Recombinant modified saRNA (VRP) and vaccinia virus Ankara (MVA) prime-boost regimen

Abstract

The present invention provides compositions, vaccines and methods for inducing protective immunity against an immunogen in a human. The protective immune response is obtained by using saRNA, in particular a VRP vector, as prime immunization and MVA for augmentation. In particular, the present invention relates to genetically engineered (recombinant) VRP and MVA vectors comprising at least one heterologous nucleotide sequence encoding an antigenic determinant of an infectious virus, such as EBV.

Description

Field of the Invention

[0001] The present invention relates to methods and compositions for enhancing an immune response in a subject, comprising self-amplifying RNA (saRNA), in particular recombinant modified alphavirus replicons (VRPs) and vaccines based on vaccinia virus Ankara (MVA) for infectious diseases such as EBV in human subjects. The present invention also relates to vaccination methods, in particular heterologous prime-boost vaccination regimens employing two viral vector compositions. More specifically, the present invention relates to recombinant VRPs and recombinant MVAs for heterologous prime-boost vaccination regimens. The present invention also relates to products, methods and uses thereof, for example, suitable for inducing a protective immune response in a subject. Background Art

[0002] It is not uncommon for many vaccines to require multiple immunizations to be successful. For children, up to five immunizations may be needed, such as the diphtheria, tetanus, and pertussis (DTP) vaccine, which is given three times during the first six months of life, followed by a fourth dose in the second year of life and a final booster between four and six years of age. Nevertheless, some vaccines still require additional boosters, even for adults who have received a complete series of immunizations, such as the tetanus-diphtheria (Td) vaccine, for which boosters are recommended every 10 years throughout a person's life. Although it is not entirely clear why some vaccines require more immunizations than others, it is generally accepted that multiple immunizations (i.e., "prime-boost") are also essential for the most successful vaccines. This principle applies to live attenuated vaccines (e.g., oral polio vaccine), inactivated vaccines (e.g., hepatitis A vaccine), recombinant protein subunit vaccines (e.g., hepatitis B vaccine), and polysaccharide vaccines (e.g., Haemophilus influenzae type b vaccine). For these vaccines, the prime-boost is "homologous" in that the vaccine given in the early prime immunization is the same vaccine used in the subsequent booster immunization.

[0003] In the past decade, studies have shown that the same antigen can be used to prime-boost immunization in a "heterologous" prime-boost format using a mismatched vaccine delivery method. The most interesting and unexpected discovery is that in many cases, heterologous prime-boost is more effective than the "homologous" prime-boost method. The rapid progress of novel vaccination methods such as DNA vaccines and viral vector-based vaccines has undoubtedly further expanded the scope of heterologous prime-boost vaccination (Excler JL, Plotkin S. The prime-boost concept applied to HIV preventive vaccines. Aids. 1997; 11 (Supplement A): S127–S137; Ramshaw IA, Ramsay AJ. The prime-boost strategy: exciting prospects for improved vaccination. Immunol Today. 2000; 21: 163–165; Lu S. Combination DNA plus protein HIV vaccines. Springer Semin Immunopathol. 2006; 28: 255–265).

[0004] A landmark report in Science in 1992 used heterologous prime-boost vaccination technology for the first time in a non-human primate model (Hu SL, Abrams K, Barber GN, Moran P, Zarling JM, Langlois AJ, Kuller L, Morton WR, Benveniste RE. Protection of macaques against SIV infection by subunit vaccines of SIV envelope glycoprotein gp160. Science. 1992; 255: 456–459. First major report on the use of heterologous prime-boost vaccination approach, in the context of AIDS vaccine development). In this study, cynomolgus monkeys were first immunized with recombinant vaccinia virus expressing SIVmne gp160 antigen, and then boosted with gp160 protein produced in baculovirus-infected cells. The animals were protected from intravenous injection of SIVmne virus, which became one of the most promising protection results in early HIV vaccine development.

[0005] Shiu-Lok Hu, the lead scientist of the above study, and his collaborators had previously demonstrated in rodents that priming with live recombinant virus and boosting with subunit recombinant protein was more effective than immunization with either immunogen alone (Hu SL, Klaniecki J, Dykers T, Sridhar P, Travis BM. Neutralizing antibodies against HIV-1BRU and SF2 isolates generated in mice immunized with recombinant vaccinia virus expressing HIV-1(BRU)envelope glycoproteins and boosted with homologous gp160. AIDS Res Hum Retroviruses. 1991; 7: 615–620).

[0006] In a separate study, Girard et al. also reported that antibody titers were significantly increased in chimpanzees primed with recombinant vaccinia virus and boosted multiple times with a mixture of recombinant HIV-1 proteins or synthetic peptides (Girard M, Kieny MP, Pinter A, Barre-Sinoussi F, Nara P, Kolbe H, Kusumi K, Chaput A, Reinhart T, Muchmore E, et al. Immunization of chimpanzees confers protection against challenge with human immunodeficiency virus. Proc Natl Acad Sci US A. 1991; 88:542–546). Also, around the same time, in what may have been the first human test of heterologous prime-boost vaccination, Daniel Zagury of the Pierre and Marie Curie University in Paris vaccinated himself with a recombinant vaccinia virus containing the HIV-1 Env gene and later boosted with recombinant Env protein (Zagury D, Bernard J, Cheynier R, Desportes I, Leonard R, Fouchard M, Reveil B, Ittele D, Lurhuma Z, Mbayo K, et al. A group specific anamnestic immune reaction against HIV-1induced by a candidate vaccine against AIDS. Nature. 1988; 332: 728–731). Other early work in non-HIV areas included small animal studies by Eckhart Wimmer's group, who used synthetic peptides and inactivated poliovirus for prime-boost immunizations (Emini EA, Jameson BA, Wimmer E. Priming for and induction of anti-poliovirus neutralizing antibodies by synthetic peptides. Nature. 1983; 304: 699–703).

[0007] Initial efforts to develop HIV-1 vaccines using heterologous prime-boost immunization approaches were based on the following principles:

[0008] Recombinant envelope (Env) glycoproteins, while able to elicit isolated specific neutralizing antibody responses, fail to elicit cytotoxic T cell responses, and on the other hand, immunization with recombinant vaccinia expressing HIV-1 antigens elicits good T cell responses but fails to elicit high levels of protective antibodies. Therefore, combined immunization including these two vaccines may be more effective than either immunogen alone (Hu SL, Klaniecki J, Dykers T, Sridhar P, Travis BM. Neutralizing antibodies against HIV-1 BRU and SF2 isolates generated in mice immunized with recombinant vaccinia virus expressing HIV-1 (BRU) envelope glycoproteins and boosted with homologous gp160. AIDS Res Hum Retroviruses. 1991; 7: 615–620).

[0009] This statement establishes a key principle for the use of heterologous prime-boost immunization, namely the induction of both humoral and cell-mediated immune responses. Modern immunology has established that this balanced immune response is important not only for protection against viral infections, but also for protection against other types of pathogens. Traditional vaccines, especially inactivated and subunit vaccines, are poor at eliciting T cell responses. This requirement is even more important for HIV vaccine development. An ideal HIV vaccine should be able to generate "sterilizing antibodies" to prevent the virus from establishing infection, which is more difficult to eliminate once HIV-1 has integrated into the genome of the host's peripheral blood mononuclear cells (PBMCs).

[0010] At the same time, T cell immune responses play a key role in controlling the scale of infection and may affect the long-term mortality and morbidity of the host.

[0011] Over the past few years, the use of heterologous prime-boost approaches in vaccine research against a variety of pathogens has gained significant momentum. This trend has shown several distinct features.

[0012] First, due to the failure of other vaccination approaches, heterologous prime-boost approaches are often used to address some of the most challenging vaccine development targets, including malaria and tuberculosis. The goal is to focus on certain key antigens and elicit high-quality immune responses involving different T cell immune response subsets. DNA prime-MVA boost vaccine encoding thrombospondin-related adhesion protein partially protects healthy malaria-naive adults from Plasmodium falciparum sporozoite challenge (Dunachie SJ, Walther M, Epstein JE, Keating S, Berthoud T, Andrews L, Andersen RF, Bejon P, Goonetilleke N, Poulton I, et al. A DNA prime-modified vaccinia virus ankara boost vaccine encoding thrombospondin-related adhesion protein but not circumsporozoite protein partially protects healthy malaria-naive adults against Plasmodium falciparum sporozoite challenge. Infect Immun. 2006; 74: 5933–5942). This study also highlights the importance of antigen selection for immune protection, as evidenced by the fact that the same combination vaccination did not result in such protection if circumsporozoite protein was used instead of thrombospondin-related adhesion protein.

[0013] For tuberculosis vaccine development, qualitatively and quantitatively different cellular immune responses were elicited in rhesus macaques that received a recombinant BCG (BCG) prime followed by an adenovirus 35 vector booster (which expresses a fusion protein consisting of Ag85A, Ag85B, and TB104) (Magalhaes I, Sizemore DR, Ahmed RK, Mueller S, Wehlin L, Scanga C, Weichold F, Schirru G, Pau MG, Goudsmit J, et al. rBCG induces strong antigen-specific T cell responses in rhesus macaques in a prime-boost setting with anadenovirus 35tuberculosis vaccine vector. PLoS ONE. 2008; 3: e3790). Alternatively, BCG can also be used as a booster after DNA vaccine prime. In a study conducted in calves, DNA priming with Ag85B, MPT64, and MPT83 antigens followed by a BCG boost elicited a higher immune response and provided better protection against Mycobacterium bovis challenge than BCG alone (Cai H, Yu DH, Hu XD, Li SX, Zhu YX. A combined DNA vaccine-prime, BCG-boost strategy results in better protection against Mycobacterium bovis challenge. DNA Cell Biol. 2006; 25: 438–447).

[0014] Secondly, a well-designed heterologous prime-boost approach can expand the range of immune responses. When mice were primed with a DNA vaccine expressing ESAT6 and subsequently received the same antigen in the form of a recombinant protein as a booster, the production of Th1-type cytokines increased significantly, and the ratio of IgG2 to IgG1 also increased significantly (Wang QM, Sun SH, Hu ZL, Yin M, Xiao CJ, Zhang JC. Improved immunogenicity of a tuberculosis DNA vaccine encoding ESAT6 by DNA priming and protein boosting. Vaccine. 2004; 22: 3622–3627). In another murine study, primed with a DNA vaccine expressing the gD antigen of herpes simplex virus type 2 (HSV-2), which preferentially induced a Th1-type cellular immune response, and boosted with recombinant gD protein, which primarily induced a Th2-biased response, resulting in significant enhancement of antibody, T cell proliferation, and Th1 cytokine production (Sin JI, Bagarazzi M, Pachuk C, Weiner DB. DNA priming-protein boosting enhances both antigen-specific antibody and Th1-type cellular immune responses in a murine herpes simplex virus-2gD vaccine model. DNA Cell Biol. 1999; 18: 771–779).

[0015] Third, the prime-boost vaccine approach can also improve the effectiveness of existing vaccines. An example is the use of DNA priming in animals, which increases the level of antibody response, followed by a booster of inactivated rabies vaccine (Biswas S, Reddy GS, Srinivasan VA, Rangarajan PN. Preexposure efficacy of a novel combination DNA and inactivated rabies virus vaccine. Hum Gene Ther. 2001; 12: 1917–1922). Similarly, DNA priming can increase the titer and lifespan of highly immune sera in animals to be immunized with recombinant PA antigens against anthrax (Herrmann JE, Wang S, Zhang C, Panchal RG, Bavari S, Lyons CR, Lovchik JA, Golding B, Shiloach J, Lu S. Passive immunotherapy of Bacillus anthracis pulmonary infection in mice with antisera produced by DNA immunization. Vaccine. 2006; 24: 5872–5880). Adding DNA priming, mice boosted with a licensed hepatitis B surface protein vaccine were able to generate stronger and more uniform antibody responses in the study group compared to the group that received recombinant protein alone. Increased secretion of IL-12 and IFN-γ in splenocytes was also observed (Xiao-wen H, Shu-han S, Zhen-lin H, Jun L, Lei J, Feng-juan Z, Ya-nan Z, Ying-jun G. Augmented humoral and cellular immune responses of a hepatitis B DNA vaccine encoding HBsAg by protein boosting. Vaccine. 2005; 23: 1649–1656).

[0016] Finally, the prime-boost approach may have important practical applications in addressing vaccine issues that have broad public health implications. In an animal model that is not infected with influenza virus, heterologous one-time DNA prime and one-time inactivated influenza vaccine boost have been shown to be more immunogenic than two homologous primes using DNA or inactivated influenza vaccines alone (Wang S, Parker C, Taaffe J, Solorzano A, Garcia-Sastre A, Lu S. Heterologous HADNA vaccine prime--inactivated influenza vaccine boost is more effective than using DNA or inactivated vaccine alone in eliciting antibody responses against H1 or H3 serotype influenza viruses. Vaccine. 2008; 26: 3626–3633). This finding may be very useful for preparing for an avian influenza pandemic. One of the key issues facing influenza vaccine development is the limited production capacity and long cycle of traditional influenza vaccines. Avian influenza vaccines usually require two immunizations. The target population can first receive an avian influenza DNA vaccine prime before any unexpected influenza pandemic breaks out, which will greatly reduce the amount of vaccine required when an influenza pandemic breaks out. This approach could also be used for other forms of influenza, including human influenza virus and swine influenza virus. Adding new vaccine strains to the existing trivalent influenza vaccine would require significant additional resources and time. Polyvalent DNA priming could cover a wide range of potential future virus strains at a much lower cost.

[0017] Similar to other novel vaccine formats, heterologous prime-boost approaches have also been investigated as potential treatments for cancer. Using the recently identified six-transmembrane epithelial antigen of the prostate (STEAP), heterologous DNA priming and Venezuelan equine encephalitis virus-like replicon particles (VRP) boosts were able to elicit better immune responses against STEAP, including INF-γ, TNF-α, and IL-12, compared to either vaccine approach alone. This vaccination regimen induced a modest but significant delay in the growth of established 31-day tumors in mice (Garcia-Hernandez Mde L, Gray A, Hubby B, Kast WM. In vivo effects of vaccination with six-transmembraneepithelial antigen of the prostate: a candidate antigen for treating prostate cancer. Cancer Res. 2007; 67: 1344–1351).

[0018] A fundamental but still mysterious question is why heterologous prime-boost is more effective than homologous prime-boost even when the same vaccine components are used. One way to investigate this question is to determine the importance of the order of administration of heterologous prime-boost vaccines. Using the Mycobacterium bovis model, it was demonstrated that the order of prime-boost vaccination of neonatal calves with BCG and a DNA vaccine encoding mycobacterialproteins Hsp65, Hsp70, and Apa is not critical for enhancing protection against bovine tuberculosis (Skinner MA, Wedlock DN, de Lisle GW, Cooke MM, Tascon RE, Ferraz JC, Lowrie DB, Vordermeier HM, Hewinson RG, Buddle BM. The order of prime-boost vaccination of neonatal calves with Mycobacterium bovis BCG and a DNA vaccine encoding mycobacterialproteins Hsp65, Hsp70, and Apa is not critical for enhancing protection against bovine tuberculosis. Infect Immun. 2005; 73: 4441–4444). In a different model, using murine HSV-2 gD antigen for DNA prime-protein boost, it was clear that DNA priming was crucial, as the reverse protein prime-DNA boost regimen generated antibody levels similar to those after homologous protein-protein vaccination and failed to further enhance Th cell proliferation responses or cytokine production (Sin JI, Bagarazzi M, Pachuk C, Weiner DB. DNA priming-protein boosting enhances both antigen-specific antibody and Th1-type cellular immune responses in a murine herpes simplex virus-2gD vaccine model. DNA Cell Biol. 1999; 18: 771–779). In an even more detailed analysis using hepatitis C E2 as a model antigen, DNA priming-adenoviral vector boosting elicited the highest levels of Th1 CD4+ T cell responses compared to reverse adenovirus prime-DNA boost or homologous prime-boost using the same vaccine.More interestingly, the DNA prime-adenovirus vector boost regimen elicited CTL responses against three E2-specific epitopes, but none of the other three possible prime-boost combinations elicited CTL responses, and one of the epitopes was immunodominant (Park SH, Yang SH, Lee CG, Youn JW, Chang J, Sung YC. Efficient induction of T helper 1 CD4+ T-cell responses to hepatitis C virus core and E2 by a DNA prime-adenovirus boost. Vaccine. 2003; 21: 4555–4564.·The order of prime-boost with DNA and adenovirus vector vaccines is important for the induction of cell mediated immune responses against HCV E2 antigen).

[0019] In an extensive nonhuman primate study presented by Shiu-lok Hu, PhD, of the University of Washington in Seattle, at the 2008 AIDS Vaccine Conference in Cape Town, South Africa, priming with either vaccinia virus vectors or DNA followed by a protein boost produced better antibody responses than boosting with DNA or various viral vector vaccines. The two heterologous prime-boost regimens (including the protein boost component but not any other combination) were able to elicit better neutralizing antibodies and anti-SHIV antibodies in about 40% of the vaccinated animals. sf162.p4 High-dose intrarectal challenge induced ablation of the immune system and protected animals from peripheral CD4+ T cell depletion.

[0020] Some studies have shown that DNA priming can increase the avidity of antibody responses elicited by protein-based vaccines (Richmond JF, Lu S, Santoro JC, Weng J, Hu SL, Montefiori DC, Robinson HL. Studies of the neutralizing activity and avidity of anti-human immunodeficiency virustype 1Env antibody elicited by DNA priming and protein boosting. J Virol. 1998; 72: 9092–9100; Wang S, Arthos J, Lawrence JM, Van Ryk D, Mboudjeka I, Shen S, Chou TH, Montefiori DC, Lu S. Enhanced immunogenicity of gp120 protein when combined with recombinant DNA priming to generate antibodies that neutralize the JR-FLprimary isolate of human immunodeficiency virus type 1. J Virol. 2005; 79: 7933–7937). Since DNA vaccines produce antigens in vivo, priming with DNA vaccines may elicit memory B cells specific for antigen-sensitive conformational domains.In a rabbit study, delivery of native HIV-1 gp120 antigen using a DNA prime-protein boost approach (rather than recombinant gp120 protein vaccine alone) was able to elicit conformation-dependent CD4 binding site antibodies, which has potential implications for neutralizing HIV-1 vaccines (M, Wang S, Crooks ET, Jiang P, Montefiori DC, Binley J, Lu S. Improved induction of antibodies against key neutralizing epitopes by human immunodeficiency virus type 1 gp120 DNA prime-protein boost vaccination compared to gp120 protein-only vaccination. J Virol. 2008; 82: 7369–7378. Including a DNA priming immunization was able to elicit conformationsensitive antibody responses when compared to protein alone HIV-1 Env vaccine).

[0021] By including other factors that may further promote or enhance the effect of the vaccine, the immunogenicity of heterologous priming-boosting can be further improved. For example, including plasmid cytokines and colony stimulating factors can enhance the immunogenicity of DNA priming-viral vector boosting HIV-1 vaccines (Barouch DH, McKay PF, Sumida SM, Santra S, Jackson SS, Gorgone DA, Lifton MA, Chakrabarti BK, Xu L, Nabel GJ, et al. Plasmid chemokines and colony-stimulating factors enhance the immunogenicity of DNA priming-viral vector boosting human immunodeficiency virus type 1 vaccines. J Virol. 2003; 77: 8729–8735). The potency of DNA vaccine priming can be enhanced by using a microparticle-based formulation followed by a protein boost (Otten GR, Schaefer M, Doe B, Liu H, Srivastava I, Megede J, Kazzaz J, Lian Y, Singh M, Ugozzoli M, et al. Enhanced potency of plasmid DNA microparticle human immunodeficiency virus vaccines in rhesus macaques by using a priming-boosting regimen with recombinant proteins. J Virol. 2005; 79: 8189–8200). However, it is unclear whether using different adjuvants as a boost for protein vaccines will have any effect.

[0022] Heterologous prime-boost vaccination, using both traditional and novel immunization approaches, offers the opportunity to elicit unique immune responses that improve immunogenicity and / or protection. Studies have shown that heterologous prime-boost can take a variety of forms and that the order of administration of prime-boost may be important, although this may be antigen-dependent and may be influenced by the host species and the type of immune response to be achieved. Future studies are needed to focus more on the mechanisms behind heterologous prime-boost vaccination and to address practical issues associated with two-component vaccines, including vaccine cost and any currently unidentified safety issues.

[0023] There is an unmet need for improved vaccines that elicit immune responses against different viruses and employ heterologous prime-boost vaccination regimens. Summary of the invention

[0024] The present invention has discovered that various prime-boost combinations of replication-incompetent vectors can produce effective immune protection against infectious diseases, particularly EBV infection.

[0025] Therefore, one general aspect of the present invention relates to a vaccine combination comprising

[0026] (a) a first composition comprising an immunologically effective amount of saRNA, the saRNA comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; and

[0027] (b) a second composition, comprising an immunologically effective amount of an MVA vector, the MVA vector comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier;

[0028] wherein one of the compositions is a priming composition and the other composition is a boosting composition.

[0029] In another aspect, the present invention relates to a kit comprising:

[0030] (a) a first composition comprising an immunologically effective amount of saRNA, the saRNA comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; and

[0031] (b) a second composition, comprising an immunologically effective amount of an MVA vector, the MVA vector comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier;

[0032] wherein one of the compositions is a priming composition and the other composition is a boosting composition.

[0033] In another aspect, the invention relates to a method of inducing an immune response against a virus in a subject, the method comprising administering to the subject:

[0034] (a) a first composition comprising an immunologically effective amount of saRNA, the saRNA comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; and

[0035] (b) a second composition, comprising an immunologically effective amount of an MVA vector, the MVA vector comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier;

[0036] wherein one of the compositions is a priming composition and the other composition is a boosting composition.

[0037] In certain embodiments, the first composition is used to elicit an immune response and the second composition is used to enhance the immune response, or vice versa.

