Recombinant fusion protein for antigen delivery and use thereof

Abstract

The present invention relates to a fusion protein comprising a peptide antigen comprising a T cell epitope, a first carrier protein linked to the N-terminus of the peptide antigen, and a second carrier protein linked to the C-terminus of the peptide antigen; a nucleic acid molecule encoding the fusion protein; an expression vector comprising the nucleic acid molecule; a cell transformed by the expression vector; and an immunogenic composition comprising the fusion protein, nucleic acid molecule, expression vector or cell.

Description

Technical Field

[0001] The present invention relates to a fusion protein comprising a peptide antigen containing a T cell epitope and a carrier protein connected to the N-terminus or the C-terminus or both of the peptide antigen; a nucleic acid molecule encoding the fusion protein; an expression vector comprising the nucleic acid molecule; a cell transformed by the expression vector; and an immunogenic composition comprising the fusion protein, the nucleic acid molecule, the expression vector or the cell. Background Art

[0002] A variety of technologies have been developed to deliver antigens in different forms to induce T cell immunity, but depending on the different forms, there are advantages and disadvantages. When delivering antigens in the form of peptides, depending on different antigen sequences, there are disadvantages that are difficult to synthesize and purify and low exposure due to solubility and short half-life. When delivering antigens in the form of mRNA, the advantage is the consistency of preparation, but there are also disadvantages, that is, it is necessary to formulate due to instability in the body, and it is uncertain to deliver a certain amount of antigen (constant expression in the body of various sequences). When delivering antigens in the form of DNA, the disadvantage is that the in vivo stability is better than mRNA, but it needs to be delivered to the nucleus, the antigen expression efficiency is low, and DNA may be inserted into the genome. The advantage of viral vectors is that they can be delivered to the body and have high immunogenicity, but there are also disadvantages, that is, due to the anti-drug antibodies caused by the production of strong antibodies against the surface of the virus during booster vaccination, the drug efficacy is reduced.

[0003] Therefore, there is a need to develop a vaccine that can more effectively deliver antigens into the body and induce a strong immune response. Prior art

[0004] [Patent Document]

[0005] (Patent Document 1) U.S. Patent No. 10023657 (July 17, 2018) Summary of the invention

[0006] Technical issues

[0007] The present invention provides an antigen delivery system that improves the expression, physical properties, stability and / or immunogenicity of antigens and improves the delivery of antigens to immune response cells. In addition, the present invention provides an antigen delivery system that can prepare, express, purify and deliver various antigen sequences and can induce a stronger immune response in vivo.

[0008] One embodiment provides a fusion protein, the fusion protein comprises a peptide antigen and a carrier protein connected to the N-terminus, C-terminus or both of the peptide antigen. A preferred embodiment provides a fusion protein, the fusion protein comprises a peptide antigen, a first carrier protein connected to the N-terminus of the peptide antigen and a second carrier protein connected to the C-terminus of the peptide antigen.

[0009] Another embodiment provides a nucleic acid molecule encoding the fusion protein.

[0010] Another embodiment provides an expression vector comprising the nucleic acid molecule.

[0011] Another embodiment provides a cell transformed with the expression vector.

[0012] Another embodiment provides a vaccine composition or immunogenic composition comprising the fusion protein, nucleic acid molecule, expression vector or cell.

[0013] Another embodiment provides a composition for preventing or treating a disease, wherein the composition comprises the fusion protein, nucleic acid molecule, expression vector or cell.

[0014] Technical Solution

[0015] According to one aspect of the present invention, a fusion protein is provided, comprising a peptide antigen and a carrier protein connected to the N-terminus, the C-terminus or both of the peptide antigen.

[0016] One embodiment provides a fusion protein comprising a peptide antigen, a first carrier protein connected to the N-terminus of the peptide antigen, and a second carrier protein connected to the C-terminus of the peptide antigen.

[0017] As an embodiment, in the fusion protein, the affinity tag can be connected to its N-terminus, C-terminus or both.

[0018] As one embodiment, a linker may be present between the peptide antigen and the first carrier protein, or a linker may be present between the peptide antigen and the second carrier protein, or both.

[0019] As one embodiment, the peptide antigen may contain a T cell epitope.

[0020] As an embodiment, the peptide antigen may comprise a T cell epitope derived from a tumor antigen, an infectious antigen, a self antigen or an allergy-inducing antigen.

[0021] As an embodiment, the carrier protein may be a protein that improves the recombinant expression of the peptide antigen or improves the purification of the peptide antigen.

[0022] As an embodiment, the first carrier protein may be a protein that improves the recombinant expression of the peptide antigen, and the second carrier protein may be an improved protein that improves the peptide antigen.

[0023] As an embodiment, the tumor antigen may include a tumor-associated antigen (TAA), a tumor-specific antigen (TSA), or a tumor-derived neoantigen.

[0024] As one embodiment, the tumor-derived neoantigen may comprise a mutation that is specifically expressed in cancer cells.

