-940:5-20:5-20.

[0020] Preferably, in S4, the reaction time of the catalytic reaction system is 2-10 min, the potential range of the differential pulse voltammetry scanning is 0 to -0.85 V, each concentration is tested for 3-5 times, and the average value is taken.

[0021] Compared with the prior art, the present application has the following beneficial effects:

[0022] The application discloses a method for rapidly detecting enrofloxacin based on a screen printing electrode and an aptamer sensor, and first, Fe / Co two-dimensional MOF nanosheet materials with a sheet structure are prepared by using a room temperature stirring method, and then the Fe / Co two-dimensional MOF nanosheet materials are incubated with enrofloxacin aptamers to prepare nanosheet / aptamer probes; after further incubation with enrofloxacin, the nanosheet / aptamer probes are mixed with acetic acid-sodium acetate buffer, o-phenylenediamine (OPD) and H2O2 to form a catalytic reaction system, and then a screen printing electrode-differential pulse voltammetry method is combined to rapidly test the enrofloxacin concentration of a sample to be tested by using a method for drawing a quantitative analysis standard working curve, so that rapid, simple and high-sensitivity detection of enrofloxacin is realized. The Fe / Co two-dimensional bimetallic MOF nanosheet provided by the application has simple synthesis process, mild conditions, can be synthesized in batches (up to g level), has good stability and high catalytic activity, and ensures the sensitivity of the reaction and the stability of the detection; meanwhile, the aptamer used in the application does not need to be labeled with a functional group, has low cost and simple modification process; in addition, the catalytic reaction in the application is carried out in a solution phase, does not need to be modified on the surface of a screen printing electrode, and has simple operation and good repeatability; finally, the method does not need to rely on large instruments and professional operators in the use process, and the screen printing electrode is easy to operate, disposable, and has low technical threshold.

[0023] Therefore, the enrofloxacin aptamer sensor and the rapid detection method based on the screen printing electrode can be used for on-site, rapid and high-sensitivity detection of the enrofloxacin content in fish and shrimp and other aquatic products at a grassroots level. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 TEM (A) and SEM (B) characterization diagrams of the Fe / Co two-dimensional MOF nanosheet;

[0025] Figure 2 XRD characterization diagram of the Fe / Co two-dimensional MOF nanosheet;

[0026] Figure 3 SEM characterization diagram of the Fe / Co two-dimensional MOF nanosheet prepared in batches;

[0027] Figure 4 Characterization diagram of peroxidase activity of the Fe / Co two-dimensional MOF nanosheet;

[0028] Figure 5 Fluorescence characterization diagram for verifying that the enrofloxacin aptamer can be modified to the surface of the Fe / Co two-dimensional MOF nanosheet;

[0029] Figure 6 Sensitivity experiment diagram (A) and a standard working curve (B) for detecting enrofloxacin;

[0030] Figure 7 Selectivity experiment diagram for detecting enrofloxacin. Detailed Implementation

[0031] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0032] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0033] Example 1: Establishment of a method for rapid detection of enrofloxacin based on screen-printed electrodes and aptamer sensors

[0034] 1. Preparation of Fe / Co two-dimensional MOF nanosheets

[0035] First, 0.11 g Co(NO3)2 and 0.045 g FeCl3 were dispersed in 50 mL of N,N-dimethylformamide solvent. Then, 250 mg terephthalic acid was added and dissolved completely. Under stirring at room temperature, 10 mL of water, 10 mL of anhydrous ethanol, and 4 mL of triethylamine were added sequentially, and stirring was continued overnight. Finally, the product was washed three times by centrifugation (5000 rpm, 10 min) with acetone and anhydrous ethanol, and then the product was resuspended in 50 mL of deionized water to a concentration of 0.6 mg / mL and stored at 4 °C for later use.

[0036] The synthesized Fe / Co two-dimensional MOF nanosheets were subjected to TEM and SEM tests, such as... Figure 1 As shown, the obtained MOF material has a layered structure with wrinkles in some areas. Further XRD characterization ( Figure 2 This indicates that the material exhibits typical crystal diffraction peaks, making it a typical crystalline material.