[0038] In certain embodiments, the present invention relates to a recombinant modified vaccinia virus (MVA) vector and a VRP vector comprising a nucleotide sequence encoding two or more antigenic determinants of a virus that causes an infectious disease.

[0039] In a preferred embodiment, the antigenic protein is any one of the structural and non-structural proteins of EBV. In a preferred embodiment, the antigenic protein is selected from gp350, gH, gL, EBNA3A, BRLF1 / BZLF1 fusion.

[0040] In another embodiment, the VRP is VEEV TC83 and the MVA is MVA-BN.

[0041] In yet another embodiment, the VRP vector in the first composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

[0042] In yet another embodiment, the MVA vector in the second composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:4.

[0043] In another aspect, the present invention relates to a vaccine combination comprising

[0044] (a) a first composition comprising an immunologically effective amount of saRNA, the saRNA comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; and

[0045] (b) a second composition, comprising an immunologically effective amount of an MVA vector, the MVA vector comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier;

[0046] wherein one of the compositions is a priming composition and the other composition is a boosting composition.

[0047] For use in generating a protective immune response against an infectious disease, wherein the first composition is used to elicit the immune response and the second composition is used to enhance the immune response, or vice versa.

[0048] The boosting composition may comprise two or more doses of the boosting composition's carrier.

[0049] In a further aspect, the present invention relates to the use of a vaccine combination or kit comprising

[0050] (a) a first composition comprising an immunologically effective amount of a saRNA vector, the saRNA vector comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; and

[0051] (b) a second composition, comprising an immunologically effective amount of an MVA vector, the MVA vector comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier;

[0052] wherein one of the compositions is a priming composition and the other composition is a boosting composition.

[0053] Used for manufacturing pharmaceutical compositions or medicaments for treating and / or preventing infectious diseases.

[0054] In yet another aspect, the present invention relates to a pharmaceutical composition comprising a vaccine combination comprising

[0055] (a) a first composition comprising an immunologically effective amount of a saRNA vector, the saRNA vector comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; and

[0056] (b) a second composition, comprising an immunologically effective amount of an MVA vector, the MVA vector comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier;

[0057] wherein one of the compositions is a priming composition and the other composition is a boosting composition and a pharmaceutically acceptable carrier, diluent and / or additive.

[0058] These and other objects of the present invention will be further described in detail in conjunction with the detailed description of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention and, together with the description, serve to explain the principles of the invention.

[0060] Figure 1A The structure and genetic organization of MVA-mBN443 are shown. Figure 1BThe structure and genetic organization of VRP-BN011 are shown. UTR = 5' or 3' untranslated region of VEEV; nsp = coding region of nonstructural proteins, SUBG PROM = subgenomic promoter of VEEV; EBV gp350 multimer: EBV gp350 = Epstein-Barr virus glycoprotein gp350 amino acids 2-434, fused to the GCN4 multimerization domain at the C-terminus; T2A = 2a peptide sequence; RKRR = furin cleavage site; P2A = 2a peptide sequence; gH = glycoprotein H of EBV; gL = glycoprotein L of EBV

[0061] Figure 2 Gp350-specific IgG responses are shown for each group. Animals (n=3) were administered intramuscularly twice on days 1 and 29 using a prime-boost regimen as outlined in the legend and described in Table 1 . Blood was collected prior to administration (pre-dose) and on days 29 and 43. Sera were tested using a multiplex ELISA. In this figure, the geometric mean and geometric standard deviation of gp350-specific IgG concentrations are expressed in EU.

[0062] Figure 3 Neutralizing antibodies in each group are shown. Animals (n=3) were administered intramuscularly twice at the 1st and 29th days with a primary immunity-boosting regimen as outlined in the legend and described in Table 1. Blood was collected before administration (before dose) and at the 29th and 43rd days, and serum was tested using a neutralization test based on flow cytometry. In this figure, geometric mean and geometric standard deviation are shown.

[0063] Figure 4 Gp350-specific T cell responses are shown for each group. Animals (n=3) were administered intramuscularly twice on days 1 and 29 using a prime-boost regimen as outlined in the legend and described in Table 1. Blood was collected prior to administration (pre-dose) and on days 8 and 36, and PBMCs were tested using an ELISPOT assay. In this figure, 1x10 6 Mean number of spot forming units (SFU) and standard error of the mean (SEM) in PBMCs.

[0064] Figure 5Shown are the IFN-γ ELISPOT responses of splenocytes after two weeks of boosting. Mice were immunized intramuscularly (IM) with TNE (buffer control), MVA-EBV or VRP-EBV on day 0, and boosted with the same homologous or heterologous test article on day 21. After 2 weeks of boosting, splenocytes were isolated and restimulated with three gp350 peptides (EBV peptide #1 (MEAALLVCQYTIQSL); EBV gp350 peptide #25 (LGAGELALTMRSKKL) and EBV peptide #26 (ELALTMRSKKLPINV)) in an ELISPOT assay. IFN-γ positive spots were counted. All counts were subtracted from background (vehicle control stimulation). Bars represent mean ± SEM;

[0065] Figure 6 OVA-specific CD8 T cell responses in the blood five days after booster immunization are shown. Mice were subcutaneously (SC) immunized with TNE (buffer control), MVA-OVA or VRP-OVA on day 0 and boosted with the same homologous or heterologous test article on day 21. Five days after the boost, blood was drawn and OVA-specific CD8 T cells were determined by flow cytometric analysis using SIINFEKL-dextramer. Bars represent mean ± SEM. N = 5 mice per group.

[0066] Figure 7 OVA-specific CD8 T cell responses in the spleen four weeks after booster immunization are shown. Mice were subcutaneously (SC) immunized with TNE (buffer control), MVA-OVA or VRP-OVA on day 0 and boosted with the same homologous or heterologous test article on day 21. Splenocytes were isolated four weeks after booster immunization and restimulated for 6 h with OVA257-264 peptide or OVA55-62 peptide. Cells producing cytokines were detected by flow cytometry. Bars represent mean ± SEM. N = 5 mice per group.

[0067] Figure 8 Shown are OVA-specific total serum IgG titers after heterologous VRP / MVA immunization. Mice were immunized subcutaneously (SC) with TNE (buffer control), MVA-OVA or VRP-OVA on day 0 and boosted with the same homologous or heterologous test article on day 21. Blood was drawn and serum was separated on days 14 and 35. OVA-specific total IgG titers were determined by ELISA. Bars represent mean ± SEM. N = 5 mice per group.

[0068] Fig. 9Shown are the IFN-γ ELISPOT responses of splenocytes after two weeks of boosting. Mice were immunized intramuscularly (IM) with TNE (buffer control), MVA-EBV or SFV-VRP-EBV on day 0, and boosted with the same homologous or heterologous test article on day 21. After 2 weeks of boosting, splenocytes were isolated and restimulated with three gp350 peptides (EBV peptide #1 (MEAALLVCQYTIQSL); EBV gp350 peptide #25 (LGAGELALTMRSKKL) and EBV peptide #26 (ELALTMRSKKLPINV)) in an ELISPOT assay. IFN-γ positive spots were counted. All counts were subtracted from background (vehicle control stimulation). Bars represent mean ± SEM;

[0069] A brief description of the sequence

[0070] SEQ ID NO: 1 depicts the nucleic acid sequence of the gp350 multimer (1455 nucleotides).

[0071] SEQ ID NO: 2 shows the nucleic acid sequence of gH (2121 nucleotides).

[0072] SEQ ID NO: 3 shows the nucleic acid sequence of gL (414 nucleotides).

[0073] SEQ ID NO: 4 shows the nucleic acid sequence (2283 nucleotides) of the fusion gene made from the BZLF1-BRLF1 sequence.

[0074] SEQ ID NO: 5 depicts the nucleic acid sequence of EBNA3A (2892 nucleotides).

[0075] SEQ ID NO: 6 depicts the DNA sequence of a loxPV site.

[0076] SEQ ID NO:7 shows the nucleic acid sequence of the Pr13.5 long promoter.

[0077] SEQ ID NO: 8 depicts the nucleic acid sequence of the PrS promoter.

[0078] SEQ ID NO:9 shows the nucleic acid sequence of the PrH5m promoter.

[0079] SEQ ID NO: 10 depicts the nucleic acid sequence of the Pr1328 promoter.

[0080] SEQ ID NO: 11 depicts the nucleic acid sequence of 2A peptide (T2A).

[0081] SEQ ID NO: 12 depicts the nucleic acid sequence of 2A peptide (P2A).

[0082] SEQ ID NO: 13 shows the nucleic acid sequence of linker GCN4. DETAILED DESCRIPTION

[0083] It would not have been expected from the teachings and implementations of the prior art that a heterologous prime-boost regimen with saRNA, particularly VRP, as a prime vaccination and MVA as a booster vaccination would be highly immunogenic in terms of gp350-specific IgG and neutralizing antibodies, whereas homologous vaccination with MVA or VRP, or administration of Ad as a booster vaccine, had minimal immunogenic effects.

[0084] Heterologous prime-boost regimens will generate immune responses that protect non-human primates from viral infections, particularly EBV. Of course, based on the data generated by the inventors and their observations, it is reasonable and credible to conclude that the vaccine regimen will also induce an immune response in humans, and not only specifically against EBV, but also against other diseases caused by other disease-related antigens, including infectious disease antigens or tumor-related antigens. In fact, the FDA accepts non-human primate models as evidence that vaccines that confer protection in these non-human primates are also suitable for humans.

[0085] In particular, the present inventors have also found that an immunization regimen comprising VRP as a primary vaccination produces higher gH / gL / gp42 complex and gH-specific IgG responses than using MVA as a primary vaccination. A single MVA or VRP vaccination of NHP with pre-existing immunity to gH / gL / gp42 or gH only boosts gH / gL / gp42 complex and gH-specific IgG responses, while a second administration has no or only a small additional boosting effect.

[0086] Thus, the present invention provides vaccines or vaccine combinations for generating an immune response that confers protection against infectious disease antigens or tumor-associated antigens (eg, EBV), as well as vaccines or vaccine combinations that can be used to manufacture vaccines against such antigens.

[0087] definition

[0088] Before describing the present invention in detail below, it should be understood that the present invention is not limited to the specific methods, protocols and reagents described herein, as these may vary. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of the present invention, which is limited only by the appended claims. Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as generally understood by those of ordinary skill in the art.

[0089] It must be noted that, as used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a structural protein" includes one or more structural proteins, and reference to "the method" includes reference to equivalent steps and methods known to those of ordinary skill in the art that may modify or substitute the methods described herein.

[0090] Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to each element in the series. Those skilled in the art will recognize or be able to determine using only routine experimentation that many embodiments are equivalent to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.

[0091] When the term "about" is used in conjunction with a numerical value, it is intended to encompass a range of values ​​having a lower limit that is 5% less than the stated value and an upper limit that is 5% greater than the stated value, unless the context clearly dictates otherwise.

[0092] As used herein, the connection term "and / or" between multiple listed elements is understood to include separate and combined options. For example, where two elements are connected by "and / or", the first option refers to the applicability of the first element without the second element. The second option refers to the applicability of the second element without the first element. The third option refers to the applicability of the first and second elements together. Any of these options is understood to fall within the meaning and therefore meets the requirements of the term "and / or" used herein. The simultaneous applicability of more than one option is also understood to fall within the meaning and therefore meets the requirements of the term "and / or".

[0093] Throughout the specification and the claims that follow, unless the context requires otherwise, the word "comprise" and variations such as "comprises" and "comprising" should be understood to imply the inclusion of the stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. When used herein, the term "comprises" may be replaced with the terms "contains" or "includes" or, as is sometimes the case, with the term "having" when used herein. Any of the above terms (comprise, contain, include, have), although less preferred, whenever used in the context of one aspect or embodiment of the invention, may be replaced with the term "consisting of".

[0094] When used herein, "consisting of" excludes any element, step, or ingredient not specified in the claim elements. When used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.

[0095] The term "antigen" includes all relevant epitopes of a particular compound, composition or substance. The term "epitope" or "antigenic determinant" refers to a site on an antigen where B cells and / or T cells bind to and respond to another protein, such as, for example, a major histocompatibility complex ("MHC") protein or a T cell receptor alone. An epitope can be formed by adjacent amino acids or by non-adjacent amino acids juxtaposed by the secondary and / or tertiary folding of a protein. The epitope formed by adjacent amino acids is usually retained when exposed to a denaturing solvent, while the epitope formed by the tertiary folding is usually lost when treated with a denaturing solvent. An epitope generally comprises at least 5, 6, 7, 8, 9, 10 or more amino acids, but is generally less than 20 amino acids, and has a unique spatial conformation. Methods for determining the spatial conformation of an epitope include, for example, X-ray crystallography and two-dimensional nuclear magnetic resonance. See, for example, "Epitope Mapping Protocols" in Methods in Molecular Biology, Vol. 66, Glenn E. Morris, ed. (1996).

[0096] Antigens can be tissue-specific (or tissue-associated) antigens or disease-specific (or disease-associated) antigens. These terms are not mutually exclusive, because tissue-specific antigens can also be disease-specific antigens. Tissue-specific antigens are expressed in a limited number of tissues. Tissue-specific antigens include, for example, prostate-specific antigen ("PSA"). Disease-specific antigens are expressed simultaneously with the disease process, wherein antigen expression is associated with the development of a particular disease or can predict the development of a particular disease. Disease-specific antigens include, for example, HER-2 associated with certain types of breast cancer, or PSA associated with prostate cancer. Disease-specific antigens can be antigens recognized by T cells or B cells.

[0097] Malignant growth derived from a specific body tissue that has experienced a loss of characteristic structural differentiation is usually accompanied by an increase in cell division ability, invasion of surrounding tissues, and metastasis ability. Tumors may be benign or malignant. For example, prostate cancer is a malignant neoplasm originating from prostate tissue or from prostate tissue, ovarian cancer is a malignant neoplasm originating from ovarian tissue or from ovarian tissue, colon cancer is a malignant neoplasm originating from colon tissue or from colon tissue, and lung cancer is a malignant neoplasm originating from lung tissue or from lung tissue. Residual cancer refers to a cancer remaining in the subject's body after treatment is given to reduce or eradicate cancer. Metastatic cancer refers to a cancer at one or more positions of the body except the original (primary) cancer origin position (metastatic cancer originates from the position).

[0098] "Conservative" variants are variant proteins or polypeptides with one or more amino acid substitutions that do not significantly affect or reduce the activity or antigenicity of the protein or its epitope. Typically, conservative substitutions are those in which a specific amino acid is substituted with another amino acid having the same or similar chemical characteristics. For example, replacing a basic amino acid (such as lysine) with another basic amino acid (such as arginine or glutamine) is a conservative substitution. The term conservative variant also includes replacing the unsubstituted parent amino acid with a substituted amino acid, provided that the antibodies generated for the substituted polypeptide also react immunologically with the unsubstituted polypeptide, and / or the substituted polypeptide retains the function of the unsubstituted polypeptide. Non-conservative substitutions are replacements of specific amino acids with amino acids having different chemical characteristics, and typically reduce the activity or antigenicity of a protein or its epitope.

[0099] Specific, non-limiting examples of conservative substitutions include the following:

[0100]

[0101] "Disease associated antigens" are expressed simultaneously with a specific disease process, where the antigen expression is associated with the disease or can predict the development of the disease. Disease associated antigens include, for example, HER-2 associated with certain types of breast cancer, or prostate specific antigen ("PSA") associated with prostate cancer. Disease associated antigens can be antigens recognized by T cells or B cells. Some disease associated antigens may also be tissue specific. Tissue specific antigens are expressed in a limited number of tissues. Tissue specific antigens include, for example, prostate specific antigen PSA.

[0102] The disease-associated antigen can be, for example, a tumor antigen, a viral antigen, a bacterial antigen, a fungal antigen, or a parasitic antigen.

[0103] The term "tumor antigen" refers to an antigen that is expressed only on, associated with, or overexpressed in tumor tissue. Exemplary tumor antigens include, but are not limited to, 5-α-reductase, α-fetoprotein ("AFP"), AM-1, APC, April, B melanoma antigen gene ("BAGE"), β-catenin, Bcl12, bcr-abl, Brachyury, CA-125, caspase-8 ("CASP-8", also known as "FLICE"), cathepsin, CD19, CD20, CD21 / complement receptor 2 ("CR2"), CD22 / BL-CAM, CD23 / F cεRII, CD33, CD35 / complement receptor 1 ("CR1"), CD44 / PGP-1, CD45 / leukocyte common antigen ("LCA"), CD46 / membrane cofactor protein ("MCP"), CD52 / CAMPATH-1, CD55 / decay accelerating factor ("DAF"), CD59 / protectin, CDC27, CDK4, carcinoembryonic antigen ("CEA"), c-myc, cyclooxygenase-2 ("cox-2"), deleted in colorectal cancer gene ("DCC"), DcR3, E6 / E7, CGFR, EMBP, Dna78, farnesyl transferase transferase, fibroblast growth factor 8a ("FGF8a"), fibroblast growth factor 8b ("FGF8b"), FLK-1 / KDR, folate receptor, G250, G melanoma antigen gene family ("GAGE-family"), gastrin 17, gastrin-releasing hormone, ganglioside 2 ("GD2") / ganglioside 3 ("GD3") / ganglioside-monosialyl-2 ("GM2"), gonadotropin-releasing hormone ("GnRH"), UDP-GlcNAc:R1Man(α1-6)R2[GlcNAc:Man(α1-6)]β1,6-N-acetylglucosamine transferase V ("GnT ​​V"), GP1, gp100 / Pme117, gp-100-in4, gp15, gp75 / tyrosine-related protein-1 ("gp75 / TRP-1"), human chorionic gonadotropin ("hCG"), heparanase, Her2 / neu, human mammary tumor virus ("HMTV"), 70-kilodalton heat shock protein ("HSP70"), human telomerase reverse transcriptase ("hTERT"), insulin-like growth factor receptor-1 ("IGFR-1"), interleukin-1 3 receptor ("IL-13R"), inducible nitric oxide synthase ("iNOS"), Ki67, KIAA0205, K-ras, H-ras, N-ras, KSA, LKLR-FUT, melanoma antigen encoding family ("MAGE family", including at least MAGE-1, MAGE-2, MAGE-3 and MAGE-4), mammaglobin, MAP17, Melan-A / melanoma antigen recognized by T cells-1 ("MART-1"), mesothelin, MIC A / B, MT-MMPs, mucin, testis-specific antigen NY-ESO-1, osteonectin, p15, P170 / MDR1, p53, p97 / melanotransferrin, PAI-1, platelet-derived growth factor ("PDGF"), μPA, PRAME, prostate basic protein, progenitor cell line cytokinin, prostate-specific antigen ("PSA"), prostate-specific membrane antigen ("PSMA"), prostatic acid phosphatase ("PAP"), RAG E-1, Rb, RCAS1, SART-1, SSX-family, STAT3, STn, TAG-72, transforming growth factor-α ("TGF-α"), transforming growth factor-β ("TGF-β"), thymosin-β-15, tumor necrosis factor-α ("TNF-α"), TP1, TRP-2, tyrosinase, vascular endothelial growth factor ("VEGF"), ZAG, p16INK4, and glutathione-S-transferase ("GST").

[0104] The term "viral antigen" refers to an antigen derived from any disease-associated pathogenic virus. Exemplary disease-associated viral antigens include, but are not limited to, antigens derived from the following viruses: adenovirus, arbovirus, astrovirus, coronavirus, Coxsackievirus, Crimean-Congo hemorrhagic fever virus, cytomegalovirus ("CMV"), dengue virus, Ebolavirus, Epstein-Barr virus ("EBV"), foot-and-mouth disease virus, Guanarito virus, Hendra virus, virus), herpes simplex virus type 1 (“HSV-1”), herpes simplex virus type 2 (“HSV-2”), human herpes simplex virus type 6 (“HHV-6”), human herpes simplex virus type 8 (“HHV-8”), hepatitis A virus (“HAV”), hepatitis B virus (“HBV”), hepatitis C virus (“HCV”), hepatitis D virus (“HDV”), hepatitis E virus (“HEV”), human immunodeficiency virus (“HIV”), influenza virus, Japanese encephalitis virus, Juninvirus, Lassa virus, Machupo virus, Marburg virus, measles virus, human metapneumovirus, molluscum contagiosum virus, mumps virus, Newcastle disease virus, Nipha virus, Norovirus, Norwalk virus, virus), human papillomavirus (“HPV”), parainfluenza virus, parvovirus, poliovirus, rabies virus, respiratory syncytial virus (“RSV”), rhinovirus, rotavirus, rubella virus, Sabia virus, severe acute respiratory syndrome virus (“SARS”), varicella zoster virus, smallpox virus, West Nile virus, and yellow fever virus.

[0105] The term "bacterial antigen" refers to an antigen derived from any disease-related pathogenic virus. Exemplary bacterial antigens include, but are not limited to, antigens derived from the following bacteria: Bacillus anthracis, Bordetella pertussis, Borrelia burgdorferi, Brucella abortus, Brucella canis, Brucella melitensis, Brucella suis, Burkholderia mallei, Burkholderia pseudomallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydophila psittaci, Clostridium botulinum, Clostridium difficile, difficile, Clostridium perfringens, Clostridium tetani, Corynebacterium diptheriae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Enterotoxigenic Escherichia coli, Pathogenic Escherichia coli, Escherichia coli 157:H7, Francisella tularensis, Haemophilus influenza, Helicobacter pylori, Legionella pneumophila, Leptospira interrogans, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis tuberculosis, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidismeningitides, Pseudomonas aeruginosa, Rickettsia rickettsia, Salmonella typhi, Salmonella typhimurium, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Vibrio cholerae, and Yersiniapestis.