[0025] As an embodiment, the tumor-associated antigen (TAA) can be CT (testicular cancer) antigen, EGFR, M12, M20, M21, M30, M44, Ova, Melan-A, PSMA (prostate-specific membrane antigen), survivin, MAGE-A, ADAbp (adenosine deaminase binding protein), cyclophilin b, gp100, CRC (colorectal-associated antigen)-C017-1 A / GA733, CEA (carcinoembryonic antigen), CAP-1, CAP-2, etv6, AML1, PSA (prostate-specific antigen), PSA-1, PSA-2, PSA-3, MAGE (melanoma antigen E), GAGE ​​(G antigen), BAGE (B melanoma antigen), RAGE (renal tumor antigen), LAGE (L antigen), NAG, GnT-V, MUM-1, CDK4, p53, tyrosinase, Muc1 (mucin 1), HER2 / neu, p21ras, N-RAS, K-RAS, RCAS1, α-fetoprotein, E-cadherin, α-catenin, β-catenin, γ-catenin, p120ctn, PRAME, NY-ESO-1, TRP2, mammaglobulin-A, metallo-pan-kinase-1 (MPS-1), cytochrome P450 isoform 1B1, 90K / Mac-2 binding protein, Ep-CAM (MK-1), HSP-70, hTERT (TRT), LEA, TAGE-1, 5T4, gp70, SCP-1, c-myc, cyclin B1, MDM2, p62, Koc, IMP1, TA90, OA1, CT-7, HOM-MEL-40 / SSX-2, SSX-1, SSX-4, HOM-TES-14 / SCP-1, HOM-TES-85, HDAC5, MBD2, TRIP4, NY-CO-45, KNSL6, HIP1R, Seb4D, KIAA1416, IMP1, 90K / Mac-2 binding protein, MDM2, or LMNA.

[0026] As an embodiment, the infection source antigen may be an antigen derived from a virus, bacteria, parasite or fungus.

[0027] As an embodiment, the first carrier protein and the second carrier protein may be the same or different, and may be NDPK (nucleoside diphosphate kinase B), CSTA (cystatin-A), Trx (thioredoxin), RPL7Am (50S ribosomal protein L7Ae), Samp2a (microarchaea modification protein 2), TE (tendon protein), TM1112 (protein containing the Cupin_3 domain of Thermotoga maritima), TrxA (thioredoxin 1), TTrx (Thermosipho africanus thioredoxin) or PSBD (peripheral subunit binding domain) or a fragment thereof, or at least two thereof, respectively.

[0028] As an embodiment, the affinity tag may be His or streptavidin.

[0029] As an embodiment, the linker can be (GS)n, (G2S)n, (G3S)n, (G4S)n, Gn, LE, SSGG or GGGGSGGGGG (wherein G is Gly, S is Ser, L is Leu, E is Glu, and n is an integer of at least 1).

[0030] As an embodiment, the size of the fusion protein may be less than 30 kDa.

[0031] According to another aspect of the present invention, a nucleic acid molecule encoding the fusion protein is provided.

[0032] According to another aspect of the present invention, an expression vector comprising the nucleic acid molecule is provided.

[0033] According to another aspect of the present invention, a cell transformed with the expression vector is provided.

[0034] According to another aspect of the present invention, a vaccine composition comprising the fusion protein, nucleic acid molecule, expression vector or cell is provided.

[0035] According to another aspect of the present invention, an immunogenic composition comprising the fusion protein, nucleic acid molecule, expression vector or cell is provided.

[0036] As an embodiment, the composition may further comprise an adjuvant.

[0037] According to another aspect of the present invention, there is provided a method for causing, inducing and / or promoting an immune response against an antigen, the method comprising administering an effective dose of the fusion protein, vaccine composition and / or immunogenic composition to a patient.

[0038] According to another aspect of the present invention, there is provided a method for preventing, ameliorating and / or treating cancer, infectious diseases, autoimmune diseases or allergic diseases, the method comprising administering an effective dose of the fusion protein, vaccine composition and / or immunogenic composition to a patient.

[0039] According to another aspect of the present invention, provided is the use of the fusion protein for causing, inducing or promoting an immune response against an antigen, or for preparing a composition for causing, inducing or promoting an immune response.

[0040] According to another aspect of the present invention, provided is the use of the fusion protein for preventing, improving and / or treating cancer, infectious diseases, autoimmune diseases or allergic diseases, or the use of the fusion protein for preparing a composition for preventing, improving and / or treating cancer, infectious diseases, autoimmune diseases or allergic diseases.

[0041] Hereinafter, the present invention will be described in more detail.

[0042] In this specification (including the claims), when the terms "comprising" are used, they should be interpreted as specifying the presence of stated features, integers, steps or elements, but should not be interpreted as excluding the presence of one or more other features, integers, steps, elements or groups thereof.

[0043] In this specification, the descriptions of documents, laws, materials, devices and articles are only for the purpose of providing background of the present invention. All or part of them do not constitute part of the prior art, nor do they suggest or demonstrate the common general knowledge in the field to which the present invention belongs before the priority date of each claim of this application.

[0044] An example of the present application relates to a fusion protein, the fusion protein comprising a peptide antigen and a carrier protein connected to the N-terminus, C-terminus or both of the peptide antigen. As a preferred embodiment, it relates to a fusion protein, the fusion protein comprising a peptide antigen, a first carrier protein connected to the N-terminus of the peptide antigen and a second carrier protein connected to the C-terminus of the peptide antigen.

[0045] The term "antigen" refers to any molecule that induces an immune response in a subject. As an example, the antigen can refer to any molecule containing an epitope that can be recognized by a T cell receptor and / or a B cell receptor and stimulates an immune response, particularly a T cell response and / or a B cell response, in a subject.

[0046] The term "epitope" refers to the region of an antigen that interacts with a T cell receptor and / or a B cell receptor.