[0037] 2. Mass production of Fe / Co two-dimensional MOF nanosheets

[0038] First, 1.31 g Co(NO3)2 and 0.305 g FeCl3 were dispersed in 50 mL of N,N-dimethylformamide solvent. Then, 625 mg terephthalic acid was added and dissolved completely. Next, 10 mL of water, 10 mL of anhydrous ethanol, and 5 mL of triethylamine were added sequentially under stirring at room temperature, and stirring continued overnight. Finally, the product was washed three times sequentially by centrifugation (5000 rpm, 10 min) with acetone and anhydrous ethanol, and then vacuum-dried overnight at 45 °C. The yield was approximately 0.5 g. Further SEM characterization was performed (…). Figure 3) indicates that the material is still a sheet structure at this time.

[0039] 3. Characterization of Peroxidase Mimic Activity of Fe / Co Two-dimensional MOF Nanosheets

[0040] First, 170 μΐ of acetic acid-sodium acetate buffer (pH = 4), 10 μΐ of Fe / Co two-dimensional MOF nanosheets (0.6 mg / mL), 10 μΐ of TMB solution (10 mM), and 10 μΐ of H2O2 solution (0.1 M) were mixed at room temperature to form a catalytic reaction system. After 5 min of reaction, the change in absorbance value of the TMB oxidation product at 652 nm was tested by means of a UV-visible absorption spectrophotometer. As shown in Figure 4 A, the absorbance of the system at 652 nm is the largest only when the nanosheets, TMB, and H2O2 coexist, indicating that the nanosheets have peroxidase mimic activity. In addition, the catalysis of the nanosheets on two other common substrates, o-phenylenediamine (OPD) and 2-azino-di(3-ethyl-benzothiazoline-6-sulfonic acid) diammonium salt (ABTS), was also explored. As shown in Figure 4 B, OPD and ABTS were also efficiently catalyzed and oxidized when the nanosheets and H2O2 were present, showing the corresponding characteristic absorption peaks, again verifying the peroxidase mimic activity of the nanosheets.

[0041] 4. Electrochemical Detection of Enrofloxacin

[0042] (1) Preparation of Two-dimensional MOF Nanosheet / Aptamer Probe

[0043] To 1 mL of two-dimensional MOF nanosheet solution (diluted 2 times), 50 μΐ of enrofloxacin aptamer (1 μΜ) was added, and the mixture was gently shaken at room temperature for 15 min. The sequence of the enrofloxacin aptamer was 5'-CCCATCAGGGGCTAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGGTTATTTCA GGGGGA-3' (SEQ ID No: 1).

[0044] To verify whether the aptamer can be modified to the surface of the two-dimensional MOF nanosheet material in this process, the following fluorescence experiment was carried out: the enrofloxacin aptamer labeled with fluorescein (FAM) was used to replace the unlabeled aptamer, and the mixture was incubated with the two-dimensional MOF nanosheets at room temperature for 15 min, and then the mixture was subjected to fluorescence testing. From Figure 5 It can be seen that, under 520 nm light excitation, the incubated mixture showed an emission peak at 525 nm similar to that of the FAM-labeled aptamer, indicating that the aptamer had been successfully modified to the surface of the nanosheets.

[0045] (2) Interaction of Two-dimensional MOF Nanosheet / Aptamer Probe with Enrofloxacin

[0046] The 60 μL two-dimensional MOF nanosheet / adapter probe was gently shaken with 15 μL enrofloxacin standard solution of different concentrations (0, 10, 100, 1000, 10000, 100000 ppb) at room temperature for 30 min, and the obtained complex served as nanomaterial for subsequent catalytic reaction.

[0047] (3) Electrochemical test

[0048] 10 μL of the solution obtained in step (2), 10 μL of o-phenylenediamine (OPD, 200 mM) and 10 μL of H2O2 (1 M) were sequentially added into an electrochemical analysis cell containing 970 μL of acetic acid-sodium acetate buffer (0.2 M, pH 4.0), mixed and reacted at room temperature for 5 min, and then inserted into a commercial screen-printed electrode (Changsha Sanjun Electronics Technology Co., Ltd., carbon D-SPE301 type; wherein the working electrode and the counter electrode are carbon electrodes, and the reference electrode is a silver / silver chloride electrode), and the electrochemical workstation was connected. Differential pulse voltammetry was used for detection, and the potential scanning range was 0 to -0.85 V, and each sample was tested for 3-5 times. The results are shown in Figure 6 As shown in A, when there is no enrofloxacin in the system, the two-dimensional MOF nanosheet catalyzes the oxidation of OPD, and there is an obvious reduction peak at -0.54 V; when different concentrations of enrofloxacin standard solution are added, part of the catalytic active sites are released due to the action of enrofloxacin and the adapter loaded on the surface of the nanosheet, and the peak current of the OPD oxidation product in the catalytic reaction system gradually increases with the increase of the concentration of enrofloxacin, indicating that this scheme can be used for electrochemical detection of enrofloxacin.