[0106] The term "fungal antigen" refers to an antigen derived from any disease-associated pathogenic fungus. Exemplary fungal antigens include, but are not limited to, antigens derived from the following fungi: Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus niger, Aspergillus terreus, Blastomyces dermatitidis, Candida albicans, Candida dubliniensis, Candida glabrata, Candida parapsilosis, Candida rugosa, Candida tropicalis, Cryptococcus albidus, Cryptococcus gattii, Cryptococcus laurensis. laurentii, Cryptococcus neoformans, Histoplasma capsulatum, Microsporum canis, Pneumocystis carinii, Pneumocystis jirovecii, Sporothrix schenckii, Stachbotrys chartarum, Tinea barbae, Tinea captitis, Tinea corporis, Tinea cruris, Tinea afaciei, Tinea incognito, Tinea nigra, Tinea versicolor, Trichophyton rubrum, and Trichophyton tonsurans.

[0107] The term "parasite antigen" refers to an antigen derived from any disease-associated pathogenic parasite. Exemplary parasite antigens include, but are not limited to, antigens derived from the following parasites: Anisakis spp., Babesia spp., Baylisascaris procyonis, Cryptosporidium spp., Cyclospora cayetanensis, Diphyllobothrium spp., Dracunculus medinensis, Entamoeba histolytica, Giardia duodenalis, Giardia intestinalis, Giardia lamblia, Leishmania sp., Plasmodium falciparum, falciparum, Schistosoma mansoni, Schistosoma haematobium, Schistosoma japonicum, Taenia spp., Toxoplasma gondii, Trichinella spiralis, and Trypanosoma cruzi.

[0108] "Epstein-Barr virus," "EBV," "human herpesvirus 4," and "HHV-4" are used interchangeably and refer to oncogenic human herpesviruses. EBV is the cause of acute infectious mononucleosis (AIM, also known as glandular fever). It is also associated with certain forms of cancer, such as Hodgkin lymphoma, Burkitt's lymphoma, nasopharyngeal carcinoma, and conditions associated with the human immunodeficiency virus (HIV), such as hairy leukoplakia and central nervous system lymphomas. EBV infects the B cells and epithelial cells of the immune system. Once the initial lytic infection of the virus is controlled, EBV remains latent in the individual's B cells and accompanies the individual throughout his or her life due to its complex life cycle, which includes alternating latent and lytic phases.

[0109] "Symptoms of EBV infection" include the presence of acute infectious mononucleosis (AIM, also known as glandular fever) and / or EBV-associated cancers. "EBV-associated cancers" refer to cancers that are caused and / or exacerbated at least in part by EBV infection, such as Hodgkin's lymphoma, Burkitt's lymphoma, nasopharyngeal carcinoma, cervical cancer, hairy leukoplakia, and central nervous system lymphomas.

[0110] The terms "antigen," "immunogen," "antigenic," "immunogenic," "antigenic activity," and "immunologically active" when referring to molecules refer to any substance capable of inducing a specific humoral and / or cell-mediated immune response. In certain embodiments, an antigen comprises at least a portion or an extracellular domain.

[0111] "EBV antigens" refer to antigens from EBV, such as "gB, gH, gL and gp350 / 220" and tumor-associated EBV antigens.

[0112] The term "EBV envelope glycoprotein" includes gp350, gB, gp42, gH, gL, gM, gN, BMRF2, BDLF2, BDLF3, BILF1, BILF2 and BARF1. The term "T cell antigen" refers to EBNA1, EBNA2, EBNA3a, EBNA3b, EBNA3c, EBNA-leader protein and LMP2.

[0113] The term "gp350 / 220" is the major EBV envelope protein. The interaction between EBV gp350 / 220 and complement receptor type 2 (CR2) CD21 and / or (CR1) CD35 on B cells is required for cell attachment and initiation of latent infection (SEQ ID NO: 1)

[0114] The term "gH" refers to the glycoprotein gp85 precursor of human herpesvirus 4 and is exemplified by SEQ ID NO: 2, NCBI reference sequence: YP_401700.1.

[0115] The terms "gL" and "BKRF2" are used interchangeably and are exemplified by SEQ ID NO: 3, NCBI reference sequence: YP_001129472.1.

[0116] The term "BZLF1-BRLF1 fusion" refers to the transcriptional activator of the EBV early gene, and is exemplified by SEQ ID NO:4.

[0117] "EBNA-3A" is exemplified by SEQ ID NO: 5, NCBI reference sequence: YP_401677.1.

[0118] "Tumor-associated EBV antigens" are EBV antigens associated with tumors in subjects infected with EBV. Exemplary tumor-associated EBV antigens include EBNA1, LMP1, LMP2, and BARF1, which are described in the following literature: Lin et al. "CD4 andCD8 T cell responses to tumor-associated Epstein-Barr virus antigens in nasopharyngeal carcinoma patients." Cancer Immunol Immunother. 2008 July; 57(7):963-75; Kohrt et al. "Dynamic CD8 T cell responses to tumor-associated Epstein-Barr virus antigens in patients with Epstein-Barr virus-negative Hodgkin's disease," Oncol Res. 2009; 18(5-6):287-92; Parmita et al., "Humoral immune responses to Epstein-Barr virus encoded tumor associated proteins and their putativeextracellular domains in nasopharyngeal carcinoma patients and regional controls," J Med Virol. 2011 Apr;83(4):665-78.

[0119] "Adjuvant" means a vehicle that enhances antigenicity. Adjuvants may include: (1) suspensions of minerals (alum, aluminum hydroxide, and / or phosphates) onto which the antigen is adsorbed; (2) water-in-oil emulsions, in which a solution of the antigen is emulsified in mineral oil (Freund's incomplete adjuvant), sometimes containing killed mycobacteria (Freund's complete adjuvant) to further enhance antigenicity by inhibiting antigen degradation and / or causing macrophage influx; (3) immunostimulatory substances, including but not limited to oligonucleotides, such as, for example, those including CpG motifs, which may also be used as adjuvants (see, e.g., U.S. Pat. No. 6,194,388; and U.S. Pat. No. 6,207,646); and (4) purified or recombinant proteins, such as co-stimulatory molecules (e.g., B7-1, ICAM-1, LFA-3, and GM-CSF).

[0120] As used herein, "affecting an immune response" includes the development of a humoral and / or cellular immune response in a subject to a recombinant MVA or VRP of the invention and / or a protein and / or polypeptide produced by a composition and / or vaccine comprising a recombinant MVA and VRP. A "humoral" immune response, as the term is well known in the art, refers to an immune response involving antibodies, while a "cellular" immune response, as the term is well known in the art, refers to an immune response involving T lymphocytes and other white blood cells, particularly an immunogen-specific response caused by HLA-restricted cytolytic T cells, or "CTLs." A cellular immune response occurs when a processed immunogen (i.e., a peptide fragment) is bound to a major histocompatibility complex.

[0121] As used herein, the term "alphavirus" has the conventional meaning in the art and includes various species of Venezuelan equine encephalitis virus (VEEV), Western equine encephalitis virus (WEEV) and Eastern equine encephalitis virus (EEEV). As used herein, "equine encephalitis virus (EEV)" includes VEEV, WEEV and EEEV and strains and isolates thereof.

[0122] As used herein, the terms "expression", "expression", "expression", etc. are used interchangeably to refer to transcription only and both transcription and translation of a sequence of interest. Thus, when referring to the expression of a nucleotide sequence in the form of DNA, the product produced by such expression may be either RNA (produced solely by transcription of the sequence to be expressed) or a polypeptide sequence (produced by both transcription and translation of the sequence to be expressed). Thus, the term "expression" also includes the possibility that both RNA and polypeptide products are produced by the expression and remain together in the same shared environment. This is the case, for example, where mRNA is translated into a polypeptide product and still exists.

[0123] As used herein, the term "expression cassette" is defined as a portion of a vector or recombinant virus typically used for cloning and / or transformation. An expression cassette typically consists of a) one or more coding sequences (e.g., open reading frames (ORFs), genes, nucleic acids encoding proteins and / or antigens) and b) sequences that control the expression of the one or more coding sequences (e.g., promoters). In addition, an expression cassette may include a 3' untranslated region (e.g., a transcription terminator, such as a vaccinia transcription terminator). "Expression cassette" may be used interchangeably with the term "transcription unit".

[0124] A "formulation" refers to a composition containing an active drug or biological ingredient (e.g., a recombinant MVA of the invention) and one or more additional components. The term "formulation" is used interchangeably herein with the terms "pharmaceutical composition," "vaccine composition," and "vaccine formulation." A formulation can be liquid or solid (e.g., lyophilized).

[0125] The term "gene" is widely used to refer to any polynucleotide fragment associated with a biological function. Therefore, a gene includes introns and exons in a genomic sequence, or only includes a coding sequence in a cDNA or viral RNA and / or a regulatory sequence required for its expression. For example, a gene also refers to a nucleic acid fragment that expresses mRNA or functional RNA or encodes a specific protein, and it includes a regulatory sequence.

[0126] As used herein, a "heterologous" gene, nucleic acid, antigen or protein is understood to be a nucleic acid or amino acid sequence that is not present in the wild-type poxvirus genome (e.g., MVA or MVA-BN). It is understood by those skilled in the art that a "heterologous gene", when present in a poxvirus, such as MVA or MVA-BN, will be incorporated into the poxvirus genome in such a way that, after administration of the recombinant poxvirus to a host cell, it is expressed as the corresponding heterologous gene product, i.e., a "heterologous antigen" and / or a "heterologous protein". Expression is generally achieved by operably linking the heterologous gene to a regulatory element that allows expression in poxvirus-infected cells. Preferably, the regulatory element comprises a natural or synthetic poxvirus promoter.

[0127] The term "immunogenic composition" or "immunological composition" encompasses compositions that elicit an immune response against an antigen of interest expressed from an MVA. The term "vaccine or vaccine composition" encompasses any composition that induces a protective immune response against an antigen of interest or effectively protects against an antigen of interest, such as eliciting a protective immune response against an antigen or providing effective protection against an antigen expressed from an MVA vector after administration or injection into an animal or human. The composition may be administered alone or may be administered sequentially with other compositions or therapeutic compositions to provide a combination composition, a mixture of two or more (preferably three, four, five or six) compositions, or a multivalent mixture.

[0128] The terms "nucleic acid", "nucleotide sequence", "nucleic acid sequence" and "polynucleotide" are used interchangeably and refer to linear or branched, single-stranded or double-stranded RNA or DNA, or their hybrids. The term also encompasses RNA / DNA hybrids. The following are non-limiting examples of polynucleotides: genes or gene fragments, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. Polynucleotides may include modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracil, other sugars and linking groups (such as fluororibose and thiolates), and nucleotide branches. The nucleotide sequence may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications included in this definition are capping, substitution of one or more naturally occurring nucleotides with analogs, and introduction of means for attaching polynucleotides to proteins, metal ions, labeling components, other polynucleotides or solid supports. Polynucleotides may be obtained by chemical synthesis or derived from microorganisms.

[0129] The term "open reading frame" (ORF) refers to a nucleotide sequence that can be translated into amino acids. Typically, such an ORF contains a start codon, and the subsequent region is usually a multiple of 3 nucleotides in length, but does not contain a stop codon (TAG, TAA, TGA, UAG, UAA or UGA) in a given reading frame. Typically, ORFs are naturally occurring or artificially constructed, i.e., by means of gene technology. ORFs encode a protein in which the amino acids that can be translated form a peptide linking chain. As used herein, the term "essential ORF" means that when, for example, MVA is partially or completely deleted experimentally, MVA virus replication, growth, or replication and growth are reduced (for example, the ORF in the mutant is at least reduced by 15 times compared to the non-deleted MVA). Methods for determining MVA virus replication and virus growth are well known to those skilled in the art. For example, methods are described in Vaccinia Virus and Poxvirology, Methods and Protocols, Volume 269, Stuart N. Isaacs, ed. (Humana Press (2004), see, e.g., Chapter 8, Growing Poxviruses and determining Virus Titer, Kotwaland Abrahams). Viral growth rate of MVA can be determined by GFP fluorescence, as described, e.g., in Orubu et al. (2012) PLOS One 7: e40167, using, e.g., CEF cells, or as described in Hornemann et al. (2003), Journal of Virology 77: 8394-8407.

[0130] As used herein, "operably linked" means that the components described are related, allowing them to function in their intended manner, such as a promoter that transcribes a nucleic acid to be expressed. A first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if the promoter is placed in a position to direct transcription of the coding sequence. In general, operably linked DNA sequences are contiguous and, where necessary, join two protein coding regions, in the same reading frame.

[0131] "Sequence homology or identity percentage (%)" for nucleic acid sequences described herein is defined as the percentage of nucleotides identical to the nucleotides in the reference sequence (i.e., the nucleic acid sequence from which it is derived) in the candidate sequence after aligning the sequences and introducing spaces (if necessary) to achieve the maximum percentage of sequence identity, and without considering any conservative substitutions as part of the sequence identity. The comparison for determining nucleotide sequence identity or homology percentage can be achieved in a variety of ways within the skill of the art, for example, using publicly available computer software such as BLAST, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine the appropriate parameters for measuring the comparison, including any algorithm required for achieving the maximum comparison over the full length of the compared sequence.

[0132] For example, Smith and Waterman, (1981), Advances in Applied Mathematics 2: 482-489 local homology algorithm provides suitable comparison of nucleotide sequences. This algorithm can be developed by using by Dayhoff, Atlas of Protein Sequences and Structure, MO Dayhoff, 5th Supplement 3: 353-358, National Biomedical Research Foundation, Washington, DC, USA, and by Gribskov (1986), Nucl. Acids Res. 14 (6): 6745-6763 standardized scoring matrix and applied to amino acid sequences. An exemplary implementation of this algorithm for determining sequence identity percentage is provided by the genetics computer group (Madison, Wis.) in the "BestFit" practical application program. The default parameters of this method are described in Wisconsin Sequence Analysis Package Program Manual, 8th Edition (1995) (available from Genetics Computer Group, Madison, Wis.). A preferred method for establishing percent identity in the context of the present invention is to use the MPSRCH program package, copyrighted by the University of Edinburgh, developed by John F.Collins and Shane S.Sturrok and distributed by IntelliGenetics, Inc. (Mountain View, Calif). From this package, the Smith-Waterman algorithm can be used, with default parameters for the score table (e.g., a gap open penalty of 12, a gap extension penalty of one and a gap of six). From the generated data, the "Match" value reflects the "sequence identity". This also applies to "percent amino acid identity (%)", but with necessary modifications. Other suitable programs for calculating percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST using default parameters. For example, BLASTN and BLASTP can be used with the following default parameters: genetic code = standard; filter = none; strands = two; cutoff = 60; expectation = 10; matrix = BLOSUM62; description = 50 sequences; sort by = high score; databases = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translation + Swiss protein + Spupdate + PIR.Details of these programs can be found at the following website: http: / / http: / / blast.ncbi.nlm.nih.gov / .

[0133] The terms "drug," "pharmaceutical composition," and "medicament" are used interchangeably herein to refer to a substance and / or combination of substances used to prevent or treat a disease.

[0134] "Pharmaceutically acceptable" means that the carrier or excipient, at the dosages and concentrations employed, does not cause any undesirable or harmful effects in the subject to which it is administered.

[0135] "Pharmaceutically acceptable carriers" are described in, for example, Remington's Pharmaceutical Sciences, by EW Martin, Mack Publishing Co., Easton, PA, 15th edition (1975); Remington's Pharmaceutical Sciences, 18th edition, A. R. Gennaro, ed., Mack Publishing Company (1990); Pharmaceutical Formulation Development of Peptides and Proteins, S. Frokjaer and L. Hovgaard, ed., Taylor & Francis

[2000] ; and Handbook of Pharmaceutical Excipients, 3rd edition, A. Kibbe, ed., Pharmaceutical Press (2000). They describe compositions and formulations using conventional pharmaceutically acceptable carriers suitable for administering the carriers and compositions disclosed herein. In general, the nature of the carrier used depends on the specific mode of administration employed. For example, parenteral preparations generally include injectable fluids as vehicles, and the injectable fluids include pharmaceutically and physiologically acceptable fluids, such as water, physiological saline, balanced salt solutions, aqueous glucose solutions, glycerol, etc. For solid compositions (such as powders, pills, tablets or capsules), conventional nontoxic solid carriers include, for example, pharmaceutical grade mannitol, lactose, starch or magnesium stearate. Pharmaceutical compositions may also contain a small amount of nontoxic auxiliary substances, such as wetting agents or emulsifiers, preservatives, pH buffers, etc., such as, for example, sodium acetate or sorbitol monolaurate.

[0136] As used herein, "prevent," "preventing," or "prophylax" a disease or infection means preventing such a disease from occurring in a subject (eg, a human or an animal).

[0137] The term "prime-boost vaccination" refers to a vaccination strategy that uses a first prime injection of a vaccine targeting a specific antigen, followed by one or more booster injections of the same vaccine at intervals. Prime-boost vaccination can be homologous or heterologous. Homologous prime-boost vaccination uses a vaccine that contains the same immunogen and carrier for the primary injection and one or more booster injections. Heterologous prime-boost vaccination uses a vaccine that contains the same immunogen for the primary injection and one or more booster injections but different carriers for the primary injection and one or more booster injections. For example, homologous prime-boost vaccination can use a recombinant MVA vector containing the same nucleic acid for the primary injection and one or more booster injections, and the nucleic acid expresses an alphavirus antigen. In contrast, heterologous prime-boost vaccination can use a recombinant MVA vector containing a nucleic acid expressing an alphavirus protein for the primary injection, and another recombinant MVA vector expressing a second alphavirus protein not included in the primary injection, and vice versa. Heterologous prime-boost vaccination also encompasses various combinations, such as, for example, the use of a plasmid encoding an immunogen in the prime injection and a recombinant MVA encoding the same immunogen in one or more booster injections, or the use of a recombinant protein immunogen in the prime injection and a recombinant MVA vector encoding the same protein immunogen in one or more booster injections.

[0138] As used herein, the term "promoter" refers to a regulatory region of a nucleic acid (usually DNA) located upstream of a nucleic acid sequence to be expressed, which contains specific DNA sequence elements that can be recognized and bound by, for example, protein transcription factors and polymerases responsible for synthesizing RNA from the coding region of the gene being promoted. Since the promoter is usually adjacent to the gene in question, the position in the promoter is specified relative to the transcription start site, and DNA transcription is carried out for a specific gene from the site (i.e., the upstream position is a negative number counting down from -1, for example -100 is the position 100 base pairs upstream). Therefore, the promoter sequence may include nucleotides up to position -1. However, the nucleotides from position +1 are not part of the promoter, i.e., it must be noted in this regard that the translation start codon (ATG or AUG) is not part of the promoter. Therefore, SEQ ID NO: 7 or 8 is a polynucleotide comprising a promoter of the present invention. As used herein, "natural poxvirus promoter" refers to an endogenous promoter of a poxvirus genome. "Synthetic poxvirus promoter" means a recombinant engineered promoter that directs transcription of a nucleic acid to be expressed by a poxvirus (e.g., MVA in CEF cells). The term "26S promoter" is well known to those skilled in the art and refers to the subgenomic promoter of the 26S RNA of the nail virus, which is usually contained in a single open reading frame (e.g., the open reading frame of capsid-E3-E2-6K-E1 of VEEV). The mRNA encoding the structural proteins of EEV (e.g., VEEV) is usually transcribed from the replication intermediate and the 26S subgenomic RNA promoter.

[0139] The terms "protein", "peptide", "polypeptide" and "polypeptide fragment" are used interchangeably herein to refer to polymers of amino acid residues of any length. The polymer may be linear or branched, may contain modified amino acids or amino acid analogs, and may be interrupted by chemical moieties other than amino acids. These terms also encompass amino acid polymers that have been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification (such as conjugation with a labeling component or a biologically active component).

[0140] When the term "recombinant" is applied to nucleic acids, vectors (e.g., MVA), etc., it refers to nucleic acids, vectors, or nucleic acids made by the artificial combination of two or more originally heterologous nucleic acid sequence segments, or nucleic acids, vectors, or nucleic acids, vectors, or nucleic acids comprising such artificial combinations of two or more originally heterologous nucleic acid sequence segments. Artificial combination is most commonly accomplished by artificial manipulation of isolated nucleic acid segments using mature genetic engineering techniques. In general, "recombinant" MVA as described herein refers to MVA produced by standard genetic engineering methods, that is, the MVA of the present invention is therefore genetically engineered or genetically modified MVA. The term "recombinant MVA" therefore includes recombinant nucleic acids having stable integration in its genome, preferably MVA (e.g., MVA-BN) in the form of transcription units. The transcription unit may include a promoter, an enhancer, a terminator, and / or a silencer. The recombinant MVA of the present invention can express heterologous antigenic determinants, polypeptides, or proteins (antigens) after inducing regulatory elements.

[0141] As used herein, the term "protective immunity" or "protective immune response" means that a vaccinated subject is able to control infection with the pathogen against which the vaccination was completed. Typically, subjects who develop a "protective immune response" will only develop mild to moderate clinical symptoms or even no symptoms. In the absence of countermeasures, the infection is expected to be fatal, but subjects with a "protective immune response" or "protective immunity" to a pathogen will not die from infection with the pathogen.

[0142] As used herein, the term "reference sample" refers to a sample that is analyzed in substantially the same manner as a sample of interest and whose information is compared to that of the sample of interest. Thus, the reference sample provides a standard that allows the information obtained from the sample of interest to be evaluated. A reference sample may be identical to a sample of interest except for one component that is exchanged, missing, or added.

[0143] The term "structural proteins" of EEV refers to structural proteins / polyproteins encoded by RNA of EEV (e.g., any of WEEV, VEEV, or EEEV as described herein). Structural proteins are usually produced by viruses and are five proteins, namely the structural polyproteins of C, E3, E2, 6k, and E1, and are usually expressed in the literature as C-E3-E2-6k-E1. E3 and 6k are also described as membrane translocation / transport signals of two glycoproteins E2 and E1. As used herein, the nucleotide sequence encoding "structural proteins" means a nucleotide sequence encoding a protein required for encapsidation (e.g., packaging) of the viral genome, and including capsid proteins, E1 glycoproteins, and E2 glycoproteins. The "structural polyprotein" of EEV refers to the polyprotein C-E3-E2-6k-E1 of EEV.