[0047] As a preferred example, the peptide antigen of the present application may contain T cell epitopes. For example, the peptide antigen of the present application may contain MHC class I and / or class II binding motifs. As a specific example, the peptide antigen of the present application may contain CD4+ T cell epitopes, i.e., peptide sequences containing MHC class II binding motifs, and can be presented on the surface of antigen presenting cells by MHC class II molecules. The peptide antigen of the present application may also contain CD8+ T cell epitopes, i.e., peptide sequences containing MHC class I binding motifs, and can be presented on the cell surface by MHC class I molecules. The peptide antigen of the present application may also contain both CD4+ T cell epitopes and CD8+ T cell epitopes.

[0048] The term "MHC (Major Histocompatibility Complex)" or "Major Histocompatibility Complex" is a protein whose function is to present antigenic fragments to immune cells, enabling them to distinguish self molecules from non-self molecules. There are two types of MHC class I and MHC class II. MHC class I is present in all nucleated cells, while MHC class II is present in antigen presenting cells. MHC class I molecules interact with CD8+ cytotoxic T cells and play an important role in destroying organ transplant rejection or infected cells. MHC class II molecules play an important role in recognizing non-self antigens and eliciting cell-mediated immunity by interacting with CD4+ T helper cells.

[0049] Generally, in an adaptive immune response, after an antigen enters the body, antigen presenting cells are able to ingest it and break it down into short peptide fragments, which can bind to the MHC class I or MHC class II molecules in the cell and be delivered to the cell surface. Therefore, when the peptide of the antigen binds to the MHC class I or MHC class II and is presented on the cell surface of the antigen presenting cell, the T cell recognizes it through the T cell receptor (TCR) and is activated, and an immune response is initiated. In this regard, the peptide antigen of the present application may correspond to an epitope of a T cell.

[0050] In other preferred embodiments, the peptide antigen may be a peptide derived from the following antigens: a tumor antigen, such as a tumor-associated antigen (TAA), a tumor-specific antigen (TSA) or a tumor-derived neoantigen; an infectious antigen, such as an antigen derived from a virus, bacteria, parasite or fungus; an autoantigen known or suspected to be able to induce autoimmunity; or an allergy-inducing antigen (allergen) known or suspected to be able to induce allergy, but not limited thereto.

[0051] For example, the peptide antigen may include a portion of a tumor antigen, an infectious antigen, a self antigen, or an allergy-inducing antigen that is predicted by computer or known to bind to MHC class I or MHC class II molecules. These antigens may be CD8+ or CD4+ T cell epitopes, but are not limited thereto.

[0052] The peptide antigen may comprise a natural or non-natural amino acid sequence, a post-translationally modified amino acid, or a peptide mimetic that can induce an immune response (e.g., a T cell or B cell response) in a subject. For example, the peptide antigen may be about 5 to about 100 or about 5 to about 50 amino acids. For example, the peptide antigen may be about 7 to 35 amino acids, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 amino acids, but is not limited thereto.

[0053] The term "tumor antigen" is used interchangeably with "cancer antigen" and refers to a molecule that elicits an immune response as an antigen expressed in a tumor (cancer). This immune response may be accompanied by antibody production or activation of specific immunocompetent cells, or both.

[0054] The tumor antigen can be derived from an organism with a tumor, a whole tumor cell that has been killed or inactivated, or a lysate, and includes any antigen derived from a tumor. The lysate is a substance produced by a method that uses a normal structure of a cell to split. In addition, the tumor antigen also includes any protein or other substance that is included in a tumor cell and has an antigenic characteristic different from that expressed by a normal cell.

[0055] For example, the tumor antigen may include a tumor-associated antigen (TAA), a tumor-specific antigen (TSA), or a tumor-derived neoantigen.

[0056] The tumor-associated antigen (TAA) is an antigen that appears more frequently in cancer cells than in normal cells, or an antigen that is displayed in other differentiation steps compared to normal cells, and is a tumor common antigen that exists in trace amounts in normal cells. Therefore, the immune response using it is likely to be offset by self-tolerance (an immunosuppressive mechanism that prevents damage to self cells), or conversely, may attack undesirable organs due to autoimmunity.

[0057] Examples of the tumor-associated antigen (TAA) may include CT (testicular cancer) antigen, EGFR, M12, M20, M21, M30, M44, Ova, Melan-A, PSMA (prostate-specific membrane antigen), survivin, MAGE-A, ADAbp (adenosine deaminase binding protein), cyclophilin b, gp100, CRC (colorectal-associated antigen)-C017-1 A / GA733, CEA (carcinoembryonic antigen), CAP-1, CAP-2, etv6, AML1, PSA (prostate-specific antigen), PSA-1, PSA-2, PSA-3, MAGE (melanoma antigen E) [For example, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10, MAGE-A11, MAGE-A12, MAGE-Xp2 (MAGE-B2), MAGE-Xp3 (MAGE-B3), MAGE-Xp4 (MAGE-B4), MAGE-C1, MAGE-C2, MAGE-C3, MAGE-C4, MAGE-C5, etc.], GAGE ​​(G antigen) [e.g., GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, GAGE-9, etc.], BAGE (B melanoma antigen), RAGE (renal tumor antigen), LAGE (L antigen), NAG, GnT-V, MUM-1, CDK4, p53, tyrosinase, Muc1 (mucin 1), HER2 / neu, p21ras, N-RAS, K-RAS, RCAS1, α-fetoprotein, E-cadherin, α-catenin, β-catenin, γ-catenin, p120ctn, PRAME, NY-ESO-1, TRP2, mammaglobulin-A, metallo-pan-segment protein-1 (MPS-1), cytochrome P450 isoform 1B1, 90K / Mac-2 binding protein, Ep-CAM (MK-1), HSP-70, hTERT (TRT), LEA, TAGE-1, 5T4, gp70, SCP-1, c-myc, cyclin B1, MDM2, p62, Koc, IMP1, TA90, OA1, CT-7, HOM-MEL-40 / SSX-2, SSX-1, SSX-4, HOM-TES-14 / SCP-1, HOM-TES-85, HDAC5, MBD2, TRIP4, NY-CO-45, KNSL6, HIP1R, Seb4D, KIAA1416, IMP1, 90K / Mac-2 binding protein, MDM2 or LMNA, but are not limited thereto.