[0049] Finally, the logarithmic value of the concentration of enrofloxacin was taken as the abscissa (x), and the change value of the peak current at -0.54 V was taken as the ordinate (y), and the standard working curve shown in B was obtained. The curve equation is y=0.1285x+0.2576, R Figure 6 =0.982. The linear range for detecting enrofloxacin is 0.1 ppb-1 ppm, and the detection limit is 0.052 ppb. 2

[0050] (4) Selectivity experiment

[0051] Five common interferents were selected to carry out the following selectivity experiment: the final concentrations of streptomycin, tetracycline, kanamycin and gentamicin were 1 ppm, and the final concentrations of ciprofloxacin and enrofloxacin were 100 ppb. From Figure 7 It can be known that only when enrofloxacin exists, the catalytic system has an obvious current change. It can be inferred that the method constructed in the present application has specific selectivity for enrofloxacin, and has good feasibility in actual sample detection.

[0052] ​Example 2: Application of the method for rapid detection of enrofloxacin based on screen-printed electrode and aptamer sensor

[0053] Carassius auratus and Palaemonetes samples were purchased from a local supermarket and stored at 4℃ for standby. The samples were pretreated as follows: 4.0 g of each sample was accurately weighed into a 50 mL beaker, 20 mL of acetonitrile containing 50% hydrochloric acid was added to mix evenly, and homogenized at medium speed for 5 min. The supernatant was filtered through a 0.45 μm organic filter membrane, and the obtained filtrate was used as the matrix solution. The final concentration of the simulated sample solution was 50, 200 and 800 ppb by adding enrofloxacin standard solution. The detection of enrofloxacin was carried out according to the method of Example 1. The peak current change value of the OPD oxidation product at -0.54 V before and after the sample was added was measured, and the concentration and recovery rate of enrofloxacin in the simulated sample were calculated according to the working curve obtained in Example 1. The specific test results are shown in Table 1.

[0054] As can be seen from Table 1, the recovery rates of the three groups of Carassius auratus and the three groups of Palaemonetes simulated samples are between 80% and 95%, and the RSDs are less than 5%. The results show that the method has good accuracy and good effect in actual sample detection.

[0055] Table 1 Test results of enrofloxacin simulated samples

[0056]

[0057] As can be seen from the above, by the blocking effect of the enrofloxacin aptamer on the active sites of the Fe / Co two-dimensional MOF nanosheet, the aptamer is induced to fall off from the surface of the nanosheet to restore the active sites of the nanosheet, and the excellent peroxidase activity of the nanosheet is combined with the simplicity and sensitivity of the screen-printed electrode-differential pulse voltammetry, thereby constructing a simple, rapid, economical and highly sensitive enrofloxacin electrochemical detection scheme, which provides strong scientific and technological support for the on-site and rapid detection of enrofloxacin in the vast number of primary aquatic products.

[0058] The embodiments of the present application are described in detail above, but the present application is not limited to the described embodiments. For those skilled in the art, various changes, modifications, replacements and variations of the embodiments can be made without departing from the principles and spirits of the present application, and still fall within the protection scope of the present application.

Claims

1. A method for rapid detection of enrofloxacin based on screen-printed electrode and aptamer sensor, characterized in that, The method comprises the following steps: S1, first dissolve the cobalt salt and iron salt in N,N-dimethylformamide solvent, then add terephthalic acid, fully dissolve, then add water, ethanol and triethylamine in sequence under stirring at room temperature, continue stirring for 6-24 hours, finally obtain Fe / Co two-dimensional MOF nanosheet after washing and resuspension; S2, mix the Fe / Co two-dimensional MOF nanosheet obtained in step S1 with enrofloxacin aptamer, incubate to obtain two-dimensional MOF nanosheet / aptamer probe; S3, mix the two-dimensional MOF nanosheet / aptamer probe obtained in step S2 with enrofloxacin standard solution of different concentrations, incubate to obtain two-dimensional MOF nanosheet / aptamer / enrofloxacin complex solution; S4, mix the two-dimensional MOF nanosheet / aptamer / enrofloxacin complex solution obtained in S3 with acetic acid-sodium acetate buffer, o-phenylenediamine solution and H2O2 to prepare a catalytic reaction system, after reaction, use a screen-printed electrode as a base electrode, test the current signal of o-phenylenediamine oxidation product at-0.54V in the catalytic reaction system by differential pulse voltammetry, and draw a quantitative analysis standard working curve with the logarithm of enrofloxacin concentration as the abscissa and the-0.54V current change value as the ordinate; S5, incubate the sample containing enrofloxacin with the two-dimensional MOF nanosheet / aptamer probe obtained in step S2 to prepare a two-dimensional MOF nanosheet / aptamer / enrofloxacin complex solution, further prepare a catalytic reaction system, after reaction, detect the current signal change value at-0.54V, and calculate the concentration of enrofloxacin in the sample according to the quantitative analysis standard working curve drawn in step S3.