[0144] The term "transcription level" or "protein level" as used herein in relation to a particular promoter refers to the amount of a gene / nucleic acid product present in vivo or in a sample at a certain point in time. Transcription or protein levels (e.g., the amount of protein transcribed as a nucleic acid of mRNA or translated from mRNA) can be determined, measured or quantified, for example, by means of mRNA or protein expressed by a gene / polynucleotide, such as encoded by a recombinant MVA of the present invention. Gene expression can result in the production of a protein, by transcription of the gene by RNA polymerase to produce a messenger RNA (mRNA) containing the same protein coding information, and translation of the mRNA by ribosomes to produce the protein. The term "transcribed" or "transcription" refers to the process by which the DNA sequence of a gene is copied into mRNA by RNA polymerase using DNA as a template. The term "translated" or "translation" refers to the process by which a protein is synthesized using the information contained in mRNA as a blueprint. For example, the amount of mRNA or protein of interest present in the sample can be standardized with the total amount of gene products (mRNA or total protein) of the same class in the same sample or reference sample (e.g., taken out from the same sample at the same time) to quantify transcription or protein levels. Transcription can be measured or detected by any method known in the art, for example, for indirect detection and measurement of the gene product of interest, which usually works via combining the gene product of interest with one or more different molecules or detection means (e.g., primers, probes, antibodies, protein scaffolds) for the gene product of interest. Such methods include, for example, RT-PCR and / or quantitative PCR. The determination of protein levels can be measured or detected by any means known to those skilled in the art, such as Western blotting, ELISA or mass spectrometry.

[0145] As used herein, "transcription terminator" consists of a DNA sequence that participates in the specific termination of RNA transcripts by RNA polymerase. Vaccinia virus containing MVA RNA polymerase terminates transcription downstream of an RNA signal (UUUUUNU, TTTTTNT or T5NT on the DNA level) in nascent RNA (Earl et al. (1990), J. Virol. 64: 2448-2451). "Transcription terminator" is sometimes referred to as "termination signal" in the literature and is therefore used interchangeably.

[0146] As used herein, "treat," "treating," or "treatment" of a disease means preventing, alleviating, ameliorating, partially or completely resolving, or curing a disease, such as a disease caused by EEV. Treatment may be one or more of: lessening the severity of the disease, limiting or preventing the development of symptoms characteristic of the disease being treated, inhibiting the worsening of symptoms characteristic of the disease being treated, limiting or preventing the recurrence of the disease in a subject previously suffering from the disease, and limiting or preventing the recurrence of symptoms in a subject.

[0147] As used herein, "trivalent" in combination with a vaccine or recombinant MVA means that the vaccine or recombinant MVA has a valency against three different viruses and produces a protective immune response against antigens (e.g., structural proteins or structural polyproteins) of those different viruses. Thus, in the context of the trivalent MVA vaccine of the present invention, trivalent means a valency against three different viruses, the antigens of which are encoded by the MVA vaccine or a vaccine comprising a recombinant MVA expressing nucleic acids encoding antigens (e.g., structural proteins or structural polyproteins of VEEV, WEEV, and EEEV). Another example of trivalent (also encompassed in the meaning of trivalent) is that the three different viruses are different strains, for example, in addition to VEEV or EEEV strains, there are two WEEV strains, such as, for example, 71V-1658 and Fleming. In the latter case, the recombinant MVA of the present invention, for example, comprises nucleotide sequences encoding proteins (e.g., structural proteins, structural polyproteins, envelope proteins) of WEEV 71V-1658, WEEV Fleming, and EEEV strains (e.g., EEEV V105-00210). In contrast, "monovalent" means that the vaccine or recombinant MVA has titer against only one virus of a particular species, such as only VEEV, only WEEV or only EEEV, and produces a protective immune response against only one structural protein or structural polyprotein of one virus. However, it does not exclude the production of a protective immune response against several closely related viral subtypes. Thus, "bivalent" means that the vaccine or recombinant MVA has titer against two viruses.

[0148] "Vector" refers to a recombinant DNA or RNA plasmid or virus containing a heterologous polynucleotide to be delivered to a target cell in vitro or in vivo. The heterologous polynucleotide may contain a sequence of interest for prophylactic or therapeutic purposes, and may optionally be in the form of an expression cassette. As used herein, a vector need not be able to replicate in the final target cell or subject. The term includes cloning vectors and viral vectors.

[0149] As used in the context of the present invention, the term "viral replicon" is used to refer to RNA or DNA comprising portions of the 49S viral genomic RNA that are essential for transcription and for cytoplasmic amplification of transport RNA and for subgenomic RNA expression of heterologous nucleic acid sequences. Thus, the replicon encodes and expresses viral nonstructural proteins necessary for cytoplasmic amplification of viral RNA.

[0150] In the context of the present invention, the term "virus" or "recombinant virus" refers to an infectious or non-infectious virus comprising a viral genome. In this case, the nucleic acids, promoters, recombinant proteins and / or expression cassettes mentioned herein are part of the viral genome of the corresponding recombinant virus. The recombinant viral genome is packaged, and the recombinant virus obtained can be used to infect cells and cell lines, in particular for infecting living animals including humans.

[0151] The term "TCID 50 TCID is the abbreviation for "tissue culture infectious dose", which refers to the amount of pathogen that produces pathological changes in 50% of the inoculated cell culture. 50 / ml. Used to determine TCID 50 The method is well known to the person skilled in the art. It is described, for example, in Example 2 of WO 03 / 053463.

[0152] The term "subject" as used herein is a living multicellular vertebrate, including, for example, humans, non-human mammals, and (non-human) primates. The term "subject" can be used interchangeably with the term "animal".

[0153] Self-amplifying RNA

[0154] There are currently two different types of synthetic RNA vaccines: conventional mRNA and self-amplifying RNA (saRNA). Multiple preclinical and clinical trials have studied the use of conventional mRNA strategies (also known as non-replicating or non-amplifying mRNA) for infectious diseases and cancer. In vitro transcribed mRNAs encoding viral antigens have been explored as vaccines, while mRNAs encoding therapeutic proteins (such as antibodies or immunomodulators) have been considered for immunotherapy. The incorporation of chemically modified nucleotides, sequence optimization, and different purification strategies can improve the efficiency of mRNA translation and reduce intrinsic immunogenicity. However, antigen expression is proportional to the number of conventional mRNA transcripts successfully delivered during vaccination. Therefore, to achieve sufficient expression for the purpose of protection or immunomodulation, large doses or repeated administration may be required. saRNA vaccines are genetically engineered replicons derived from self-replicating single-stranded RNA viruses that solve this limitation. They can be delivered as viral replicon particles (VRPs), in which saRNA is packaged into viral particles, or as fully synthesized saRNA produced after in vitro transcription. In order to produce replication-defective VRPs, envelope proteins are provided in trans form as defective auxiliary constructs during the production process. Therefore, the resulting VRP lacks the ability to form infectious virus particles after the first infection, and only RNA can be further amplified. VRP may be derived from positive-sense RNA viruses and negative-sense RNA viruses, but the latter is more complex and reverse genetics is required to rescue VRP. As with gene therapy, there are also some related problems in vaccine development using viral vectors. These problems include the immunogenicity of the vector itself, which can trigger undesirable immune responses and prevent the use of the same vector for subsequent booster administration. Pre-existing immunity to viral vectors may also render the vaccine ineffective. Like live attenuated vaccines, replication-competent alphavirus vectors also pose a threat of viral reactivation. To avoid this, saRNA vaccines can be produced and delivered in a similar manner to conventional mRNA vaccines. Positive-sense alphavirus genomes commonly used in saRNA vaccine design include Venezuelan equine encephalitis virus (VEE), Sindbis virus (SINV) and Semliki forest virus (SFV). The alphavirus replicase gene encodes an RNA-dependent RNA polymerase (RdRP) complex that can amplify synthetic transcripts in situ. Antigens or therapeutic sequences are expressed at high levels as separate entities and no further proteolytic processing of the immunogen is required. Due to its self-replicating activity, saRNA can be delivered at lower concentrations than conventional mRNA vaccines to achieve comparable antigen expression.

[0155] As mentioned above, saRNA constructs have historically been delivered by alpha viruses, such as Venezuelan equine encephalitis virus (VEEV), Semliki Forest virus (SFV), or Sindbis virus. These saRNA constructs contain four non-structural proteins, a subgenomic promoter, and genes of interest (replacing viral structural proteins). By missing viral structural proteins, RNA cannot produce infectious viruses. After the non-structural proteins are delivered to the cytoplasm, RNA-dependent RNA polymerase (RDRP) is formed, which can replicate genomic RNA (entire RNA chain) and subgenomic RNA (gene of interest). Each of the four non-structural proteins plays a role in the formation of RDRP, which is a complex and multi-stage process. This RNA replication results in higher antigen expression than non-replicating mRNA.

[0156] EEV virus, protein and nucleotide sequences

[0157] EEV is an alphavirus belonging to the Togaviridae family. EEV is a small enveloped positive-strand RNA virus well known in the art. The viral nucleocapsid is surrounded by a host-derived lipid membrane, in which the envelope protein trimer of E1 and E2 heterodimers is embedded. The nucleocapsid consists of a capsid protein (C) surrounding a single-stranded RNA genome. The RNA genome (49SRNA) of the EEV virus is about 11-12kb long and contains a 5' cap and a 3' polyadenylated tail, and is translated immediately after entering the cell. The 5' region of the genome encodes four non-structural proteins (NSP1, NSP2, NSP3 and NSP4). The 3' region of the genome encodes five structural proteins (C, E3, E2, 6k, E1), which are expressed in the form of structural polyproteins of 26S subgenomic RNA. The mRNA encoding the structural proteins is transcribed by replication intermediates and the 26S subgenomic promoter. Protease cleavage of the polyprotein produces mature structural proteins C, E3, E2, 6k, and E1. The nucleocapsid (C) protein has autoproteolytic activity, which cleaves the C protein from the precursor protein shortly after the ribosome passes the junction between the C and E3 protein coding sequences. Subsequently, the envelope glycoproteins E2 and E1 are derived by proteolytic cleavage and form heterodimers. E2 initially appears in infected cells in the form of the precursor pE2, which is composed of E3 and E2. After glycosylation and passage through the endoplasmic reticulum and Golgi apparatus, E3 is cleaved from E2 at the cleavage site by a furin-like protease activity.

[0158] Live attenuated vaccines are already used in the U.S. military and among laboratory workers, and formalin-killed vaccines are available for use in horses.

[0159] One such live attenuated vaccine is TC-83, originally developed by the U.S. Army for vaccine use (Pittman et al., 1996). TC-83 was generated by serial passage of the Trinidad Donkey VEEV strain in guinea pig heart cells (Alevizatos et al., 1967). Point mutations in the E2 and 5′ untranslated regions are responsible for the attenuated phenotype of TC-83 (Kinney et al., 1993). TC-83 is considered effective in preventing human disease, but 15–37.5% of vaccine recipients develop febrile symptoms (Berge et al., 1961; McKinney et al., 1963; Alevizatos et al., 1967; Pittman et al., 1996), and only 82% of vaccine recipients seroconvert after vaccination. The probability of maintaining a plaque reduction neutralization titer of ≥1:20 for 5-8 years is 60%. Because TC-83 is available only as a research vaccine and in a limited population, additional studies to evaluate the immunogenicity of the vaccine over time in humans were not possible. Of interest in this study, C57BL / 6 (WT) mice developed disseminated brain infection with high titers but no mortality after intranasal infection with the VEEV-TC-83 vaccine strain (Hart et al., 1997; Steele et al., 1998; Julander et al., 2008; Taylor et al., 2012).

[0160] It is to be understood that any combination of any of the above-described WEEVs, EEEVs and / or VEEVs is also contemplated in any of the embodiments as described herein.

[0161] Modified vaccinia virus Ankara (MVA)

[0162] The artificially attenuated modified vaccinia virus Ankara ("MVA") was generated by more than 570 serial passages of the chorioallantoic vaccinia virus Ankara (CVA) strain in chicken embryo fibroblasts (for review, see Mayr, A., et al. Infection 3, 6-14 (1975)). As a result of these long passages, the genome of the resulting MVA virus lacks approximately 27 kilobases of genomic sequence compared to its predecessor, CVA, and has therefore been described as a host cell that highly restricts replication to avian cells (Meyer, H. et al., J. Gen. Virol. 72, 1031-1038 (1991), Meisinger et al. J. Gen. Virol 88, 3249-3259 (2007)). The resulting MVA was shown in multiple animal models to be nontoxic compared to the fully replication-competent starting material (Mayr, A. and Danner, K., Dev. Biol. Stand. 41:225-34 (1978)).

[0163] MVA viruses useful in the practice of the present invention may include, but are not limited to, MVA-572 (deposited on January 27, 1994 as ECACC V94012707); MVA-575 (deposited on December 7, 2000 as ECACC V00120707), MVA-I721 (cited in Suter et al., Vaccine 2009), NIH clone 1 (deposited on March 27, 2003 as PTA-5095 deposited) and MVA-BN (deposited with the European Collection of Cell Cultures (ECACC) on August 30, 2000 under the number V00083008).

[0164] More preferably, the MVA used according to the present invention includes MVA-BN and MVA-BN derivatives. MVA-BN has been described in International PCT Publication WO 02 / 042480. As used herein, "MVA-BN derivative" refers to any virus that exhibits substantially the same replication characteristics as MVA-BN but exhibits differences in one or more parts of its genome.

[0165] MVA-BN and MVA-BN derivatives cannot replicate, meaning that they cannot replicate reproductively in vivo and in vitro. More specifically, in vitro, MVA-BN or MVA-BN derivatives have been described as being able to replicate reproductively in chicken embryo fibroblasts (CEF), but not in human keratinocytes HaCat (Boukamp et al. (1988) J. Cell Biol. 106: 761-771), human bone osteosarcoma cell line 143B (ECACC deposit number 91112502), human embryonic kidney cell line 293 (ECACC deposit number 85120602) and human cervical adenocarcinoma cell line HeLa (ATCC deposit number CCL-2). In addition, the viral amplification rate of MVA-BN or MVA-BN derivatives in Hela cells and HaCaT cell lines is at least two times smaller than that of MVA-575, and more preferably three times smaller. Testing and determination of these properties of MVA-BN and MVA-BN derivatives are described in WO 02 / 42480 (US Patent Application No. 2003 / 0206926) and WO 03 / 048184 (US Patent Application No. 2006 / 0159699).

[0166] The term "incapable of reproductive replication" or "incompetent of reproductive replication" in a human cell line in vitro as described in the previous paragraph is described, for example, in WO 02 / 42480, which also teaches how to obtain MVAs having the desired properties as described above. The term applies to viruses having an in vitro viral amplification rate of less than 1 at 4 days post infection using the assay described in WO 02 / 42480 or U.S. Pat. No. 6,761,893.

[0167] The amplification or replication of viruses in in vitro human cell lines as described in the previous paragraphs is usually expressed as the ratio of the virus produced by infected cells (output) to the amount of virus originally used to infect cells (input), which is called the "amplification rate". An amplification rate of "1" defines an amplification state in which the amount of virus produced from infected cells is the same as the amount originally used to infect cells, meaning that infected cells allow viral infection and propagation. In contrast, an amplification rate of less than 1, i.e., a reduction in output compared to the input level, indicates a lack of propagation replication, and therefore the virus is weakened.

[0168] Integration of loci into MVA

[0169] The nucleotide sequence encoding one or more proteins can be inserted into any suitable part of the virus or viral vector, in particular, the viral genome of recombinant MVA. The suitable part of recombinant MVA is a non-essential part of the MVA genome. The non-essential part of the MVA genome can be an intergenic region or a known deletion site 1-6 of the MVA genome. Alternatively or in addition, the non-essential part of the recombinant MVA can be a coding region of the MVA genome, which is non-essential for viral growth. However, the insertion site is not limited to these preferred insertion sites in the MVA genome, because within the scope of the present invention, the promoter, expression cassette and / or nucleotides encoding one, two, three or more proteins as described herein can be inserted into any position of the viral genome, as long as it is possible to obtain a recombinant that can be amplified and propagated in at least one cell culture system, such as chicken embryo fibroblasts (CEF cells). Preferably, the nucleotide sequence encoding one, two, three or more proteins can be inserted into one or more intergenic regions (IGR) of MVA. The term "intergenic region" preferably refers to those viral genome parts located between two adjacent open reading frames (ORFs) of the MVA viral genome, preferably between two essential ORFs of the MVA viral genome. In certain embodiments, the IGR is selected from IGR 07 / 08, IGR 44 / 45, IGR 64 / 65, IGR 88 / 89, IGR 136 / 137 and IGR 148 / 149. In certain embodiments, less than 5, 4, 3 or 2 IGRs of the recombinant MVA comprise a nucleotide sequence encoding one or more proteins. The number of insertion sites of the MVA comprising a nucleotide sequence encoding one or more proteins can be 1, 2, 3, 4, 5, 6, 7 or more. In certain embodiments, the nucleotide sequence is inserted into 4, 3, 2 or fewer insertion sites. Preferably, two insertion sites are used, preferably IGR 44 / 45 and IGR 88 / 89. In certain embodiments, three insertion sites are used. Preferably, the recombinant MVA comprises at least 2, 3, 4, 5, 6 or 7 genes inserted into 2 or 3 insertion sites.

[0170] Additionally or alternatively, the nucleotide sequence may be inserted into one or more known deletion sites, i.e., deletion sites I, II, III, IV, V or VI of the MVA genome. The term "known deletion site" refers to the portion of the MVA genome that has been deleted by serial passage on CEF cells characterized at the 516th generation relative to the genome of the parental virus from which the MVA was derived, in particular the parental chorioallantoic vaccinia virus Ankara (CVA), e.g., as described in Meisinger-Henschel et al. (2007), Journal of General Virology 88: 3249-3259. In certain embodiments, less than 5, 4, 3 or 2 known deletion sites of the recombinant MVA comprise nucleotide sequences encoding one, two, three or more proteins as described herein.

[0171] The recombinant MVA virus provided herein can be produced by conventional methods known in the art. The method of obtaining recombinant MVA or inserting an exogenous coding sequence into the MVA genome is well known to those skilled in the art. For example, standard molecular biology techniques, such as DNA cloning, DNA and RNA separation, Western blot analysis, RT-PCR and PCR amplification techniques are described in Molecular Cloning, A laboratory Manual 2nd edition (J. Sambrook et al., Cold Spring Harbor Laboratory Press (1989)), and the technology for handling and manipulating viruses is described in Virology Methods Manual (BWJ Mahy et al. (ed.), Academic Press (1996)). Likewise, techniques and expertise for the handling, manipulation and genetic engineering of MVA are described in Molecular Virology: A Practical Approach (AJ Davison and RM Elliott (eds.), The Practical Approach Series, IRL Press at Oxford University Press, Oxford, UK (1993) (see, e.g., Chapter 9: Expression of genes by Vaccinia virus vectors)) and Current Protocols in Molecular Biology (John Wiley & Son, Inc. (1998) (see, e.g., Chapter 16, Part IV: "Expression of proteins in mammalian cells using vaccinia viral vectors")).

[0172] For the production of various recombinant MVA viruses disclosed herein, different methods known to those skilled in the art can be applied. The DNA sequence to be inserted into the virus can be placed in an E. coli plasmid construct, into which DNA homologous to the DNA segment of MVA is inserted. In addition, the DNA sequence to be inserted can be connected to a promoter. The promoter-gene linkage can be positioned in the plasmid construct so that the two ends of the promoter-gene linkage are flanked by DNA homologous to the DNA sequence, which is flanked by the MVA DNA region containing the non-essential locus. The resulting plasmid construct can be amplified and isolated by propagation in E. coli. The isolated plasmid containing the DNA gene sequence to be inserted can be transfected into, for example, a chicken embryo fibroblast (CEF) cell culture, and the culture is infected with MVA at the same time. The recombination between the homologous MVA DNA in the plasmid and the viral genome can produce MVA modified due to the presence of exogenous DNA sequences, respectively.

[0173] According to a preferred embodiment, cells of a suitable cell culture, such as CEF cells, can be infected with MVA. The infected cells can then be transfected with a first plasmid vector comprising one or more exogenous or heterologous genes, preferably under the transcriptional control of an expression control element. As described above, the plasmid vector also comprises a sequence capable of directing the insertion of an exogenous sequence into a selected portion of the MVA genome. Optionally, the plasmid vector also contains a box comprising a marker and / or selection gene operably linked to a poxvirus promoter. Suitable markers or selection genes are, for example, genes encoding green fluorescent protein, β-galactosidase, neomycin-phosphoribosyltransferase or other markers. The use of a selection or marker box simplifies the identification and separation of the recombinant MVA produced.

[0174] However, recombinant MVA can also be identified by PCR technology. Subsequently, another cell can be infected with the recombinant MVA obtained as described above and transfected with a second vector containing one or more second exogenous or heterologous genes. If this gene is introduced into a different insertion site of the MVA genome, the second vector also differs in the MVA homologous sequence that guides the integration of the one or more second exogenous genes into the MVA genome. After homologous recombination occurs, recombinant viruses containing two or more foreign or heterologous genes can be isolated. For the introduction of additional exogenous genes into the recombinant virus, the steps of infection and transfection can be repeated by infecting with the recombinant virus isolated in the previous step and transfecting with another vector containing another one or more exogenous genes.

[0175] Alternatively, the infection and transfection steps described above are interchangeable, i.e., suitable cells can be first transfected with a plasmid vector containing the foreign gene, and then infected with MVA. As another alternative, each foreign gene can also be introduced into a different virus, cells can be co-infected with all the recombinant viruses obtained, and recombinants including all the foreign genes can be screened. A third alternative is to connect the DNA genome and the foreign sequence in vitro and use a helper virus to reconstruct the recombinant vaccinia virus DNA genome. A fourth alternative is to perform homologous recombination between a vaccinia virus genome cloned as a bacterial artificial chromosome (BAC) and a linear foreign sequence in Escherichia coli or another bacterial species, wherein the linear foreign sequence is flanked by a DNA sequence homologous to the sequence of the desired integration site in the flanking vaccinia virus genome.