[0058] The tumor-specific antigen (TSA) refers to an antigen that exists only specifically in cancer cells. In particular, when a tumor proliferates in a cancer patient, new antigen epitopes that can stimulate T cells are produced due to cancer cell-specific gene mutations, which are called neoantigens. In other words, the neoantigen includes cancer cell-specific gene mutations, and unlike tumor-common antigens that are also expressed in trace amounts in normal cells, the neoantigen is only selectively expressed in cancer cells, so it is recognized by the autoimmune system as a non-self foreign epitope, resulting in strong anti-cancer immune activity.

[0059] When a peptide generated from a mutated DNA is displayed on the MHC on the cell surface, it is recognized by the T cell receptor (TCR), and since no mutations occur in normal cells or tissues, there is no problem of self-tolerance or autoimmunity for neoantigen-specific T cells. Due to this advantage, the neoantigen is considered an ideal target for T cell-based cancer immunotherapy.

[0060] The causes of new antigens include, but are not limited to, frameshift deletions or insertions (in which the decoding of the genetic code is not aligned because one or more nucleotides that make up the DNA are added or deleted), point mutations due to the replacement of one nucleotide by another, other missense mutations, splice site mutations, read-through mutations or gene fusion mutations.

[0061] The new antigen is predicted by specific cancer cell genome analysis of individual cancer patients, for example, it can extract DNA, and then perform base sequence analysis by obtaining cancer cells in the patient's tumor, and compare it with the base sequence of normal cells to select the mutated part, and then identify the new antigen that stimulates T cells in the base sequence of each part of the mutation. In this article, big data processing such as next-generation gene sequencing (NGS), whole exome sequencing (WES) or RNA sequencing, computer programs for predicting MHC binding, or artificial intelligence (AI) for predicting new antigens, etc., can be used, but are not limited to this. Since the mutation form is not shared between patients, the new antigen can be prepared as a personalized cancer vaccine.

[0062] As a specific example, the tumor antigen can be represented by any one of the amino acid sequences of SEQ ID NOs: 1 to 44, but is not limited thereto.

[0063] The infectious antigen may be an antigen derived from a virus, bacteria, parasite or fungus.

[0064] For example, the viral antigen can be an antigen derived from the following viruses: varicella virus, smallpox virus, Ebola virus, Marburg virus, dengue virus, influenza virus, parainfluenza virus, respiratory syncytial virus, measles virus, human immunodeficiency virus, human papilloma virus, varicella-zoster virus, herpes simplex virus, cytomegalovirus, Epstein-Barr virus, JC virus, rhabdovirus, rotavirus, rhinovirus, adenovirus, papillomavirus, parvovirus, picornavirus, poliovirus, mumps-inducing virus, rabies-inducing virus, reovirus, rubella virus, togavirus, orthomyxovirus, retrovirus, hepadnavirus, coxsackievirus, equine encephalitis virus, Japanese encephalitis virus, yellow fever virus, Rift Valley fever virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus or hepatitis E virus, but are not limited thereto.

[0065] The bacterial antigen may be derived from Borrelia species, Bacillus anthracis, Borrelia burgdorferi, Bordetella pertussis, Campylobacter jejuni, Chlamydia species, Chlamydial psittaci, Chlamydial trachomatis, Clostridium species, Clostridium tetani, Clostridium botulinum, Clostridium perfringens, Corynebacterium diphtheriae, Coxiella species, Enterococcus species, Erlichia species, Escherichia coli, coli), Francisella tularensis, Haemophilus species, Haemophilus influenzae, Haemophilus parainfluenzae, Lactobacillus species, Legionella species, Legionella pneumophila, Leptospirosis interrogans, Listeria species, Listeria monocytogenes, Mycobacterium species, Mycobacterium tuberculosis, Mycobacterium leprae, Mycoplasma species, Mycoplasma pneumoniae pneumoniae), Neisseria species, Neisseria meningitidismeningitidis, Neisseria gonorrhoeae, Pneumococcus species, Pseudomonas species, Pseudomonas aeruginosa, Salmonella species, Salmonella typhi, Salmonella enterica, Rickettsia species, Rickettsia ricketsii, Rickettsia typhi, Shigella species, Staphylococcus species, Staphylococcus aureus, Streptococcus species, Streptococcus pneumoniae pnuemoniae, Streptococcus pyrogenes, Streptococcus mutans, Treponema species, Treponema pallidum, Vibrio species, Vibrio cholerae or Yersinia pestis, but are not limited thereto.

[0066] The fungus-derived antigen may be a fungus-derived antigen selected from Candida species, Cryptococcus species, Coccidioides species, Histoplasma species and Aspergillus species, but is not limited thereto.

[0067] The parasite-derived antigen may be an antigen derived from Plasmodium, Trypanosoma, Schistosoma or Leishmania, but is not limited thereto.

[0068] The term "carrier protein" refers to a protein that is connected to a peptide antigen and improves the recombinant expression (e.g., high expression rate, consistent expression rate, etc.) of the peptide antigen, improves purification, enhances physical properties, stabilizes or enhances immunogenicity, and / or improves delivery to immune response cells. In the present application, the carrier protein can be connected to the N-terminus and C-terminus of the peptide antigen, respectively, and in order to distinguish them, they are each referred to as a first carrier and a second carrier, respectively.