2. The method for rapid detection of enrofloxacin based on screen-printed electrode and aptasensor according to claim 1, characterized in that, In S1, the cobalt salt includes cobalt chloride, cobalt oxalate, cobalt carbonate, cobalt sulfate, cobalt nitrate and cobalt acetate; the iron salt includes ferric chloride, ferric sulfate, ferric chloride and ferric nitrate.

3. The method for rapid detection of enrofloxacin based on screen-printed electrode and aptasensor according to claim 1, characterized in that, In S1, the amount ratio of the cobalt salt, iron salt, N,N-dimethylformamide, terephthalic acid and triethylamine is 20mg-1.5g:10mg-0.35g:10-50mL:0.25-0.65g:2-10mL; the volume ratio of the water, ethanol and triethylamine is 5:5:0.5-6.

4. The method for rapid detection of enrofloxacin based on screen-printed electrode and aptasensor according to claim 1, characterized in that, In S1, the solution used for washing is acetone and ethanol, and the solvent used for resuspension is water; the concentration of the obtained Fe / Co two-dimensional MOF nanosheet after resuspension is 0.4-2mg / mL.

5. The method for rapid detection of enrofloxacin based on screen-printed electrode and aptasensor according to claim 1, characterized in that, In S2, the enrofloxacin aptamer has a nucleotide sequence as shown in SEQ ID No:

1.

6. The method for rapid detection of enrofloxacin based on screen-printed electrode and aptasensor according to claim 1, characterized in that, In S2, the use concentration of the Fe / Co two-dimensional MOF nanosheet is 0.05-1mg / mL, the use concentration of the enrofloxacin aptamer is 5-50μM, the volume ratio of the Fe / Co two-dimensional MOF nanosheet to the enrofloxacin aptamer is 5-20:1-5; the incubation is room temperature oscillation incubation, and the incubation time is 5-60min.

7. The method for rapid detection of enrofloxacin based on screen-printed electrode and aptasensor according to claim 1, characterized in that, In S3, the concentration of enrofloxacin standard solution is 0.1, 1, 10, 100, 1000, 10000, 100000, 1000000 ppb, respectively, and the volume ratio of the two-dimensional MOF nanosheet / adapter probe to the enrofloxacin standard solution is 4-8:1-4; the incubation is room temperature oscillation incubation, and the incubation time is 5-60 min.

8. The method for rapid detection of enrofloxacin based on screen-printed electrode and aptasensor according to claim 1, characterized in that, In the catalytic reaction system of S4, the concentration of acetic acid-sodium acetate buffer is 0.05-0.2 M, and the pH is 2-5; the concentration of o-phenylenediamine solution is 10-300 mM, and the concentration of H2O2 is 0.5-2 M; the volume ratio of the two-dimensional MOF nanosheet / adapter / enrofloxacin complex solution, acetic acid-sodium acetate buffer, o-phenylenediamine solution and H2O2 is 5-20:985-940:5-20:5-20.

9. The method for rapid detection of enrofloxacin based on screen-printed electrode and aptasensor according to claim 1, characterized in that, In S4, the reaction time of the catalytic reaction system is 2-10 min, the potential range of the differential pulse voltammetry scanning is 0 to-0.85 V, 3-5 times are tested for each concentration, and the average value is taken.

Citation Information

Patent Citations

  • Ratio fluorescent probe for detecting fleroxacin based on metal organic framework material as well as preparation and application of ratiometric fluorescent probe

    CN115260519A

  • Electrochemical aptamer sensor based on Au-coated MnO nano-enzyme signal amplification as well as preparation method and application of electrochemical aptamer sensor

    CN118858408A