[0176] Expression of antigenic proteins

[0177] In certain embodiments, the expression of one, more or all nucleotide sequences encoding proteins (disease associated antigens) of, for example, EBV viruses as described herein is under the control of one or more poxvirus promoters. The promoter according to the present invention can be any synthetic or natural poxvirus promoter. In certain embodiments, the poxvirus promoter is a Pr13.5 promoter, a PrHyb promoter, a Pr7.5 promoter, a hybrid early / late promoter, a PrS promoter, a PrS5E promoter, a Pr1328, a PrH5m, a synthetic or natural early or late promoter, or a vaccinia virus ATI promoter. Suitable promoters are further described in WO 2010 / 060632, WO 2010 / 102822, WO 2013 / 189611, and WO 2014 / 063832.

[0178] The nucleic acid encoding the disease-associated antigen can be operably connected to an expression control sequence. The expression control sequence operably connected to the encoding sequence is engaged so that the expression of the encoding sequence is realized under conditions compatible with the expression control sequence. The expression control sequence includes but is not limited to the start codon at the beginning of the open reading frame of a suitable promoter, enhancer, transcription terminator, coded protein, the splicing signal of the intron and the in-frame termination codon. Suitable promoters include, but are not limited to, the SV40 early promoter, the retroviral LTR, the adenovirus major late promoter, the human CMV immediate early I promoter, and various poxvirus promoters, including, but not limited to, the following vaccinia virus or MVA derived promoters: 30K promoter, 13 promoter, sE / L promoter, Pr7.5K, 40K promoter, C1 promoter, PrSynIIm promoter, PrLE1 promoter, PrH5m promoter, PrS promoter, hybrid early / late promoter, PrS5E promoter, PrA5E promoter, and Pr4LS5E promoter; the vaccinia virus ATI promoter, or the following fowlpox derived promoters: Pr7.5K promoter, 13 promoter, 30K promoter, or 40K promoter.

[0179] In certain embodiments, the poxvirus promoter is selected from the group consisting of: PrS promoter (SEQ ID NO:8), Pr1328 (SEQ ID NO:10), PrH5m (SEQ ID NO:9.), and Pr13.5 promoter (SEQ ID NO:7).

[0180] Antigenic determinant / protein

[0181] The term "antigenic determinant" or "antigenic protein" refers to any molecule that stimulates the host immune system to produce an antigen-specific immune response, whether a cellular response or a humoral antibody response. Antigenic determinants may include proteins, polypeptides, antigenic protein fragments, antigens and epitopes that still induce an immune response in the host and form a part of the antigen, homologues or variants of proteins, polypeptides, antigenic protein fragments, antigens and epitopes, including, for example, glycosylated proteins, polypeptides, antigenic protein fragments, antigens and epitopes, and nucleotide sequences encoding such molecules. Therefore, proteins, polypeptides, antigenic protein fragments, antigens and epitopes are not limited to specific natural nucleotide or amino acid sequences, but rather encompass sequences identical to the native sequence and modifications to the native sequence, such as deletions, additions, insertions and substitutions.

[0182] The term "epitope" refers to a site on an antigen to which B cells and / or T cells bind and respond alone or in combination with another protein, such as, for example, a major histocompatibility complex ("MHC") protein or a T cell receptor. An epitope can be formed by adjacent amino acids or by non-adjacent amino acids juxtaposed by secondary and / or tertiary folding of a protein. Epitopes formed by adjacent amino acids are usually retained when exposed to a denaturing solvent, while epitopes formed by tertiary folding are usually lost when treated with a denaturing solvent. An epitope typically comprises at least 5, 6, 7, 8, 9, 10 or more amino acids, but is generally less than 20 amino acids and has a unique spatial conformation. Methods for determining the spatial conformation of an epitope include, for example, X-ray crystallography and two-dimensional nuclear magnetic resonance. See, for example, "Epitope Mapping Protocols" in Methods in Molecular Biology, Vol. 66, Glenn E. Morris, ed. (1996).

[0183] Preferably, a homolog or variant is at least about 50%, at least about 60% or 65%, at least about 70% or 75%, at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88% or 89%, more usually at least about 90%, 91%, 92%, 93% or 94%, and even more usually at least about 95%, 96%, 97%, 98% or 99%, most usually at least about 99% identical at the nucleotide or amino acid sequence level to the referenced protein, polypeptide, antigenic protein fragment, antigen and epitope.

[0184] In some embodiments, the heterologous nucleic acid encodes an antigenic domain or an antigenic protein fragment rather than a whole antigenic protein. These fragments can be any length sufficient to be antigenic or immunogenic. The fragment can be at least 8 amino acids long, preferably 10-20 amino acids, but can be longer, such as, for example, at least 50, 100, 200, 500, 600, 800, 1000, 1200, 1600, 2000 amino acids long, or any length therebetween.

[0185] In some embodiments, at least one nucleic acid fragment encoding an antigenic protein fragment or its immunogenic polypeptide is inserted into a viral vector of the present invention. In another embodiment, about 2-6 different nucleic acids encoding different antigenic proteins are inserted into one or more viral vectors. In some embodiments, multiple immunogenic fragments or subunits of various proteins can be used. For example, different sites from a single protein or different proteins from the same strain or several different epitopes from protein orthologs of different strains can be expressed from a vector.

[0186] Immunogenic compositions and disease-associated antigens

[0187] In one aspect, provided herein are immunogenic compositions comprising a recombinant poxvirus, such as, for example, a modified vaccinia virus Ankara (MVA) comprising a nucleic acid sequence encoding a heterologous disease-associated antigen and a VRP encoding the antigen.

[0188] In certain embodiments, the heterologous disease-associated antigen is an infectious disease antigen or a tumor-associated antigen. In certain embodiments, the heterologous disease-associated antigen is a tumor-associated antigen. In certain embodiments, the tumor-associated antigen is selected from the group consisting of: 5-α-reductase, α-fetoprotein ("AFP"), AM-1, APC, April, B melanoma antigen gene ("BAGE"), β-catenin, Bcl12, bcr-abl, Brachyury, CA-125, caspase-8 ("CASP-8", also known as "FLICE"), cathepsin, CD19, CD20, CD21 / complement receptor 2 ("CR2"), CD22 / BL-CAM, CD23 / F cεRII, CD33, CD35 / complement receptor 1 ("CR1"), CD44 / PGP-1, CD45 / leukocyte common antigen ("LCA"), CD46 / membrane cofactor protein ("MCP"), CD52 / CAMPATH-1, CD55 / decay accelerating factor ("DAF"), CD59 / protectin, CDC27, CDK4, carcinoembryonic antigen ("CEA"), c-myc, cyclooxygenase-2 ("cox-2"), deleted in colorectal cancer gene ("DCC"), DcR3, E6 / E7, CGFR, EMBP, Dna78, farnesyl transferase transferase, fibroblast growth factor 8a ("FGF8a"), fibroblast growth factor 8b ("FGF8b"), FLK-1 / KDR, folate receptor, G250, G melanoma antigen gene family ("GAGE-family"), gastrin 17, gastrin-releasing hormone, ganglioside 2 ("GD2") / ganglioside 3 ("GD3") / ganglioside-monosialyl-2 ("GM2"), gonadotropin-releasing hormone ("GnRH"), UDP-GlcNAc:R1Man(α1-6)R2[GlcNAc:Man(α1-6)]β1,6-N-acetylglucosamine transferase V ("GnT ​​V"), GP1, gp100 / Pme117, gp-100-in4, gp15, gp75 / tyrosine-related protein-1 ("gp75 / TRP-1"), human chorionic gonadotropin ("hCG"), heparanase, Her2 / neu, human mammary tumor virus ("HMTV"), 70-kilodalton heat shock protein ("HSP70"), human telomerase reverse transcriptase ("hTERT"), insulin-like growth factor receptor-1 ("IGFR-1"), interleukin-1 3 receptor ("IL-13R"), inducible nitric oxide synthase ("iNOS"), Ki67, KIAA0205, K-ras, H-ras, N-ras, KSA, LKLR-FUT, melanoma antigen encoding family ("MAGE family", including at least MAGE-1, MAGE-2, MAGE-3 and MAGE-4), mammaglobin, MAP17, Melan-A / melanoma antigen recognized by T cells-1 ("MART-1"), mesothelin, MIC A / B, MT-MMPs, mucin, testis-specific antigen NY-ESO-1, osteonectin, p15, P170 / MDR1, p53, p97 / melanotransferrin, PAI-1, platelet-derived growth factor ("PDGF"), μPA, PRAME, prostate basic protein, progenitor cell line cytokinin, prostate-specific antigen ("PSA"), prostate-specific membrane antigen ("PSMA"), prostatic acid phosphatase ("PAP"), RAG E-1, Rb, RCAS1, SART-1, SSX-family, STAT3, STn, TAG-72, transforming growth factor-alpha ("TGF-α"), transforming growth factor-beta ("TGF-β"), thymosin-beta-15, tumor necrosis factor-alpha ("TNF-α"), TP1, TRP-2, tyrosinase, vascular endothelial growth factor ("VEGF"), ZAG, p16INK4, and glutathione-S-transferase ("GST"). In certain embodiments, the tumor-associated antigen is brachyury. In certain embodiments, the tumor-associated antigen is PSA. In certain embodiments, the tumor-associated antigen is CEA. In certain embodiments, the tumor-associated antigen is MUC-1. In certain embodiments, the tumor-associated antigens are CEA and MUC-1. ,

[0189] In certain embodiments, the heterologous disease-associated antigen is an infectious disease antigen. In certain embodiments, the infectious disease antigen is a viral antigen, a bacterial antigen, a fungal antigen, or a parasitic antigen.

[0190] In certain embodiments, the infectious disease antigen is a viral antigen. In certain embodiments, the viral antigen is derived from a virus selected from the group consisting of adenovirus, arbovirus, astrovirus, coronavirus, coxsackievirus, Crimean-Congo hemorrhagic fever virus, cytomegalovirus ("CMV"), dengue virus, Ebola virus, Epstein-Barr virus ("EBV"), foot-and-mouth disease virus, Guanarito virus, Hendra virus, herpes simplex virus type 1 ("HSV-1"), herpes simplex virus type 2 ("HSV-2"), human herpes virus type 6 ("HHV-6"), human herpes virus type 8 ("HHV-8"), hepatitis A virus ("HAV"), hepatitis B virus ("HBV"), hepatitis C virus ("HCV"), D-type hepatitis virus (“HDV”), hepatitis E virus (“HEV”), human immunodeficiency virus (“HIV”), influenza virus, Japanese encephalitis virus, Junin virus, Lassa virus, Machupo virus, Marburg virus, measles virus, human metapneumovirus, molluscum contagiosum virus, mumps virus, Newcastle disease virus, Nipah virus, norovirus, Norwalk virus, human papillomavirus (“HPV”), parainfluenza virus, parvovirus, poliovirus, rabies virus, respiratory syncytial virus (“RSV”), rhinovirus, rotavirus, rubella virus, Sabia virus, severe acute respiratory syndrome virus (“SARS”), varicella zoster virus, smallpox virus, West Nile virus, and yellow fever virus.

[0191] In certain embodiments, the infectious disease antigen is a bacterial antigen. In certain embodiments, the bacterial antigen is selected from the group consisting of antigens derived from the following bacteria: anthrax Bacillus, pertussis Bordetella, burgdorferi, abortus Brucella, canis Brucella, melioides Brucella, suis Brucella, glanders Burkholderia, pseudomallei Burkholderia, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydia psittaci, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheriae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, enterotoxigenic Escherichia coli, pathogenic Escherichia coli coli) 157:H7, Francisella tularensis, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Leptospira interrogans, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pseudomonas aeruginosa, Rickettsia, Salmonella typhi, Salmonella typhimurium, Shigella sonnei, Staphylococcus urea, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Vibrio cholerae and Yersinia pestis. In certain embodiments, the bacterial antigen is derived from Bacillus anthracis.

[0192] In certain embodiments, the infectious disease antigen is a fungal antigen. In certain embodiments, the fungal antigen is selected from the group consisting of antigens derived from the following fungi: Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus niger, Aspergillus terreus, Blastomyces dermatitidis, Candida albicans, Candida dubliniensis, Candida glabrata, Candida parapsilosis, Candida rugosa, Candida tropicalis, Cryptococcus albicans, Cryptococcus gattii, Cryptococcus laurenii, Cryptococcus neoformans, Histoplasma capsulatum, Microsporum canis, Pneumocystis carinii, Pneumocystis jirovecii, Sporothrix schenckii, Catarum, Tinea barbae, Tinea capitis, Tinea corporis, Tinea corporis cruris, Tinea faciis, Tinea cryptonomica, Tinea nigricans, Tinea versicolor, Trichophyton rubrum, and Trichophyton tonsurans.

[0193] In certain embodiments, the infectious disease antigen is a parasite antigen. In certain embodiments, the parasite antigen is selected from the group consisting of antigens derived from the following parasites: Ascidian species, Babesia species, Raccoon Ascaris, Cryptosporidium species, Cyclospora cayeta, Diphyllobothrium species, Guinea worm, Entamoeba histolytica, Giardia duodenalis, Giardia intestinalis, Giardia lamblia, Leishmania species, Plasmodium falciparum, Schistosoma mansoni, Schistosoma haematobium, Schistosoma japonicum, Taenia species, Toxoplasma gondii, Trichinella spiralis, and Trypanosoma cruzi.

[0194] Epstein-Barr virus (EBV)

[0195] Epstein-Barr virus (EBV; also known as human herpesvirus 4, HHV-4) is a human herpesvirus. The enveloped dsDNA virus is transmitted by the oral route through saliva or genital secretions and can infect epithelial cells and B cells, where the virus enters a two-stage life cycle consisting of a lytic phase and a latent phase, which are coordinated by complex regulation. The lytic phase, when it occurs in young, previously uninfected adolescents, can cause infectious mononucleosis (glandular fever). Infectious mononucleosis is a risk factor for the development of later cancers. EBV has been associated with specific forms of cancer, such as Hodgkin lymphoma, Burkitt lymphoma, gastric cancer, and nasopharyngeal carcinoma. In addition, there is evidence of a link between EBV and autoimmune diseases.

[0196] Methods for producing non-recombinant and recombinant poxviruses

[0197] Methods for obtaining recombinant poxviruses, such as MVA, or for inserting exogenous coding sequences into the genome of poxviruses (e.g., MVA) are well known to those skilled in the art. For example, standard molecular biology techniques, such as methods for DNA cloning, DNA and RNA isolation, Western blot analysis, RT-PCR, and PCR amplification techniques are described in Molecular Cloning, Alaboratory Manual 2nd Edition (J. Sambrook et al., Cold Spring Harbor Laboratory Press (1989)), and techniques for handling and manipulating viruses are described in Virology Methods Manual (BWJ Mahy et al. (eds.), Academic Press (1996)). Similarly, techniques and expertise for the handling, manipulation and genetic engineering of poxviruses are described in Molecular Virology: A Practical Approach (AJ Davison and RM Elliott (eds.), The Practical Approach Series, IRL Press at Oxford University Press, Oxford, UK (1993), see, e.g., Chapter 9: Expression of genes by Vaccinia virus vectors); Current Protocols in Molecular Biology (John Wiley & Son, Inc. (1998), see, e.g., Chapter 16, Section IV: Expression of proteins in mammalian cells using vaccinia viral vector); and Genetic Engineering, Recent Developments in Applications, Apple Academic Press (2011), Dana M. Santos, see, e.g., Chapter 3: Recombinant-mediated Genetic Engineering of a Bacterial Artificial Chromosome Clone of Modified Vaccinia Virus Ankara (MVA)).The construction and isolation of recombinant MVA is also described in Methods and Protocols, Vaccinia Virus and Poxvirology, ISBN 978-1-58829-229-2 (Staib et al.), Humana Press (2004), see e.g. Chapter 7.

[0198] The method for producing and purifying virus-based materials (such as viral vectors and / or viruses) is known to those skilled in the art. The method includes infecting suitable cell culture (for example, chicken embryo fibroblasts (CEF cells) or cell lines, such as cell lines and EB66 cells derived from DF-1, ducks, MDCK, quail or chickens) and subsequently amplifying viruses under suitable conditions well known to those skilled in the art. Although it is preferred to use a method without animal materials (such as cell culture media), serum-free culture conditions (such as culture media) and serum-containing culture methods can be used for virus production. The term "serum-free" culture media refers to any cell culture media that does not contain serum from animal or human sources. As used herein, "animal-free" refers to any compound or compound set (except for the cell or cell line used to produce and purify virus-based materials) that is not produced in the animal cells of an organism or is not produced by the animal cells of an organism. Suitable cell culture media are known to those skilled in the art, and these culture media include salts, vitamins, buffers, energy sources, amino acids and other substances. Examples of culture media suitable for serum-free culture of CEF cells are medium 199 (Morgan, Morton and Parker; Proc Soc. Exp. Biol. Med. 1950 January; 73 (1): 1-8; particularly available from Life Technologies) or VP-SFM (Invitrogen Ltd.), which are preferred. For example, serum-free methods for culturing viruses and amplifying viruses in CEF cells are described in WO 2004 / 022729. The production and purification of viral material upstream and downstream processes are described in WO 2012 / 010280. Further methods suitable for purifying the viruses of the present application are described in WO 03 / 054175, WO 07 / 147528, WO 2008 / 138533, WO 2009 / 100521 and WO 2010 / 130753. Leon et al. described a suitable method for propagating and purifying recombinant poxviruses in duck embryo-derived cells, such as but not limited to EB66 cells (Leon et al. (2016), The EB66 cell line as a valuable cell substrate for MVA-based vaccines production, Vaccine 34:5878-5885).

[0199] Methods for producing saRNA

[0200] Conventional and synthetic saRNA vaccines are produced in essentially the same way. In short, mRNA expression plasmids (pDNA) encoding DNA-dependent RNA polymerase promoters (usually derived from T7, T3 or SP6 phages) and RNA vaccine candidates are designed as templates for in vitro transcription. The flexibility of the gene synthesis platform is a key advantage. For conventional mRNA vaccines, antigenic sequences or immunomodulatory sequences are flanked by 5′ and 3′ untranslated regions (UTRs). The poly (A) tail can be incorporated from the 3' end of the pDNA template or enzymatically added after in vitro transcription. The saRNA vaccine pDNA template contains additional alphavirus replicon genes and conserved sequence elements. Nonstructural proteins 1, 2, 3 and 4 (nsP1-4) are essential for replicon activity because the nonstructural proteins form the RdRP complex. In vitro transcription is typically performed on a linearized pDNA template or a linear DNA fragment, typically using T7 DNA-dependent RNA polymerase, to produce multiple copies of RNA transcripts. The 5' end is capped for efficient translation. This can usually be accomplished by co-transcriptional capping with a synthetic cap analog or by post-transcriptional enzymatic capping. Once the 5' end of the RNA is capped and purified, it can be formulated and delivered. For saRNA, a co-transcriptional capping step with a cap analog is generally preferred because the 5' cap is different from that of regular mRNA.

[0201] The RNA product is then purified, which may include a step to remove in vitro transcription byproducts in the form of double-stranded dsRNA. These byproducts may be removed by, for example, double-stranded specific enzymatic RNases or chromatography using materials with specific dsRNA affinity. Further chromatography or other purification steps may be used to improve the purity and quality of the RNA product, such as affinity purification, filtration. Affinity purification may also include polyA specific resins to enrich for full-length and polyadenylated RNAs and remove incomplete shorter byproducts.

[0202] Vaccines and pharmaceutical compositions

[0203] Since the replication of the recombinant MVA virus described herein is strictly restricted and therefore highly attenuated, the virus is an ideal candidate virus for treating a variety of mammals including humans and even immunocompromised humans. Therefore, pharmaceutical compositions and vaccines for inducing immune responses in living animals (including humans) are provided herein. In addition, a recombinant MVA vector comprising a nucleotide sequence encoding an EBV glycoprotein antigenic determinant is provided for treating and / or preventing diseases caused by EBV.

[0204] The vaccine preferably comprises any of the recombinant MVA viruses described herein, formulated in solution at a concentration ranging from 10 4 Up to 10 9 TCID 50 / ml, 10 5 Up to 5x10 8 TCID 50 / ml, 10 6 Up to 10 8 TCID 50 / ml or 10 7 Up to 10 8 TCID 50 / ml. Preferred vaccination doses for humans include 10 6 Up to 10 9 TCID 50 , including 10 6 TCID 50 , 10 7 TCID 50 or 10 8 TCID 50 dosage.

[0205] The pharmaceutical compositions provided herein may generally include one or more pharmaceutically acceptable and / or approved carriers, additives, antibiotics, preservatives, adjuvants, diluents and / or stabilizers. Such auxiliary substances may be water, saline, glycerol, ethanol, wetting agents or emulsifiers, pH buffer substances, etc. Suitable carriers are generally large, slowly metabolized molecules such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids, amino acid copolymers, lipid aggregates, etc.

[0206] For the preparation of vaccines, the recombinant MVA virus provided herein can be converted into a physiologically acceptable form. This can be achieved based on the experience of preparing poxvirus vaccines for vaccination against smallpox, as described in H. Stickl et al., Dtsch.med.Wschr.99:2386-2392 (1974).

[0207] For example, purified virus can be stored at -80°C with a titer of 5 × 10 8 TCID 50 / ml, prepared in about 10mM Tris, 140mM NaCl pH 7.4. For the preparation of vaccine injection, for example, 10 2 -10 8 or 10 2 -10 9Individual virus particles can be lyophilized in 100 ml of phosphate buffered saline (PBS) in the presence of 2% peptone and 1% human albumin in ampoules (preferably glass ampoules). Alternatively, the vaccine injection can be produced by gradually freeze-drying the virus in the formulation. This formulation may contain additional additives, such as mannitol, dextran, sugar, glycine, lactose, polyvinyl pyrrolidone or other adjuvants, such as antioxidants or inert gases, stabilizers or recombinant proteins (e.g., human serum albumin) suitable for in vivo administration. The glass ampoule is then sealed and can be stored for several months between 4°C and room temperature. However, as long as it is not required, the ampoule is preferably stored at a temperature below -20°C.