[0069] At least one of the carrier proteins may be connected to the N-terminus, the C-terminus, or both, respectively. For example, 1, 2, or 3 or more carrier proteins may be connected to the N-terminus, the C-terminus, or both, respectively.

[0070] The first carrier protein and the second carrier protein are the same or different, and may be at least one of NDPK (nucleoside diphosphate kinase B), CSTA (cystatin-A) [e.g., human CSTA (hCSTA) or mouse CSTA (mCSTA) etc.], Trx (thioredoxin) [e.g., human Trx (hTRx) or mouse TRx (mTRx) etc.], RPL7Am (50S ribosomal protein L7Ae), Samp2a (microarchaea modification protein 2), TE (tendon protein) [e.g., TE1, TE2, TE3.1, TE3.2, TE4 etc.], TM1112 (protein containing the Cupin_3 domain of Thermotoga maritima), TrxA (thioredoxin 1), TTrx (Thermotoga africanus thioredoxin) or PSBD (peripheral subunit binding domain) or a fragment thereof, but are not limited thereto. In addition, they may be codon optimized for the host cell, or may be appropriately modified to include mutations in certain sequences, or to include an initial methionine to improve functional or structural stability. For example, modifications may be introduced by deletion, substitution, or addition of certain sequences to remove residues that can participate in dimerization or redox reactions, inhibit nucleic acid binding, inhibit binding to deaminases (UniProt: Q8U1Y4), reduce excessive binding affinity to human serum albumin, facilitate quantification, inhibit deamidation, etc., but are not limited thereto.

[0071] As a preferred embodiment, considering the problem that it may be difficult to recombinantly express the antigen due to the sequence of the tumor antigen, the first carrier protein located at the N-terminus can be selected to improve antigen expression. For example, the purpose of selecting the first carrier protein can be to express the antigen above a certain level in the host expression system and / or to express it consistently and / or to stabilize it. For example, the first carrier protein can be at least one selected from TrxA, Trx (e.g., tTrx, mTrx, etc.), CSTA (e.g., tCSTA, mCSTA), TT-CSTA, TE, RPL7Am, Samp2a, TM1112, TT-TM1112, TT-Trx, but is not limited thereto.

[0072] In addition, as a preferred embodiment, considering the problem that it may be difficult to purify the antigen (or remove impurities) due to the sequence of the tumor antigen, the second carrier protein located at the C-terminus can be selected to improve the purification of the antigen. For example, the purpose of selecting the second carrier protein can be to improve the purification by stabilizing the C-terminal structure of the fusion protein in a common purification system. For example, the second carrier protein can be at least one selected from NDPK, TrxA, CSTA (e.g., tCSTA, mCSTA), PSBD, PSBD-TT, but is not limited thereto.

[0073] In addition, the carrier protein may include a pan-HLA DR binding epitope (PADRE), a tetanus toxin epitope (TT) or a diphtheria toxoid or a genetically detoxified variant thereof, a staphylococcal exotoxin or toxoid, or a Pseudomonas aeruginosa exotoxin A or a derivative thereof, but is not limited thereto.

[0074] As a specific example, the tumor antigen can be represented by any one of the amino acid sequences of SEQ ID NOs: 45 to 69, but is not limited thereto.

[0075] The protein (e.g., carrier protein and / or fusion protein) and / or polypeptide provided in this specification may be separated and / or purified from nature, or may be recombinant or chemically synthesized. When the amino acid sequence of the protein (e.g., carrier protein and / or fusion protein) and / or polypeptide provided in this specification comprises methionine (Met, M) as the first amino acid residue, the protein or polypeptide may be recombinantly produced, and the methionine at the first amino acid position from the N-terminus may be encoded by a start codon. Therefore, when the amino acid sequence of the protein (e.g., carrier protein and / or fusion protein) and / or polypeptide provided in this specification comprises methionine produced by recombinant production at the N-terminus, and when the protein or polypeptide is obtained by other methods (e.g., chemical synthesis or separation from nature) or is not located at the N-terminus of the fusion protein, it may be interpreted as comprising an amino acid sequence starting from the second amino acid residue except for the methionine produced by recombinant production at the first position of the N-terminus.

[0076] In one example of the fusion protein of the present application, the affinity tag can be linked to its N-terminus, C-terminus, or both.

[0077] The term "affinity tag" refers to a substance that provides a site for the fusion protein to attach to a specific substrate in vitro, i.e., when the fusion protein is purified by an experiment. The affinity tag is a part of the fusion protein that does not induce immunogenicity or affect the activity of the fusion protein.

[0078] The fusion protein of the present application can be purified by including an affinity tag without considering the characteristics according to the antigen sequence, and the protein can be produced at an ultra-high speed because the fusion protein can be easily purified by affinity purification.

[0079] The affinity tag may be polyhistidine (His), polyphenylalanine, polyalanine, streptavidin, maltose binding protein (MBP), intein, thioredoxin (Trx), protein A, NusA (N-utilizing substance A), β-galactosidase or glutathione-S-transferase (GST), but is not limited thereto. For example, in the case of a polyhistidine tag, a peptide having 5 to 8 histidines arranged continuously in the sequence (e.g., His-His-His-His-His-His) is used, and the histidine tag has an affinity for divalent metal ions, so the fusion protein can be purified by affinity chromatography using nickel-immobilized beads, cobalt-immobilized beads, etc.