[0208] For vaccination or treatment, the lyophilisate can be dissolved in an aqueous solution, preferably saline or Tris buffer, and administered systemically or topically, i.e., parenterally, subcutaneously, intravenously, intramuscularly, intranasally, or any other route of administration known to a skilled practitioner. The mode of administration, dosage, and number of administrations can be optimized by a person skilled in the art in a known manner. However, the most common situation is that the patient receives the second vaccination about one month to six weeks after the first vaccination.

[0209] Combination vaccines using a heterologous prime-boost regimen

[0210] The combination vaccines and methods described herein can be used as part of a heterologous prime-boost regimen. In a heterologous prime-boost, a first priming vaccination is given, followed by one or more subsequent booster vaccinations.

[0211] The MVA and VRP recombinant viral vectors according to the present invention can also be used in heterologous prime-boost regimens, wherein one or more initial prime vaccinations are carried out with an MVA or VRP vector as defined herein, and one or more subsequent booster vaccinations are carried out with a poxvirus vector not used in the prime vaccination, for example, if an MVA vector as defined herein is administered in the prime boost, the subsequent booster vaccination will be a VRP vector, and vice versa.

[0212] In a preferred embodiment, the primary vaccination is performed with a VRP vector and the booster vaccination is performed with MVA. Thus, one aspect of the present invention relates to a combination vaccine comprising:

[0213] (a) a first composition comprising an immunologically effective amount of a VRP vector, wherein the VRP vector comprises a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; and

[0214] (b) a second composition, comprising an immunologically effective amount of an MVA vector, the MVA vector comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier;

[0215] Wherein said first composition is a priming composition and said second composition is a boosting composition, preferably wherein said boosting composition comprises two or more doses of a vector for said boosting composition.

[0216] Vaccines and kits containing recombinant MVA and saRNA (VRP) viruses

[0217] Also provided herein are vaccines and kits comprising one or more recombinant VRPs and / or MVAs described herein. The kit may include one or more containers or vials containing recombinant MVA or VRP, and instructions for administering recombinant MVA and VRP to subjects at risk of infectious diseases. In certain embodiments, the subject is a human. In certain embodiments, the instructions indicate that recombinant MVA is administered to the subject in a single dose or multiple (i.e., 2, 3, 4, etc.) doses. In certain embodiments, the instructions indicate that recombinant MVA or VRP viruses are administered to uninfected or non-uninfected subjects in the first (primary) and second (enhanced) administrations. Preferably, the kit includes at least two vials for primary / enhanced immunization, the vials comprising recombinant VRPs as described herein, for the first inoculation ("primary inoculation") in the first vial / container, and for at least the second and / or third and / or further inoculation ("enhanced inoculation") in the second and / or other vials / containers, the vials / containers comprising recombinant MVA.

[0218] Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be construed as exemplary only, with the true scope and spirit of the invention being indicated by the appended claims.

[0219] Implementation

[0220] Embodiment 1 is a vaccine combination comprising

[0221] (a) a first composition comprising an immunologically effective amount of saRNA, the saRNA comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; and

[0222] (b) a second composition, comprising an immunologically effective amount of an MVA vector, the MVA vector comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier;

[0223] wherein one of the compositions is a priming composition and the other composition is a boosting composition.

[0224] Embodiment 2 is a vaccine combination according to embodiment 1, wherein the first composition is used to elicit an immune response and the second composition is used to boost the immune response.

[0225] Embodiment 3 is a vaccine combination according to embodiment 1, wherein the second composition is used to elicit an immune response and the first composition is used to boost the immune response.

[0226] Embodiment 4 is a vaccine combination according to any one of embodiments 1-3, wherein the antigen protein is an infectious disease antigen or a tumor-associated antigen.

[0227] Embodiment 5 is a vaccine combination according to embodiment 4, wherein the antigenic protein is an infectious disease antigen.

[0228] Embodiment 6 is a vaccine combination according to embodiment 5, wherein the antigenic protein is a viral antigen, a bacterial antigen, a fungal antigen or a parasite antigen.

[0229] Embodiment 7 is a vaccine combination according to embodiment 6, wherein the antigenic protein is a viral antigen.

[0230] Embodiment 8 is a vaccine combination according to embodiment 7, wherein the viral antigen is derived from a virus selected from the group consisting of: adenovirus, arbovirus, astrovirus, coronavirus, coxsackievirus, Crimean-Congo hemorrhagic fever virus, cytomegalovirus ("CMV"), dengue virus, Ebola virus, Epstein-Barr virus ("EBV"), foot-and-mouth disease virus, Guanarito virus, Hendra virus, herpes simplex virus type 1 ("HSV-1"), herpes simplex virus type 2 ("HSV-2"), human herpes virus type 6 ("HHV-6"), human herpes virus type 8 ("HHV-8"), hepatitis A virus ("HAV"), hepatitis B virus ("HBV"), hepatitis C virus (" The following are human immunodeficiency viruses: influenza virus, Japanese encephalitis virus, Junin virus, Lassa virus, Machupo virus, Marburg virus, measles virus, human metapneumovirus, molluscum contagiosum virus, mumps virus, Newcastle disease virus, Nipah virus, norovirus, Norwalk virus, human papillomavirus (“HPV”), parainfluenza virus, parvovirus, poliovirus, rabies virus, respiratory syncytial virus (“RSV”), rhinovirus, rotavirus, rubella virus, Sabia virus, severe acute respiratory syndrome virus (“SARS”), varicella zoster virus, smallpox virus, West Nile virus, and yellow fever virus.

[0231] Embodiment 9 is a vaccine combination according to embodiment 6, wherein the antigenic protein is a bacterial antigen.

[0232] Embodiment 10 is a vaccine combination according to embodiment 9, wherein the bacterial antigen is derived from a bacterium selected from the group consisting of: Bacillus anthracis, Bordetella pertussis, Borrelia burgdorferi, Brucella abortus, Brucella canis, Brucella melioides, Brucella suis, Burkholderia glanders, Burkholderia pseudomallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydia psittaci, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheriae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Enterotoxigenic Escherichia coli , pathogenic Escherichia coli, Escherichia coli) 157:H7, Francisella tularensis, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Leptospira interrogans, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pseudomonas aeruginosa, Rickettsia, Salmonella typhi, Salmonella typhimurium, Shigella sonnei, Staphylococcus urea, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Vibrio cholerae, and Yersinia pestis.

[0233] Embodiment 11 is a vaccine combination according to embodiment 6, wherein the infectious disease antigen is a fungal antigen.

[0234] Embodiment 12 is a vaccine combination according to embodiment 11, wherein the fungal antigens are derived from a fungus selected from the group consisting of Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus niger, Aspergillus terreus, Blastomyces dermatitidis, Candida albicans, Candida dubliniensis, Candida glabrata, Candida parapsilosis, Candida rugosa, Candida tropicalis, Cryptococcus albicans, Cryptococcus gattii, Cryptococcus laurenii, Cryptococcus neoformans, Histoplasma capsulatum, Microsporum canis, Pneumocystis carinii, Pneumocystis jirovecii, Sporothrix schenckii, Catarum catarum, tinea barbae, tinea capitis, tinea corporis, tinea corporis and tinea cruris, tinea faciei, tinea cryptonomia, tinea nigricans, tinea versicolor, Trichophyton rubrum and Trichophyton tonsurans.

[0235] Embodiment 13 is a vaccine combination according to embodiment 6, wherein the antigenic protein is a parasite antigen.

[0236] Embodiment 14 is a vaccine combination according to embodiment 13, wherein the parasite antigen is derived from a parasite selected from the group consisting of: Ascidian species, Babesia species, Ascaris raccoon, Cryptosporidium species, Cyclospora cayeta, Diphyllobothrium species, Guinea worm, Entamoeba histolytica, Giardia duodenalis, Giardia intestinalis, Giardia lamblia, Leishmania species, Plasmodium falciparum, Schistosoma mansoni, Schistosoma haematobium, Schistosoma japonicum, Taenia species, Toxoplasma gondii, Trichinella spiralis and Trypanosoma cruzi.

[0237] Embodiment 15 is a vaccine combination according to embodiment 4, wherein the antigen protein is a tumor-associated antigen.

[0238] Embodiment 16 is a vaccine combination according to embodiment 15, wherein the tumor-associated antigen is selected from the group consisting of: 5-alpha-reductase, alpha-fetoprotein ("AFP"), AM-1, APC, April, B melanoma antigen gene ("BAGE"), β-catenin, Bcl12, bcr-abl, Brachyury, CA-125, caspase-8 ("CASP-8", also known as "FLICE"), cathepsin, CD19, CD20, CD21 / complement receptor 2 ("CR2"), CD22 / BL-CAM, CD23 / F cεRII, CD33, CD35 / complement receptor 1 ("CR1"), CD44 / PGP-1, CD45 / leukocyte common antigen ("LCA"), CD46 / membrane cofactor protein ("MCP"), CD52 / CAMPATH-1, CD55 / decay accelerating factor ("DAF"), CD59 / protectin, CDC27, CDK4, carcinoembryonic antigen ("CEA"), c-myc, cyclooxygenase-2 ("cox-2"), deleted in colorectal cancer gene ("DCC"), DcR3, E6 / E7, CGFR, EMBP, Dna78, farnesyl transferase transferase, fibroblast growth factor 8a ("FGF8a"), fibroblast growth factor 8b ("FGF8b"), FLK-1 / KDR, folate receptor, G250, G melanoma antigen gene family ("GAGE-family"), gastrin 17, gastrin-releasing hormone, ganglioside 2 ("GD2") / ganglioside 3 ("GD3") / ganglioside-monosialyl-2 ("GM2"), gonadotropin-releasing hormone ("GnRH"), UDP-GlcNAc:R1Man(α1-6)R2[GlcNAc:Man(α1-6)]β1,6-N-acetylglucosamine transferase V ("GnT ​​V"), GP1, gp100 / Pme117, gp-100-in4, gp15, gp75 / tyrosine-related protein-1 ("gp75 / TRP-1"), human chorionic gonadotropin ("hCG"), heparanase, Her2 / neu, human mammary tumor virus ("HMTV"), 70-kilodalton heat shock protein ("HSP70"), human telomerase reverse transcriptase ("hTERT"), insulin-like growth factor receptor-1 ("IGFR-1"), interleukin-13 receptor ("IL-13R"), inducible iNOS, Ki67, KIAA0205, K-ras, H-ras, N-ras, KSA, LKLR-FUT, melanoma antigen encoding gene 1 ("MAGE-1"), melanoma antigen encoding gene 2 ("MAGE-2"), melanoma antigen encoding gene 3 ("MAGE-3"), melanoma antigen encoding gene 4 ("MAGE-4"), mammaglobin, MAP17, Melan-A / melanoma antigen recognized by T cells-1 ("MART-1"), mesothelin, MIC A / B, MT-MMPs, mucin, testis-specific antigen NY-ESO-1, osteonectin, p15, P170 / MDR1, p53, p97 / melanotransferrin, PAI-1, platelet-derived growth factor ("PDGF"), μPA, PRAME, prostate basic protein, progenitor cell line cytokinin, prostate-specific antigen ("PSA"), prostate-specific membrane antigen ("PSMA"), prostatic acid phosphatase ("PAP"), RAG E-1, Rb, RCAS1, SART-1, SSX-family, STAT3, STn, TAG-72, transforming growth factor-α ("TGF-α"), transforming growth factor-β ("TGF-β"), thymosin-β-15, tumor necrosis factor-α ("TNF-α"), TP1, TRP-2, tyrosinase, vascular endothelial growth factor ("VEGF"), ZAG, p16INK4, and glutathione-S-transferase ("GST").

[0239] Embodiment 17 is a vaccine combination according to any one of embodiments 1-8, wherein the antigenic protein is any structural protein and non-structural protein of EBV.

[0240] Embodiment 18 is a vaccine combination according to embodiment 17, wherein the antigenic protein is selected from gp350, gH, gL, EBNA3A and BRLF1 / BZLF1 fusion.

[0241] Embodiment 19 is a vaccine combination according to embodiment 18, wherein the antigenic protein is encoded by SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5 and SEQ ID NO:4.

[0242] Embodiment 20 is a vaccine combination according to any one of embodiments 1-19, wherein the saRNA is VRP, preferably VEEV, and more preferably TC83.

[0243] Embodiment 21 is a vaccine combination according to any one of embodiments 1-19, wherein the MVA is MVA-BN.

[0244] Embodiment 22 is a vaccine combination according to embodiment 20, wherein the VRP in the first composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of gp350, gH and gL.

[0245] Embodiment 23 is a vaccine combination according to embodiment 22, wherein the antigenic protein is encoded by SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3.

[0246] Embodiment 24 is a vaccine combination according to any one of embodiments 1-23, which is used to generate a protective immune response against an infectious disease or a tumor-related disease, wherein the first composition is used to induce the immune response and the second composition is used to boost the immune response.

[0247] Embodiment 25 is a vaccine combination according to any one of embodiments 1-23, which is used to generate a protective immune response against an infectious disease or a tumor-related disease, wherein the second composition is used to induce the immune response and the first composition is used to boost the immune response.

[0248] Embodiment 26 is a vaccine combination according to any one of embodiments 1-25, wherein the boosting composition comprises two or more doses of a vector for the boosting composition.

[0249] Embodiment 27 is a kit comprising:

[0250] (a) a first composition comprising an immunologically effective amount of saRNA, the saRNA comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; and

[0251] (b) a second composition, comprising an immunologically effective amount of an MVA vector, the MVA vector comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier;

[0252] wherein one of the compositions is a priming composition and the other composition is a boosting composition.

[0253] Embodiment 28 is a kit according to embodiment 27, wherein the first composition is used to induce an immune response and the second composition is used to boost the immune response.

[0254] Embodiment 29 is a kit according to embodiment 27, wherein the second composition is used to elicit an immune response and the first composition is used to boost the immune response.

[0255] Embodiment 30 is a kit according to any one of embodiments 27-29, wherein the antigen protein is an infectious disease antigen or a tumor-associated antigen.

[0256] Embodiment 31 is a kit according to embodiment 30, wherein the disease-associated antigen is an infectious disease antigen.

[0257] Embodiment 32 is a kit according to embodiment 31, wherein the infectious disease antigen is a viral antigen, a bacterial antigen, a fungal antigen, or a parasitic antigen.

[0258] Embodiment 33 is a kit according to embodiment 32, wherein the infectious disease antigen is a viral antigen.

[0259] Embodiment 34 is a kit according to embodiment 33, wherein the viral antigen is derived from a virus selected from the group consisting of: adenovirus, arbovirus, astrovirus, coronavirus, coxsackievirus, Crimean-Congo hemorrhagic fever virus, cytomegalovirus ("CMV"), dengue virus, Ebola virus, Epstein-Barr virus ("EBV"), foot-and-mouth disease virus, Guanarito virus, Hendra virus, herpes simplex virus type 1 ("HSV-1"), herpes simplex virus type 2 ("HSV-2"), human herpes virus type 6 ("HHV-6"), human herpes virus type 8 ("HHV-8"), hepatitis A virus ("HAV"), hepatitis B virus ("HBV"), hepatitis C virus (" The following are human immunodeficiency viruses: influenza virus, Japanese encephalitis virus, Junin virus, Lassa virus, Machupo virus, Marburg virus, measles virus, human metapneumovirus, molluscum contagiosum virus, mumps virus, Newcastle disease virus, Nipah virus, norovirus, Norwalk virus, human papillomavirus (“HPV”), parainfluenza virus, parvovirus, poliovirus, rabies virus, respiratory syncytial virus (“RSV”), rhinovirus, rotavirus, rubella virus, Sabia virus, severe acute respiratory syndrome virus (“SARS”), varicella zoster virus, smallpox virus, West Nile virus, and yellow fever virus.

[0260] Embodiment 35 is a kit according to embodiment 32, wherein the infectious disease antigen is a bacterial antigen.

[0261] Embodiment 36 is a kit according to embodiment 35, wherein the bacterial antigen is derived from a bacterium selected from the group consisting of: Bacillus anthracis, Bordetella pertussis, Borrelia burgdorferi, Brucella abortus, Brucella canis, Brucella melioides, Brucella suis, Burkholderia glanders, Burkholderia pseudomallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydia psittaci, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheriae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Enterotoxigenic Escherichia coli , pathogenic Escherichia coli, Escherichia coli) 157:H7, Francisella tularensis, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Leptospira interrogans, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pseudomonas aeruginosa, Rickettsia, Salmonella typhi, Salmonella typhimurium, Shigella sonnei, Staphylococcus urea, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Vibrio cholerae, and Yersinia pestis.

[0262] Embodiment 37 is a kit according to embodiment 32, wherein the infectious disease antigen is a fungal antigen.

[0263] Embodiment 38 is a kit according to embodiment 37, wherein the fungal antigen is derived from a fungus selected from the group consisting of Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus niger, Aspergillus terreus, Blastomyces dermatitidis, Candida albicans, Candida dubliniensis, Candida glabrata, Candida parapsilosis, Candida rugosa, Candida tropicalis, Cryptococcus albicans, Cryptococcus gattii, Cryptococcus laurenii, Cryptococcus neoformans, Histoplasma capsulatum, Microsporum canis, Pneumocystis carinii, Pneumocystis jirovecii, Sporothrix schenckii, Catarum catarum, tinea barbae, tinea capitis, tinea corporis, tinea corporis and tinea cruris, tinea faciei, tinea cryptonomia, tinea nigricans, tinea versicolor, Trichophyton rubrum and Trichophyton tonsurans.

[0264] Embodiment 39 is a kit according to embodiment 32, wherein the infectious disease antigen is a parasite antigen.

[0265] Embodiment 40 is a kit according to embodiment 39, wherein the parasite antigen is derived from a parasite selected from the group consisting of Ascidian species, Babesia species, Ascaris raccoon, Cryptosporidium species, Cyclospora cayeta, Diphyllobothrium species, Guinea worm, Entamoeba histolytica, Giardia duodenalis, Giardia intestinalis, Giardia lamblia, Leishmania species, Plasmodium falciparum, Schistosoma mansoni, Schistosoma haematobium, Schistosoma japonicum, Taenia species, Toxoplasma gondii, Trichinella spiralis, and Trypanosoma cruzi.

[0266] Embodiment 41 is a kit according to embodiment 30, wherein the disease-associated antigen is a tumor-associated antigen.

[0267] Embodiment 42 is a kit according to embodiment 41, wherein the tumor-associated antigen is selected from the group consisting of: 5-alpha-reductase, alpha-fetoprotein ("AFP"), AM-1, APC, April, B melanoma antigen gene ("BAGE"), β-catenin, Bcl12, bcr-abl, Brachyury, CA-125, caspase-8 ("CASP-8", also known as "FLICE"), cathepsin, CD19, CD20, CD21 / complement receptor 2 ("CR2"), CD22 / BL-CAM, CD23 / F cεRII, CD33, CD35 / complement receptor 1 ("CR1"), CD44 / PGP-1, CD45 / leukocyte common antigen ("LCA"), CD46 / membrane cofactor protein ("MCP"), CD52 / CAMPATH-1, CD55 / decay accelerating factor ("DAF"), CD59 / protectin, CDC27, CDK4, carcinoembryonic antigen ("CEA"), c-myc, cyclooxygenase-2 ("cox-2"), deleted in colorectal cancer gene ("DCC"), DcR3, E6 / E7, CGFR, EMBP, Dna78, farnesyl transferase transferase, fibroblast growth factor 8a ("FGF8a"), fibroblast growth factor 8b ("FGF8b"), FLK-1 / KDR, folate receptor, G250, G melanoma antigen gene family ("GAGE-family"), gastrin 17, gastrin-releasing hormone, ganglioside 2 ("GD2") / ganglioside 3 ("GD3") / ganglioside-monosialyl-2 ("GM2"), gonadotropin-releasing hormone ("GnRH"), UDP-GlcNAc:R1Man(α1-6)R2[GlcNAc:Man(α1-6)]β1,6-N-acetylglucosamine transferase V ("GnT ​​V"), GP1, gp100 / Pme117, gp-100-in4, gp15, gp75 / tyrosine-related protein-1 ("gp75 / TRP-1"), human chorionic gonadotropin ("hCG"), heparanase, Her2 / neu, human mammary tumor virus ("HMTV"), 70-kilodalton heat shock protein ("HSP70"), human telomerase reverse transcriptase ("hTERT"), insulin-like growth factor receptor-1 ("IGFR-1"), interleukin-13 receptor ("IL-13R"), inducible iNOS, Ki67, KIAA0205, K-ras, H-ras, N-ras, KSA, LKLR-FUT, melanoma antigen encoding gene 1 ("MAGE-1"), melanoma antigen encoding gene 2 ("MAGE-2"), melanoma antigen encoding gene 3 ("MAGE-3"), melanoma antigen encoding gene 4 ("MAGE-4"), mammaglobin, MAP17, Melan-A / melanoma antigen recognized by T cells-1 ("MART-1"), mesothelin, MIC A / B, MT-MMPs, mucin, testis-specific antigen NY-ESO-1, osteonectin, p15, P170 / MDR1, p53, p97 / melanotransferrin, PAI-1, platelet-derived growth factor ("PDGF"), μPA, PRAME, prostate basic protein, progenitor cell line cytokinin, prostate-specific antigen ("PSA"), prostate-specific membrane antigen ("PSMA"), prostatic acid phosphatase ("PAP"), RAG E-1, Rb, RCAS1, SART-1, SSX-family, STAT3, STn, TAG-72, transforming growth factor-α ("TGF-α"), transforming growth factor-β ("TGF-β"), thymosin-β-15, tumor necrosis factor-α ("TNF-α"), TP1, TRP-2, tyrosinase, vascular endothelial growth factor ("VEGF"), ZAG, p16INK4, and glutathione-S-transferase ("GST").

[0268] Embodiment 43 is a kit according to any one of embodiments 27-34, wherein the antigenic protein is any structural protein and non-structural protein of EBV.