[0080] Affinity tags can be cleaved or not cleaved under extracellular or intracellular conditions. Even if affinity tags are not cleaved, they are not only safe in vivo, but also do not induce structural changes in fusion proteins and do not substantially affect the function of fusion proteins in cells.

[0081] In one example of the fusion protein of the present application, a linker may be present between the peptide antigen and the first carrier protein, or a linker may be present between the peptide antigen and the second carrier protein, or both.

[0082] The term "linker" refers to a molecule or atom group that connects or couples or binds two or more components. In the present application, the various components of the fusion protein, such as a peptide antigen and a carrier protein, or a carrier protein and an affinity tag, can be connected or combined together by any appropriate means. The linker may have additional functions, such as increasing or decreasing water solubility, or increasing the distance between the two components to be connected to obtain flexibility or increase stability, etc., but preferably does not induce immunogenicity or affect the activity of the fusion protein.

[0083] The linker can be a peptide linker having a length of 1 to 10 or 2 to 10 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more (e.g., 20 or less) amino acids, such as 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 amino acids, but not limited thereto. As an example, the peptide linker can be composed of neutral amino acids (more specifically, Gly, Ser, Ala, Thr or a combination of these 4 amino acids). For example, it can be (GS)n, (G2S)n, (G3S)n, (G4S)n, Gn, LE, SSGG or GGGGSGGGGG (in this article, G is Gly, S is Ser, L is Leu, E is Glu, and n is an integer of at least 1), for example, it can be GS, GGGGS, LE, SSGG, GG, GGGGG or GGGGSGGGGG, but is not limited to this.

[0084] In one embodiment, the linker can comprise a degradable peptide sequence that can be cleaved by an intracellular enzyme (e.g., a protease), and cleavage of the linker can result in the release of any component (e.g., an affinity tag or a carrier protein) attached to the linker.

[0085] The term "connected" refers to components that are directly or indirectly connected together. The individual components can be covalently connected or non-covalently connected. In addition, "connected" can refer to the chemical or physical combination of the individual components after contact with a cell (e.g., an antigen presenting cell or an immune cell) and immunization. For example, when the antigen presenting cell and the immune cell are in contact, multiple components may be associated so that they cannot freely disperse from each other. For example, two components are covalently connected to each other, thereby preventing the two components from dispersing or diffusing separately.

[0086] As an example, the size of the fusion protein of the present application is not particularly limited, but for example, in order to easily remove impurities during purification, it is advantageous to have a small size. In this regard, the total size of the fusion protein can be less than 500 kDa, less than 400 kDa, less than 300 kDa, less than 200 kDa, less than 100 kDa, less than 90 kDa, less than 80 kDa, less than 70 kDa, less than 60 kDa, less than 50 kDa, such as 10 kDa to 100 kDa, 10 kDa to 90 kDa, 10 kDa to 80 kDa, 10 kDa to 70 kDa, 10 kDa to 60 kDa, 10 kDa to 50 kDa, 10 kDa to 40 kDa, 10 kDa to 30 kDa, but is not limited thereto. Another example of the present application relates to a nucleic acid molecule encoding the fusion protein.

[0087] The term "nucleic acid molecule", "nucleic acid" or "nucleic acid sequence" refers to a deoxyribonucleotide or ribonucleotide polymer in a single-stranded or double-stranded form. Unless otherwise specifically stated, the nucleic acid molecule encompasses RNA genomic sequences, cDNA, and RNA sequences transcribed therefrom, and includes natural nucleic acid analogs.

[0088] The nucleic acid molecule includes not only the nucleic acid sequence encoding the amino acid sequence of the fusion protein, but also a sequence complementary to the sequence. The complementary sequence includes not only a completely complementary sequence, but also a substantially complementary sequence, which means, for example, a sequence that can hybridize with the nucleic acid sequence encoding the amino acid sequence of the fusion protein under stringent conditions known in the art.

[0089] The fusion protein of the present application is not limited thereto, but can preferably be obtained by expression and purification by a recombinant method. Therefore, the present invention also provides an expression vector comprising a nucleic acid molecule encoding a fusion protein and a cell transformed therewith, for expressing and purifying the fusion protein.

[0090] Another example of the present application relates to an expression vector comprising the nucleic acid molecule.

[0091] The term "expression vector" refers to an operably linked nucleic acid structure in which a gene insert encoding a target protein is expressed. In one embodiment, the expression vector may be a linear or circular or single-stranded or double-stranded DNA, cDNA, RNA, etc. encoding two target proteins. The expression vector may constitute a part of a vector that can be used to transform, transduce or transfect a host, but is not limited thereto, and may itself be transcribed and / or translated in vitro.

[0092] The term "operably linked" refers to a functional association between nucleic acid sequences. For example, a coding sequence (e.g., a sequence encoding a target protein) can be operably linked to an appropriate regulatory element so that it can be replicated, transcribed and / or translated. For example, a coding sequence is operably linked to a promoter when the promoter is capable of promoting transcription of the coding sequence. The regulatory elements do not need to be adjacent to the coding sequence, as long as they function appropriately. For example, there may be an insertion sequence between the promoter sequence and the coding sequence that is not translated but transcribed, and the promoter sequence can still be considered to be "operably linked" to the coding sequence.

[0093] Each element in the expression vector should be operably linked to each other, and the connection of these element sequences can be carried out by joining (ligating) at a convenient restriction enzyme site. When such a site does not exist, it can be carried out using synthetic oligonucleotide adapters or linkers according to a common method.

[0094] The expression vector may contain transcription and translation expression control sequences that allow the corresponding gene to be expressed in the host. As expression control sequences, a promoter for transcription, any operator sequence for regulating the transcription and / or a sequence for regulating transcription and translation termination may be included. The start codon and the stop codon are generally considered to be part of the nucleic acid sequence encoding the target protein, and when the gene construct is administered, they will show an effect in the subject, and should be in the same frame as the coding sequence.

[0095] For example, a promoter refers to a DNA base sequence site to which transcription regulatory factors bind, and a promoter that can induce strong and stable gene expression can be used for the purpose of increasing the gene expression rate.

[0096] The promoter may be constitutive or inducible. The promoter is not limited thereto, but examples thereof include the early and late promoters of adenovirus, the simian virus 40 (SV40) promoter, the mouse mammary tumor virus (MMTV) promoter, the HIV long terminal repeat (LTR) promoter, the Moloney virus promoter, the cytomegalovirus (CMV) promoter, the Epstein virus (EBV) promoter, the Rous sarcoma virus (RSV) promoter, the RNA polymerase ± promoter, the T3 and T7 promoters, the major operator and promoter region of bacteriophage λ, and the like.

[0097] In addition, the expression vector may appropriately contain an adaptor or linker, an enhancer, a selection marker (e.g., an antibiotic resistance marker), a replicable unit, a polyA sequence, a purification tag or other components and induction sequences known to be able to regulate gene expression in prokaryotic cells or eukaryotic cells or their viruses, as well as various combinations thereof.

[0098] The expression vector may use various types of vectors, such as plasmid, virus vector, phage vector, cosmid vector, etc.

[0099] Another example of the present application relates to a cell transformed by the expression vector.

[0100] In the present invention, as for the transformed cells, as host cells capable of stably and continuously cloning or expressing the expression vector, any host cell known in the art can be used, and the prokaryotic cells include Escherichia coli, such as Escherichia coli JM109, Escherichia coli BL21, Escherichia coli RR1, Escherichia coli LE392, Escherichia coli B, Escherichia coli X1776, Escherichia coli W3110, Bacillus strains such as Bacillus subtilis, Bacillus thuringiensis, and enterobacterial strains such as Salmonella typhimurium, Serratia marcescens and various Pseudomonas species, etc. When transformed into eukaryotic cells, yeast (Saccharomyces cerevisiae) can be used as host cells. cerevisiae)), insect cells, plant cells and animal cells, such as CHO cell line (Chinese Hamster Ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines, etc., but not limited thereto.

[0101] As known in the art, to introduce the expression vector into the cell, suitable standard techniques can be used, such as electroporation, electroinjection, microinjection, calcium phosphate coprecipitation, calcium chloride / rubidium chloride method, retroviral infection, DEAE-dextran, cationic liposome method, polyethylene glycol-mediated uptake, gene gun, etc., but not limited thereto. Then, the circular structure can be introduced in a linear form by cutting with an appropriate restriction enzyme.

[0102] The method of selecting transformed cells can be easily carried out according to methods well known in the art, using the phenotype expressed by the selection marker. For example, when the selection marker is a specific antibiotic resistance gene, the transformant can be easily selected by culturing the transformant in a culture medium containing the antibiotic.

[0103] The culture of the transformed cells can be carried out by various methods known in the art. For example, the transformed cells are inoculated in a culture medium for culture, and then when the cell density reaches a certain level, IPTG is added to the culture medium to induce protein expression and cultured, thereby obtaining the protein secreted in the cells or the culture medium.

[0104] The protein secreted in the cell or culture medium can be obtained in a purified form according to various purification methods known in the art, but preferably, it can be purified by affinity chromatography using an affinity tag. For example, when the fusion protein is fused to GST, a combination of a resin column and glutathione is used, and when it is fused to His, IMAC (immobilized metal affinity chromatography) is used to easily obtain the protein.

[0105] Another embodiment of the present application relates to a vaccine composition or immunogenic composition comprising the fusion protein, nucleic acid molecule, expression vector or cell.

[0106] Another embodiment of the present application relates to a composition for preventing or treating cancer, infectious diseases, autoimmune diseases or allergic diseases, wherein the composition comprises the fusion protein, nucleic acid molecule, expression vector or cell.

[0107] The term "immunogenic composition" refers to any composition capable of inducing an immune response. The term "vaccine" refers to an immunogenic composition used to reduce or prevent the risk of disease or infection, or to ameliorate or treat a common disease or infection by inducing an immune response.

[0108] These compositions can be preparations containing the form of fusion protein according to the application, and can be applied to a subject to cause an immune response. Therefore, the compositions of the present invention can be conveniently used to prevent, improve or treat a disease. After being introduced into a subject or a host, the compositions can cause an immune response, preferably, it can cause a T cell-mediated immune response.

[0109] The vaccine of the present invention can be an anti-cancer vaccine comprising tumor antigens, such as tumor antigen sequences obtained from tumor analysis of patients, especially new antigen sequences, and accordingly, can maximize the proliferation and activation of personalized anti-cancer T cells to increase the anti-cancer immune effect.