[0269] Embodiment 44 is a kit according to embodiment 43, wherein the antigenic protein is selected from gp350, gH, gL, EBNA3A and BRLF1 / BZLF1 fusion.

[0270] Embodiment 45 is a kit according to embodiment 44, wherein the antigenic protein is encoded by SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5 and SEQ ID NO:4.

[0271] Embodiment 46 is a kit according to any one of embodiments 27-45, wherein the saRNA is VRP, preferably VEEV, more preferably TC83.

[0272] Embodiment 47 is a kit according to any one of embodiments 27-45, wherein the MVA is MVA-BN.

[0273] Embodiment 48 is a kit according to embodiment 46, wherein the VRP in the first composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of gp350, gH and gL.

[0274] Embodiment 49 is a kit according to embodiment 48, wherein the antigenic protein is encoded by SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3.

[0275] Embodiment 50 is a kit according to any one of embodiments 27-49, which is used to generate a protective immune response against an infectious disease or a tumor-related disease, wherein the first composition is used to induce the immune response and the second composition is used to boost the immune response.

[0276] Embodiment 51 is a kit according to any one of embodiments 27-49, which is used to generate a protective immune response against an infectious disease or a tumor-related disease, wherein the second composition is used to induce the immune response and the first composition is used to boost the immune response.

[0277] Embodiment 52 is a kit according to any one of embodiments 1-51, wherein the boosting composition comprises two or more doses of a carrier for the boosting composition.

[0278] Embodiment 53 is the vaccine combination according to any one of embodiments 1-23, the vaccine combination for use according to any one of embodiments 24-26, the kit according to any one of embodiments 27-49, the kit for use according to any one of embodiments 50-52, wherein the MVA used to produce the recombinant virus is MVA-BN virus or a derivative thereof, which has the ability to reproductively replicate in vitro in chicken embryo fibroblast (CEF) cells, but does not have the ability to reproductively replicate in the human keratinocyte cell line HaCat, the human osteosarcoma cell line 143B, the human embryonic kidney cell line 293, and the human cervical adenocarcinoma cell line HeLa.

[0279] Embodiment 54 is the vaccine combination according to any one of embodiments 1-23, the vaccine combination for use according to any one of embodiments 24-26, the kit for use according to any one of embodiments 27-49, the kit for use according to any one of embodiments 50-52, wherein the MVA used to produce the recombinant virus is MVA-BN, which is deposited at the European Collection of Animal Cell Cultures (ECACC) under accession number V00083008.

[0280] Embodiment 55 is use of the vaccine combination according to any one of embodiments 1-23 or the drug kit according to any one of embodiments 27-49 in the manufacture of a pharmaceutical composition or medicament for treating and / or preventing an infectious disease.

[0281] Embodiment 56 is a pharmaceutical composition comprising the vaccine combination according to embodiments 1-23 and a pharmaceutically acceptable carrier, diluent and / or additive.

[0282] Embodiment 57 is a method of inducing an immune response against a virus in a subject, the method comprising administering to the subject:

[0283] (a) a first composition comprising an immunologically effective amount of saRNA, the saRNA comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; and

[0284] (b) a second composition, comprising an immunologically effective amount of an MVA vector, the MVA vector comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier;

[0285] wherein one of the compositions is a priming composition and the other composition is a boosting composition.

[0286] Embodiment 58 is a method according to embodiment 57, wherein the first composition is used to induce an immune response and the second composition is used to boost the immune response.

[0287] Embodiment 59 is a method according to embodiment 57, wherein the second composition is used to induce an immune response and the first composition is used to boost the immune response.

[0288] Embodiment 60 is a method according to any one of embodiments 57-59, wherein the disease-associated antigen is an infectious disease antigen or a tumor-associated antigen.

[0289] Embodiment 61 is a method according to embodiment 60, wherein the disease-associated antigen is an infectious disease antigen.

[0290] Embodiment 62 is a method according to embodiment 61, wherein the infectious disease antigen is a viral antigen, a bacterial antigen, a fungal antigen, or a parasitic antigen.

[0291] Embodiment 63 is a method according to embodiment 62, wherein the infectious disease antigen is a viral antigen.

[0292] Embodiment 64 is a method according to embodiment 63, wherein the viral antigen is derived from a virus selected from the group consisting of: adenovirus, arbovirus, astrovirus, coronavirus, coxsackievirus, Crimean-Congo hemorrhagic fever virus, cytomegalovirus ("CMV"), dengue virus, Ebola virus, Epstein-Barr virus ("EBV"), foot-and-mouth disease virus, Guanarito virus, Hendra virus, herpes simplex virus type 1 ("HSV-1"), herpes simplex virus type 2 ("HSV-2"), human herpes virus type 6 ("HHV-6"), human herpes virus type 8 ("HHV-8"), hepatitis A virus ("HAV"), hepatitis B virus ("HBV"), hepatitis C virus (" The following are human immunodeficiency viruses: influenza virus, Japanese encephalitis virus, Junin virus, Lassa virus, Machupo virus, Marburg virus, measles virus, human metapneumovirus, molluscum contagiosum virus, mumps virus, Newcastle disease virus, Nipah virus, norovirus, Norwalk virus, human papillomavirus (“HPV”), parainfluenza virus, parvovirus, poliovirus, rabies virus, respiratory syncytial virus (“RSV”), rhinovirus, rotavirus, rubella virus, Sabia virus, severe acute respiratory syndrome virus (“SARS”), varicella zoster virus, smallpox virus, West Nile virus, and yellow fever virus.

[0293] Embodiment 65 is a method according to embodiment 62, wherein the infectious disease antigen is a bacterial antigen.

[0294] Embodiment 66 is a method according to embodiment 65, wherein the bacterial antigen is derived from a bacterium selected from the group consisting of: Bacillus anthracis, Bordetella pertussis, Borrelia burgdorferi, Brucella abortus, Brucella canis, Brucella melioides, Brucella suis, Burkholderia glanders, Burkholderia pseudomallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydia psittaci, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheriae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Enterotoxigenic Escherichia coli , pathogenic Escherichia coli, Escherichia coli) 157:H7, Francisella tularensis, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Leptospira interrogans, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pseudomonas aeruginosa, Rickettsia, Salmonella typhi, Salmonella typhimurium, Shigella sonnei, Staphylococcus urea, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Vibrio cholerae, and Yersinia pestis.

[0295] Embodiment 67 is a method according to embodiment 62, wherein the infectious disease antigen is a fungal antigen.

[0296] Embodiment 68 is a method according to embodiment 67, wherein the fungal antigen is derived from a fungus selected from the group consisting of Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus niger, Aspergillus terreus, Blastomyces dermatitidis, Candida albicans, Candida dubliniensis, Candida glabrata, Candida parapsilosis, Candida rugosa, Candida tropicalis, Cryptococcus albicans, Cryptococcus gattii, Cryptococcus laurenii, Cryptococcus neoformans, Histoplasma capsulatum, Microsporum canis, Pneumocystis carinii, Pneumocystis jirovecii, Sporothrix schenckii, Catarum catarum, tinea barbae, tinea capitis, tinea corporis, tinea corporis and tinea cruris, tinea faciei, tinea cryptonomia, tinea nigricans, tinea versicolor, Trichophyton rubrum and Trichophyton tonsurans.

[0297] Embodiment 69 is a method according to embodiment 62, wherein the infectious disease antigen is a parasite antigen.

[0298] Embodiment 70 is a method according to embodiment 69, wherein the parasite antigen is derived from a parasite selected from the group consisting of: Ascidian species, Babesia species, Raccoon Ascaris, Cryptosporidium species, Cyclospora cayeta, Diphyllobothrium species, Guinea worm, Entamoeba histolytica, Giardia duodenalis, Giardia intestinalis, Giardia lamblia, Leishmania species, Plasmodium falciparum, Schistosoma mansoni, Schistosoma haematobium, Schistosoma japonicum, Taenia species, Toxoplasma gondii, Trichinella spiralis, and Trypanosoma cruzi.

[0299] Embodiment 71 is a method according to Embodiment 60, wherein the disease-associated antigen is a tumor-associated antigen.

[0300] Embodiment 72 is a method according to embodiment 71, wherein the tumor-associated antigen is selected from the group consisting of: 5-alpha-reductase, alpha-fetoprotein ("AFP"), AM-1, APC, April, B melanoma antigen gene ("BAGE"), β-catenin, Bcl12, bcr-abl, Brachyury, CA-125, caspase-8 ("CASP-8", also known as "FLICE"), cathepsin, CD19, CD20, CD21 / complement receptor 2 ("CR2"), CD22 / BL-CAM, CD23 / F cεRII, CD33, CD35 / complement receptor 1 ("CR1"), CD44 / PGP-1, CD45 / leukocyte common antigen ("LCA"), CD46 / membrane cofactor protein ("MCP"), CD52 / CAMPATH-1, CD55 / decay accelerating factor ("DAF"), CD59 / protectin, CDC27, CDK4, carcinoembryonic antigen ("CEA"), c-myc, cyclooxygenase-2 ("cox-2"), deleted in colorectal cancer gene ("DCC"), DcR3, E6 / E7, CGFR, EMBP, Dna78, farnesyl transferase transferase, fibroblast growth factor 8a ("FGF8a"), fibroblast growth factor 8b ("FGF8b"), FLK-1 / KDR, folate receptor, G250, G melanoma antigen gene family ("GAGE-family"), gastrin 17, gastrin-releasing hormone, ganglioside 2 ("GD2") / ganglioside 3 ("GD3") / ganglioside-monosialyl-2 ("GM2"), gonadotropin-releasing hormone ("GnRH"), UDP-GlcNAc:R1Man(α1-6)R2[GlcNAc:Man(α1-6)]β1,6-N-acetylglucosamine transferase V ("GnT ​​V"), GP1, gp100 / Pme117, gp-100-in4, gp15, gp75 / tyrosine-related protein-1 ("gp75 / TRP-1"), human chorionic gonadotropin ("hCG"), heparanase, Her2 / neu, human mammary tumor virus ("HMTV"), 70-kilodalton heat shock protein ("HSP70"), human telomerase reverse transcriptase ("hTERT"), insulin-like growth factor receptor-1 ("IGFR-1"), interleukin-13 receptor ("IL-13R"), inducible iNOS, Ki67, KIAA0205, K-ras, H-ras, N-ras, KSA, LKLR-FUT, melanoma antigen encoding gene 1 ("MAGE-1"), melanoma antigen encoding gene 2 ("MAGE-2"), melanoma antigen encoding gene 3 ("MAGE-3"), melanoma antigen encoding gene 4 ("MAGE-4"), mammaglobin, MAP17, Melan-A / melanoma antigen recognized by T cells-1 ("MART-1"), mesothelin, MIC A / B, MT-MMPs, mucin, testis-specific antigen NY-ESO-1, osteonectin, p15, P170 / MDR1, p53, p97 / melanotransferrin, PAI-1, platelet-derived growth factor ("PDGF"), μPA, PRAME, prostate basic protein, progenitor cell line cytokinin, prostate-specific antigen ("PSA"), prostate-specific membrane antigen ("PSMA"), prostatic acid phosphatase ("PAP"), RAG E-1, Rb, RCAS1, SART-1, SSX-family, STAT3, STn, TAG-72, transforming growth factor-α ("TGF-α"), transforming growth factor-β ("TGF-β"), thymosin-β-15, tumor necrosis factor-α ("TNF-α"), TP1, TRP-2, tyrosinase, vascular endothelial growth factor ("VEGF"), ZAG, p16INK4, and glutathione-S-transferase ("GST").

[0301] Embodiment 73 is a method according to any one of embodiments 57-64, wherein the antigenic protein is any structural protein and non-structural protein of EBV.

[0302] Embodiment 74 is a method according to embodiment 73, wherein the antigenic protein is selected from gp350, gH, gL, EBNA3A and BRLF1 / BZLF1 fusion.

[0303] Embodiment 75 is a method according to embodiment 74, wherein the antigenic protein is encoded by SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5 and SEQ ID NO:4.

[0304] Embodiment 76 is a method according to any one of embodiments 57-75, wherein the saRNA is VRP, preferably VEEV, more preferably TC83.

[0305] Embodiment 77 is a method according to embodiments 57-75, wherein the MVA is MVA-BN.

[0306] Embodiment 78 is a method according to embodiment 76, wherein the VRP in the first composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of gp350, gH and gL.

[0307] Embodiment 79 is a method according to embodiment 78, wherein the antigenic protein is encoded by SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3.

[0308] Embodiment 80 is a method according to any one of embodiments 57-79, wherein the boosting composition is administered 1-12 weeks after administration of the priming composition.

[0309] Embodiment 81 is a method according to any one of embodiments 57-81, wherein the boosting composition is administered to the subject two or more times.

[0310] Reference will now be made in detail to exemplary embodiments of the present invention, examples of which are illustrated in the accompanying drawings.

[0311] Example

[0312] The following detailed examples are intended to help better understand the present invention. However, the present invention is not limited by the examples. Other embodiments of the present invention will be apparent to those skilled in the art by considering the description and practice of the present invention disclosed herein.

[0313] Example 1: Materials and Methods

[0314] Construction of recombinant MVA, VRP (alphavirus replicon particle) and adenovirus

[0315] The following sections describe the construction of recombinant MVA, Ad and VRP, which contain one or more heterologous nucleic acids expressing antigenic determinants of Epstein-Barr virus EBV glycoproteins and / or other EBV proteins. All other constructs described herein were made using similar methods.

[0316] Construction of MVA-mBN443B (MVA-BN-EBV)

[0317] MVA-BN-EBV (MVA-mBN443B) based on modified vaccinia Ankara-Bavaria Nordic Vectors, and encoding a fusion of the nonstructural protein EBNA3A and the early transactivator BRLF1 / BZLF1 as well as the structural glycoproteins (gp) gH and gL and a truncated soluble form of gp350 (amino acids 2-434) with a flexible linker and GCN4 multimerization domain for multimer formation. The nucleotide sequence was codon optimized and synthesized, including the promoter sequence and the sequences required for cloning. If the corresponding insertion site, i.e., the intergenic region (IGR 44 / 45 and IGR 88 / 89), is targeted for insertion via homologous recombination, the individual EBV genes are cloned into a transfer plasmid with sequences homologous to the surrounding MVA sequences.

[0318] Construction of VRP-BN011 (recombinant vaccine based on alphavirus replicon particles)

[0319] Recombinant alphavirus replicon particles VRP-BN011 are multivalent recombinant VRPs encoding three EBV antigens. VRP-BN011 is composed of a replicon derived from the attenuated strain of VEEV TC83, which expresses soluble truncated gp350 (amino acids 2-434), gH and gL proteins with a GCN4 multimerization domain for multimer formation. The basis is the sequence of the TC83 vaccine strain of VEEV, in which the VEEV viral cap-env polyprotein sequence is deleted and replaced by the listed genes of EBV. Three EBV genes are encoded on a polyprotein, with 2A peptides between individual sequences. T2A and P2A peptide sequences are inserted between three EBV coding sequences (EBV gp350-GCN4 and gH without a stop codon) to produce separate proteins, thereby inducing missing peptide bonds in the extended protein chain. In addition, a furin cleavage site is inserted downstream of the gH coding sequence to cut off the P2A sequence from the C-terminus of the mature gH protein. Sequences were codon optimized and synthesized, including cloning the required sequence. VRP stock solution was prepared by transfecting HEK293T cells with three plasmids (packaging plasmid driven by CMV promoter, recombinant replicon (with EBV gene on plasmid) encoding cap or env and CMV). Harvest supernatant was applied to sucrose cushion for purification. By infecting Vero cells, and then using dsRNA-specific mouse monoclonal antibody (J2, Jena Bioscience) to stain double-stranded RNA (dsRNA) replication intermediates, VRP stock solution was titrated in several dilution steps and analyzed by FACS.

[0320] Construction of AdC68gp350 (adenovirus vector-based recombinant vaccine)

[0321] The adenoviral vector (AdC68) expresses a truncated soluble form of the EBV gp350 protein (AdC68gp350) with a flexible linker and multimerization domain for multimer formation.

[0322] Luminex Multiplex Enzyme-Linked Immunosorbent Assay (ELISA)

[0323] IgG antibodies specific for the EBV antigens gp350, gH / gL / gp42 complex, and gH were quantified in NHP serum samples by multiplex ELISA. For this purpose, Luminex magnetic microspheres were used according to the manufacturer's instructions ( Antibody Coupling Kit, Luminex) was coupled to gp350 protein, gH / gL complex, or gH protein. Since each microsphere is uniquely addressable, multiple immunoassays can be performed simultaneously on the same sample in the same well. Briefly, to detect NHP IgG antibodies specific for EBV antigens gp350, gH / gL / gp42 complex, and gH sera, they were incubated with antigen-coupled microspheres. Different serum dilutions (1:200–1:20000) were tested depending on the expected antibody levels. In addition, a standard (human serum, purchased from BioIVT, lot number BRH1079042) was included in the analysis. After a washing step, the detection reagent (detection antibody: goat F(ab')2 anti-human IgG-Fc, PE-conjugated, pre-absorbed, Abcam, catalog number 98596) was incubated with the antibody-bound microspheres. After additional washing steps, the microspheres were incubated with 200 TM The system and Luminex Xponent 3.1 software were used to measure and analyze multiplex ELISA plates.

[0324] Neutralization test

[0325] EBV-specific neutralizing antibodies in NHP serum samples were quantified by flow cytometry-based neutralization testing. Briefly, 2-fold serial dilutions of test serum were prepared, and a defined amount of EBV was added to each serum dilution. One hour later, the serum-virus mixture was added to Ramos cells. Infected Ramos cells express EBV proteins. The next day, cells were stained with DAPI and monoclonal EBV-specific antibodies. The percentage of EBV-positive cells was analyzed using an LSR Fortessa flow cytometer. Serum samples containing neutralizing antibodies resulted in a decrease in the percentage of EBV-positive cells. In contrast, serum samples without neutralizing antibodies showed the highest percentage of anti-EBV stained cells. Uninfected "cells only" wells were used to set the gate for EBV positivity. The percentage of EBV-positive cells was used to calculate IC50 titers using GraphPad Prism software.

[0326] Enzyme-linked immunosorbent assay (ELISA)

[0327] OVA-specific IgG in serum was determined. ELISA was performed by coating 96-well plates with 5 μg / ml OVA and then blocking with PBS containing 5% FCS / 0.05% Tween20. HRP-conjugated antibodies were used and IgG was subsequently detected with TMB substrate. Absorbance was measured at 450 nm. ELISA titers were determined using linear regression analysis and Log10 titers were calculated.

[0328] Example 2: Experimental Design

[0329] The aim of this analysis was to evaluate and compare serum EBV-specific IgG and neutralizing antibodies induced by different prime-boost vaccination regimens using MVA-BN-EBV, VRP-BN011, and AdC68gp350, administered intramuscularly twice, four weeks apart, to cynomolgus monkeys (Macaca fascicularis).

[0330] Twelve female cynomolgus monkeys were administered three different vaccines via intramuscular injection (in the right thigh) on days 1 and 29 of the dosing period. A terminal necropsy was performed 6 weeks later.

[0331] Table 1 summarizes the main study designs for the respective vaccine administrations. To determine the immunogenicity of the antibodies, EBV-specific IgG and EBV neutralizing antibodies to the EBV antigen gp350 were measured using multiplex ELISA and flow cytometry-based assays, respectively. Non-human primate (NHP) serum samples were analyzed before dosing, before the second administration, and two weeks after administration (day 29, day 43).

[0332] Table 1: Main study design and group allocation.

[0333]

[0334] Example 3: Results and Conclusions

[0335] In the following sections, the following abbreviations are used:

[0336] AdC68gp350 Adenoviral vector (AdC68) expresses a truncated soluble form of the EBV gp350 protein with a flexible linker and multimerization domain for multimer formation EBV Epstein-Barr virus

[0337] ELISA enzyme-linked immunosorbent assay

[0338] GCN4 Multimerization domain based on a leucine zipper derived from the yeast protein GCN4

[0339] gH EBV glycoprotein H

[0340] gH / gL / gp42 complex EBV gH / gL / gp42 complex

[0341] gL EBV glycoprotein L

[0342] gp350 EBV glycoprotein 350 (a soluble form containing amino acids 2-434 was used here)

[0343] Inf.U Infection Unit

[0344] IgG Immunoglobulin G

[0345] IC50 half maximal inhibitory concentration

[0346] IM Intramuscular

[0347] LLOQ Lower limit of quantification

[0348] MVA-BN Modified Vaccinia Ankara – Bavaria Nordic

[0349] MVA-BN-EBV MVA-BN vector encoding a fusion of the nonstructural protein EBNA3A and the early transcriptional activators BRLF1 / BZLF1, as well as the structural glycoproteins (gp) gH and gL and a truncated soluble form of gp350 (amino acids 2-434) with a flexible linker and multimerization domain for multimer formation

[0350] NHP Nonhuman primate

[0351] SOP Standard Operating Procedure

[0352] VRP-BN011 Recombinant VRP-BN containing a VEEV-TC83-derived replicon encoding EBV soluble gp350 (amino acids 2-434), gH and gL with a flexible linker and GCN4 multimerization domain for multimer formation, packaged with VEEV-TC83-derived envelope and capsid proteins

[0353] TU transduction unit

[0354] Example 4: Gp350-specific IgG antibody response in NHP

[0355] The geometric mean concentrations (GM) of the EBV gp350-specific groups are shown in Tables 2 and Figure 2 The lower limit of quantification (LLOQ) was defined as 40 EU. Serum samples below 40 EU were reported as negative, and 20 EU corresponded to half of the LLOQ.

[0356] Pre-dose serum samples were negative for all groups (Groups 1 to 4).

[0357] On day 29 (4 weeks after the first administration), complete seroconversion by multiplex ELISA was detected in almost all groups of NHP. In group 1 (MVA / MVA), only one of three animals produced measurable gp350-specific IgG. On day 29, the highest concentrations of gp350-specific IgG were measured in groups 2 (VRP / MVA) and 4 (VRP / Ad), with GM of 3563, 3891, and 3731, respectively.

[0358] Complete seroconversion was also observed for Group 1 (MVA / MVA) on Day 43 (2 weeks after the second administration). The second administration boosted the gp350-specific antibody response of Group 3 (VRP / VRP) by 4-fold and that of Group 2 (VRP / MVA) by 7-fold compared to the corresponding antibody concentrations on Day 29. Group 2 had the highest gp350-specific IgG response with a GM of 26.626 (individual concentration range, 14.406 to 71453), followed by Group 3 (VRP / VRP) and Group 4 (VRP / Ad) with a GM of 4800 (individual concentration range, 1180 to 15.032) and a GM of 6090 (individual concentration range, 5179 to 7225), respectively.

[0359] These results suggest that VRP strongly increased gp350-specific antibody responses when given in heterologous combination with Ad or MVA as booster vaccination and that homologous combinations of MVA or VRP had minimal immunogenic effects on gp350-specific antibody induction.

[0360] Table 2: Summary of gp350-specific IgG antibody concentrations measured by multiplex ELISA

[0361]

[0362] 1 : % seroconversion rate, 2 : geometric mean concentration, 3 :Number of NHPs

[0363] Example 5: EBV-specific neutralizing antibody responses in NHPs

[0364] EBV-specific neutralizing antibody responses were measured in all pre-dose, day 29, and day 43 serum samples in each group by flow cytometry-based neutralization assays. The neutralization group geometric mean concentrations (GM) are plotted in Tables 3 and Figure 3 The LLOQ was defined as a half maximal inhibitory concentration (IC50) of 30. Serum samples with an IC50 below 30 were reported as negative, and an IC50 of 15, corresponding to half the LLOQ.

[0365] Pre-dose serum samples were negative for all groups (Groups 1 to 4).

[0366] On day 29 (4 weeks after the first administration), seroconversion was detected in two of three animals in groups 2 (VRP / MVA) and 3 (VRP / VRP), and 100% seroconversion was detected in group 4 (VRP / Ad). No animals in group 1 (MVA / MVA) seroconverted at this time. Overall, at day 29, neutralizing antibody concentrations in all seroconverted animals (regardless of the respective priming vaccination) were low (GM<50).

[0367] On day 43 (2 weeks after the second administration), complete seroconversion was observed in all groups except Group 1 (MVA / MVA), where only two of three animals developed measurable neutralizing antibodies.

[0368] The second administration boosted the neutralizing antibody level of group 2 (VRP / MVA) to 14-fold. The least significant boosting effect was in group 1 (MVA / MVA; 3-fold), group 3 (VRP / VRP; 4-fold), and group 4 (VRP / Ad; 4-fold). The highest neutralizing concentration measured in group 2 (VRP / MVA) was GM 605 (individual concentration range was 372 to 1572). The lowest neutralizing antibody levels were in group 4 (VRP / Ad), group 3 (VRP / VRP), and group 1 (MVA / MVA), with GM 176 (individual concentration range was 145 to 219), GM 118 (individual concentration range was 31 to 256), and GM 49 (individual concentration range was 15 to 214), respectively.

[0369] These results correlated with gp350-specific IgG responses measured by multiplex ELISA: VRP strongly boosted neutralizing antibody responses in heterologous prime-boost combinations. Homologous prime-boost regimens using either MVA or VRP were the least immunogenic.

[0370] Table 3: Summary of neutralizing antibodies

[0371]

[0372] 1 : % seroconversion rate, 2 : geometric mean concentration, 3 :Number of NHPs

[0373] In conclusion, the heterologous prime-boost regimen with VRP as the prime vaccine and MVA as the booster vaccine had high immunogenicity in terms of gp350-specific IgG and neutralizing antibodies, while the immunogenicity of the homologous vaccination regimen with either MVA or VRP was minimal. A single vaccination independent of the candidate vaccine was insufficient to induce a strong neutralizing antibody response.

[0374] Example 6: EBV-specific T cell responses in NHPs

[0375] EBV-specific T cell responses were measured by ELISPOT in blood PBMC samples at pre-dose, day 29, and day 43 in each group. 6个 The spot forming units (SFU) of PBMC are shown in Figure 4 middle.

[0376] Except for Group 4, pre-dose serum samples of all groups (Groups 1 to 3) were below the LLOQ.

[0377] At day 8 after the first administration, all 4 groups showed detectable Gp350-specific T cell responses, with no significant differences between the groups. The second vaccination did not further enhance the Gp350-specific T cell responses in Groups 1 (MVA / MVA), 3 (VRP / VRP), and 4 (VRP / Ad), with the exception of Group 2 (VRP / MVA), which showed a significant increase in Gp350-specific T cell responses per 1x10 6 The SFU of PBMCs further increased ( Figure 4 ). These data suggest that VRP / MVA heterologous immunization not only excels in antibody induction but also generates the highest EBV-specific T cell responses.

[0378] Example 7: EBV-specific T cell responses in mice

[0379] To assess T cell immunogenicity, mice were primed / boosted with homologous or heterologous combinations of MVA-EBV or VRP-EBV on days 0 and 21 (see Table 4). The experiment was terminated 2 weeks after the boost.

[0380] Table 4: Design of mouse VRP-EBV / MVA-EBV prime / boost study

[0381]

[0382] Prior to this experiment, immunodominant peptides within Gp350 had been identified using a peptide library screening approach. Three of these peptides (referred to as peptide 1, peptide 25, and peptide 26) had been identified as being highly efficiently recognized by T cells after immunization (data not shown). Therefore, in the experiments reported below, these three peptides were used in ELISPOT and 6h restimulation assays. Figure 5 Homologous immunization with MVA / MVA or VRP / VRP induced almost no T cell response to EBV. In contrast, heterologous immunization with VRP followed by MVA significantly increased SFU / 1x10 6 The number of splenocytes per 100 μg / ml was 1.34 μg / ml, indicating that the immunization regimen had a strong induction of EBV-specific T cells. It is noteworthy that peptides 25 and 26 had an advantage over peptide 1.

[0383] Example 8: OVA-specific T cell responses in mice

[0384] In order to study whether the advantages of VRP and MVA platform heterologous combination also extend to other antigens outside EBV, another experiment was set up. In this experiment, the model antigen ovalbumin (OVA) was selected and MVA-OVA and VRP-OVA were used for immunization (see Table 5). In order to evaluate T cell immunogenicity, mice were primed / boosted with homologous or heterologous combinations of MVA-OVA or VRP-OVA at day 0 and day 21 (see Table 5). The experiment was terminated after 2 weeks of reinforcement.

[0385] Table 5: Mouse VRP-OVA / MVA-OVA prime / boost study design

[0386]

[0387]

[0388] The primary readout was CD8 T cell responses in peripheral blood five days after boost immunization and restimulation of splenocytes with peptides targeting dominant and subdominant epitopes of OVA on the day of mouse sacrifice (4 weeks after boost).

[0389] Five days after the boost, when the groups were divided into homologous and allogeneic treatments, the allogeneic treatment showed the strongest response ( Figure 6 At this time point, the VRP-OVA homologous treatment showed a trend toward higher responses than the homologous MVA-OVA treatment (MVA / MVA), but this was not statistically significant. In contrast, boosting the initial VRP-OVA immunization with MVA-OVA immunization resulted in significantly greater expansion of OVA-specific CD8 T cells in the blood 5 days after the boost compared with the MVA / MVA treatment and the VRP / VRP treatment ( Figure 6 ).

[0390] Four weeks after the boost, early memory responses were tested in splenocytes. To this end, splenocytes were restimulated with the OVA257-264SIINFEKL peptide as well as the OVA55-62 subdominant peptide. Figure 7 As shown, the combination of VRP-OVA prime immunization and MVA-OVA boost immunization produced the strongest response to both the OVA257-264 peptide and the OVA55-62 peptide.

[0391] Interestingly, while all treatment combinations induced OVA257-264 peptide-specific responses on their own, responses to the subdominant OVA55-62 peptide were only detectable in the heterologous combination group. This suggests that combining VRP-OVA prime immunization with MVA-OVA booster immunization may not only generate a stronger immune response, but also a broader immune response, which is difficult to achieve with homologous treatment alone.

[0392] Example 9: OVA-specific CD8 T cell responses in mice

[0393] In addition, homologous or heterologous combinations of VRP-OVA and MVA-OVA platforms were tested for OVA-specific antibody production. To evaluate antibody immunogenicity, mice were primed / boosted with homologous or heterologous combinations of MVA-OVA or VRP-OVA on days 0 and 21 (see Table 5). Antibody production was measured in serum 14 days after the prime and boost immunizations, on days 14 and 35, respectively. Figure 8 As shown, mice immunized with VRP-OVA achieved the highest total IgG titers and complete seroconversion on day 14, while mice immunized with MVA-OVA showed a slightly weaker antibody response. After booster immunization (day 35), OVA-specific antibody levels increased and showed complete seroconversion in all treatment groups, but there was a clear benefit of boosting the VRP-OVA prime immunization with MVA-OVA immunization.

[0394] In summary, the combination of VRP-OVA prime immunization and MVA-OVA boost immunization enhanced the expansion of antigen-specific CD8+ T cells in peripheral blood and increased the qualitative responses of antigen-specific CD8+ T cells to dominant and subdominant OVA epitopes. The benefits of heterologous VRP / MVA immunization were also observed in terms of antibody induction.

[0395] Example 10: Gp350-specific T cell responses in mice

[0396] So far, the above experiments have been performed using VRPs based on Venezuelan equine encephalitis virus (VEEV). However, VRPs can also be based on other alphaviruses. Therefore, a VRP based on Semliki Forest virus (SFV) was generated to investigate whether this type of VRP could also effectively induce an immune response or whether it was more immunogenic than a VRP based on VEEV. To this end, the immunogenicity of an SFV-based VRP (SFV-VRP-EBV) expressing the EBV antigens gp350, gH and gL was tested.

[0397] To assess T cell immunogenicity, mice were primed / boosted with homologous or heterologous combinations of MVA-EBV or SFV-VRP-EBV on days 0 and 21 (see Table 6). The experiment was terminated 2 weeks after the boost.

[0398] Table 6: Mouse SFV-VRP-EBV / MVA-EBV prime / boost study design

[0399]

[0400] Prior to this experiment, immunodominant peptides within Gp350 had been identified using a peptide library screening approach. Three of these peptides (referred to as peptide 1, peptide 25, and peptide 26) had been identified as being highly efficiently recognized by T cells after immunization (data not shown). Therefore, in the experiments reported below, these three peptides were used in ELISPOT and 6h restimulation assays. Fig. 9 Homologous immunization with MVA / MVA induced almost no T cell response to EBV. In contrast, SFV-VRP elicited a high EBV-specific T cell response to EBV ( Fig. 9 Importantly, heterologous immunization with SFV-VRP followed by MVA significantly increased SFU / 1x10 6 The number of splenocytes per 100 μg / ml was 1.34 μg / ml, indicating that the immunization regimen had a strong induction of EBV-specific T cells. It is noteworthy that peptides 25 and 26 had an advantage over peptide 1.

[0401] In conclusion, heterologous immunization with VRPs based on Venezuelan equine encephalitis virus (VEEV) or Semliki Forest virus (SFV) were effective inducers of T cells specific for vaccine-encoded antigens.

[0402] sequence

[0403] SEQ ID NO: 1 Nucleic acid sequence of gp350 multimer (1455 nucleotides).

[0404] atg tgatag

[0405] SEQ ID NO: 2gH nucleic acid sequence (2121 nucleotides).

[0406] atg tga

[0407] The nucleic acid sequence of SEQ ID NO:3 gL (414 nucleotides).

[0408] atg agagccgtgggagtgttcctggccatctgcctcgtgaccatcttcgtgctgcccacctggggtaactgggcttacccttgttgccacgtgacccagctgagagcccagcatctgctggcactggagaacatcagcgacatctacctggtgtccaaccagacctgcgacggcttcagcctggcatccctgaacagtcccaagaacggcagcaatcagctcgtgatctccagatgtgccaacggactgaacgtggtgtccttcttcatctccatcctgaagcggagcagcagcgctctgacaggccacctgagagagctgctgaccaccctggaaaccctgtacggcagcttcagcgtggaagatctgttcggagccaacctgaacagatacgcctggcacagaggaggc tga

[0409] The nucleic acid sequence of SEQ ID NO:4 BZLF1 - BRLF1 (2283 nucleotides).

[0410] atg tgataa

[0411] SEQ ID NO:5 Nucleic acid sequence of EBNA3A (2892 nucleotides).

[0412] atg tgataa

[0413] SEQ ID NO:6 Nucleic acid sequence of a loxPV site.

[0414] ATAACTTCGTATAGGATACTTTATACGAAGTTAT

[0415] SEQ ID NO:7 Nucleic acid sequence of Pr13.5 long promoter.

[0416] taaaaatagaaactataatcatataatagtgtaggttggtagtattgctcttgtgactagagactttagttaaggtactgtaaaaatagaaactataatcatataatagtgtaggttggtagta

[0417] SEQ ID NO:8 Nucleic acid sequence of PrS promoter.

[0418] aaaaattgaaattttattttttttttttggaatataa

[0419] SEQ ID NO:9 Nucleic acid sequence of PrH5m promoter.

[0420] taaaaattgaaaataaatacaaaggttcttgagggttgtgttaaattgaaagcgagaaataatcataaataatttcattatcgcgatatccgttaagtttgtatcgta

[0421] SEQ ID NO:10 Nucleic acid sequence of Pr1328 promoter.

[0422] tatattataagtgtggtgtttggtcgatgtaaaatttttgtcgataaaaattaaaaaataacttaatttattattgatctcgtgtgtgtacaaccgaaatc

[0423] SEQ ID NO: 11 Nucleic acid sequence of 2A peptide (T2A).

[0424] AGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCT

[0425] SEQ ID NO: 12 Nucleic acid sequence of 2A peptide (P2A).

[0426] GGATCCGGCGCCACCAATTTCTCCCTGCTGAAACAGGCCGGCGATGTGGAAGAGAATCCAGGCCCT

[0427] SEQ ID NO: 13 Nucleic acid sequence of flexible linker and GCN4 multimerization domain

[0428] CCTAAGCCCAGCACACCTCCTGGCAGCTCTTGTGGAGGCATGAAAGTGAAGCAGCTGGTGGACAAGGTGGAAGAACTGCTGAGCAAGAACTACCACCTCGTGAATGAGGTGGCACGGCTCGTGAAGCTCGTGGGAGAAAGAGGTGGC

Claims

1. A vaccine combination comprising (c) a first composition comprising an immunologically effective amount of a saRNA comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; and (d) a second composition, comprising an immunologically effective amount of an MVA vector, wherein the MVA vector comprises a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; wherein one of the compositions is a priming composition and the other composition is a boosting composition.

2. The vaccine combination according to claim 1, wherein the first composition is used to elicit an immune response and the second composition is used to boost the immune response.

3. The vaccine combination according to claim 1, wherein the second composition is used to elicit an immune response and the first composition is used to boost the immune response.

4. The vaccine combination according to any one of claims 1-3, wherein the antigen protein is an infectious disease antigen or a tumor-associated antigen. The vaccine combination according to claim 4 , wherein the antigen protein is an infectious disease antigen. The vaccine combination according to claim 5 , wherein the antigenic protein is a viral antigen.

7. The vaccine combination according to claim 6, wherein the viral antigen is derived from Epstein-Barr virus ("EBV").

8. The vaccine combination according to any one of claims 1-7, wherein the antigenic protein is any structural protein and non-structural protein of EBV.

9. The vaccine combination according to claim 8, wherein the antigenic protein is selected from gp350, gH, gL, EBNA3A and BRLF1 / BZLF1 fusion.

10. The vaccine combination according to claim 9, wherein the antigenic protein is encoded by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO:

4.

11. The vaccine combination according to any one of claims 1-10, wherein the saRNA is a VRP, preferably based on an alphavirus, more preferably based on VEEV, and even more preferably based on TC83.

12. The vaccine combination according to any one of claims 1-10, wherein the MVA is MVA-BN.

13. The vaccine combination according to claim 11, wherein the VRP in the first composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of gp350, gH and gL.

14. The vaccine combination according to claim 13, wherein the antigenic protein is encoded by SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO:

3.

15. The vaccine combination according to any one of claims 1-14, which is used to generate a protective immune response against an infectious disease or a tumor-related disease, wherein the first composition is used to induce the immune response and the second composition is used to enhance the immune response.

16. The vaccine combination according to any one of claims 1-14, which is used to generate a protective immune response against an infectious disease or a tumor-related disease, wherein the second composition is used to induce the immune response and the first composition is used to enhance the immune response.

17. The vaccine combination according to any one of claims 1-16, wherein the boosting composition comprises two or more doses of the vector of the boosting composition.

18. A medicine kit comprising: (c) a first composition comprising an immunologically effective amount of a saRNA comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; and (d) a second composition, comprising an immunologically effective amount of an MVA vector, wherein the MVA vector comprises a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; wherein one of the compositions is a priming composition and the other composition is a boosting composition.

19. The kit of claim 18, wherein the first composition is for eliciting an immune response and the second composition is for boosting the immune response.

20. The kit of claim 18, wherein the second composition is used to elicit an immune response and the first composition is used to boost the immune response.

21. The kit according to any one of claims 18 to 20, wherein the antigenic protein is an infectious disease antigen or a tumor-associated antigen.

22. The kit of claim 21, wherein the disease-associated antigen is an infectious disease antigen.

23. The kit of claim 22, wherein the infectious disease antigen is a viral antigen.

24. The kit of claim 23, wherein the viral antigen is derived from Epstein-Barr virus ("EBV").

25. The kit according to any one of claims 18 to 24, wherein the antigenic protein is any structural protein and non-structural protein of EBV.

26. The kit of claim 25, wherein the antigenic protein is selected from the group consisting of gp350, gH, gL, EBNA3A, and BRLF1 / BZLF1 fusion.

27. The kit of claim 26, wherein the antigenic protein is encoded by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO:

4.

28. The kit according to any one of claims 18-27, wherein the saRNA is a VRP, preferably based on an alphavirus, more preferably based on VEEV, more preferably based on TC83.

29. The kit of any one of claims 18-27, wherein the MVA is MVA-BN.

30. The kit of claim 28, wherein the VRP in the first composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of gp350, gH, and gL.

31. The kit of claim 30, wherein the antigenic protein is encoded by SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO:

3.

32. The kit according to any one of claims 18-31, for generating a protective immune response against an infectious disease or a tumor-related disease, wherein the first composition is used to induce the immune response and the second composition is used to boost the immune response.

33. The kit according to any one of claims 18-31, for generating a protective immune response against an infectious disease or a tumor-related disease, wherein the second composition is used to induce the immune response and the first composition is used to boost the immune response.

34. The kit of any one of claims 18-33, wherein the boosting composition comprises two or more doses of the carrier of the boosting composition.

35. The vaccine combination according to any one of claims 1-14, the vaccine combination for use according to any one of claims 15-17, the drug kit according to any one of claims 18-31, and the drug kit for use according to any one of claims 32-34, wherein the MVA used to produce the recombinant virus is MVA-BN virus or a derivative thereof, which has the ability to reproductively replicate in chicken embryo fibroblast (CEF) cells in vitro, but does not have the ability to reproductively replicate in the human keratinocyte cell line HaCat, the human osteosarcoma cell line 143B, the human embryonic kidney cell line 293, and the human cervical adenocarcinoma cell line HeLa.

36. The vaccine combination according to any one of claims 1-14, the vaccine combination for use according to any one of claims 15-17, the drug kit according to any one of claims 18-31, the drug kit for use according to any one of claims 32-34, wherein the MVA used to produce the recombinant virus is MVA-BN, which is deposited in the European Collection of Animal Cell Cultures (ECACC) under accession number V00083008.

37. Use of the vaccine combination according to any one of claims 1 to 14 or the kit according to any one of claims 18 to 31 in the manufacture of a pharmaceutical composition or medicament for treating and / or preventing infectious diseases.

38. A pharmaceutical composition comprising the vaccine combination according to claims 1-14 and a pharmaceutically acceptable carrier, diluent and / or additive.

39. A method of inducing an immune response against a virus in a subject, the method comprising administering to the subject: (c) a first composition comprising an immunologically effective amount of a saRNA comprising a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; and (d) a second composition, comprising an immunologically effective amount of an MVA vector, wherein the MVA vector comprises a nucleic acid encoding an antigenic protein, and a pharmaceutically acceptable carrier; wherein one of the compositions is a priming composition and the other composition is a boosting composition.

40. The method of claim 39, wherein the first composition is used to elicit an immune response and the second composition is used to boost the immune response.

41. The method of claim 39, wherein the second composition is used to elicit an immune response and the first composition is used to boost the immune response.

42. The method of any one of claims 39-41, wherein the disease-associated antigen is an infectious disease antigen or a tumor-associated antigen.

43. The method of claim 42, wherein the disease-associated antigen is an infectious disease antigen.

44. The method of claim 43, wherein the infectious disease antigen is a viral antigen.

45. The method of claim 44, wherein the viral antigen is derived from Epstein-Barr virus ("EBV").

46. ​​The method according to any one of claims 39-45, wherein the antigenic protein is any structural protein and non-structural protein of EBV.

47. The method of claim 46, wherein the antigenic protein is selected from the group consisting of gp350, gH, gL, EBNA3A, and BRLF1 / BZLF1 fusion.

48. The method of claim 47, wherein the antigenic protein is encoded by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO:

4.

49. The method of any one of claims 39-48, wherein the saRNA is a VRP, preferably based on an alphavirus, more preferably based on VEEV, more preferably based on TC83.

50. The method of claims 39-48, wherein the MVA is MVA-BN.

51. The method of claim 49, wherein the VRP in the first composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of gp350, gH, and gL.

52. The method of claim 51, wherein the antigenic protein is encoded by SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO:

3.

53. The method of any one of claims 39-52, wherein the boost composition is administered 1-12 weeks after administration of the priming composition.

54. The method of any one of claims 39-53, wherein the boosting composition is administered to the subject two or more times.

Images