[0110] The vaccine composition of the present application may also contain additional adjuvants to enhance the effectiveness of the vaccine. Suitable adjuvants include (1) aluminum salts (alum), such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc.; (2) water-in-oil emulsion preparations (containing or not containing specific immunostimulants, such as muramyl peptides or bacterial cell wall components), for example, (a) MF59, containing 5% squalene, 0.5% tween80 and 0.5% span 85 (optionally containing different amounts of N-acetylmuramoyl-L-alanyl-D-isoglutamine-L-alanine-2-(1',2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE), which is not required), formulated into particles less than one micron (WO90 / 14837); (b) SAF, containing 10% squalene, 0.4% tween 80, 5% Pluronic block polymer and N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), shaken to microfluidize into particles below one micron or produce a large particle size emulsion, and (c) Ribi™ adjuvant system (RAS) comprising at least one bacterial cell wall component selected from monophosphoryl lipid A (MPL), trehalose dimycolate (TDM) and cell wall skeleton (CWS), 2% squalene and 0.2% tween 80; (3) saponin adjuvants; (4) complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA); (5) cytokines, such as interleukins (such as IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (such as gamma interferon), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF), etc.; (6) detoxification mutants of bacterial ADP-ribosylating toxins, such as cholera toxin (CT), pertussis toxin (PT) or heat-labile toxin (LT) of Escherichia coli, especially LT-R72, CT-S109, PT-K9 / G129 (WO93 / 13302 and WO92 / 19265); and other materials as adjuvants to enhance the effectiveness of vaccines, but not limited to these.

[0111] The composition of the present application may further contain a commonly used amount of a pharmaceutically acceptable carrier, diluent and / or excipient as required.

[0112] The pharmaceutically acceptable carrier includes lactose, glucose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil, etc., which are commonly used in preparations, but are not limited thereto. In addition to the above components, the composition may also include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.

[0113] The fusion protein and the composition comprising the fusion protein as an active ingredient can be formulated into a unit dosage form or prepared by adding to a multi-dose container using pharmaceutically acceptable carriers and / or excipients according to methods that can be easily performed by those skilled in the art.

[0114] For example, the vaccine composition may comprise a common saline or buffered aqueous medium for suspension or dissolution. For example, a diluent such as water, saline, glycerol, ethanol, etc. may be generally included, and auxiliary substances such as wetting agents, emulsifiers, pH buffers, etc. may be present in the composition.

[0115] Suitable for injection include sterile aqueous solution (water soluble) or dispersion and sterile powder for preparing sterile injection solution or dispersion immediately. They should be stable under the preparation conditions and should be stored in the case of preventing microbial contamination such as bacteria or fungi. Various antibacterial and antifungal agents can be used, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. to prevent microbial contamination. In many cases, it is preferred to include isotonic agents, such as sugar or sodium chloride. Long-term absorption of injection compositions can be achieved by using drugs that delay absorption in the composition, such as aluminum monostearate or gelatin.

[0116] By combining the fusion protein of the required amount with various other components listed above in the above-mentioned solvent, to other components except fusion protein and / or heat-labile adjuvant, cytokine etc., for example buffer solution such as PBS is filtered and sterilized to prepare sterile injection solution if necessary.Usually, dispersion liquid is prepared by including various sterilization active ingredients into the sterilization vehicle containing basic dispersion medium and above-mentioned other required components.In the case of the sterilized powder for preparing sterile injection solution, preferred preparation method is vacuum drying and freeze drying method.Through these methods, the powder of active component and any required component can be obtained by its above-mentioned aseptic filtration solution as described above.

[0117] The patient to whom the fusion protein or the composition containing the fusion protein as an active ingredient is administered may be a mammal, such as a human; a primate, including a monkey, etc.; a rodent, including a rat, a mouse, etc., but is not limited thereto.

[0118] Another aspect of the present invention provides a method for causing, inducing or promoting an immune response against an antigen, the method comprising administering an effective dose of the fusion protein, vaccine composition and / or immunogenic composition to a patient.

[0119] The method of causing, inducing or promoting an immune response against an antigen may relate to a method of causing, inducing or promoting an immune response against an antigen in a cancer patient, and for example comprises administering to a cancer patient.

[0120] The term "immune response" is the result of direct or indirect stimulation mediated by cells or cytokines, and refers to changes in the activity of cells in the immune system, such as B cells, T cells or monocytes. The immune response can be a specific (T cell and / or B cell) and / or a nonspecific immune response.

[0121] Without limiting the effects of the present invention in any way, delivering the fusion protein according to the present invention induces an immune response, in particular, this is particularly useful for inducing a T cell response, such as a CD4+ T cell response or a CD8+ T cell response to an antigen. CD4+ T cell responses and CD8+ T cell responses can occur together or independently with humoral responses or other specific or nonspecific immune responses.

[0122] Another aspect of the present invention relates to the use of the fusion proteins of the present invention to treat and / or prevent disease conditions. Examples of diseases that can be treated according to the present invention include various cancer diseases, infectious diseases, autoimmune diseases, and allergic diseases.

[0123] For example, the cancer can be a solid cancer or a hematological malignancy, and as a non-limiting example, it can be breast cancer, lung cancer, prostate cancer, ovarian cancer, brain cancer, liver cancer, cervical cancer, endometrial cancer, uterine cancer, colon cancer, colorectal cancer, rectal cancer, kidney cancer, Wilms tumor, skin cancer, oral squamous cell carcinoma, epidermoid carcinoma, nasopharyngeal cancer, head and neck cancer, bone cancer, esophageal cancer, bladder cancer, lymphoma (e.g., Hodgkin's lymphoma or non-Hodgkin's lymphoma), gastric cancer, pancreatic cancer. The subject of the present invention may be a lung cancer, a testicular cancer, a thyroid cancer, a follicular cancer, a melanoma, a myeloma, a multiple myeloma, a mesothelioma, an osteosarcoma, a myelodysplastic syndrome, a mesenchymal tumor, a soft tissue sarcoma, a liposarcoma, a gastrointestinal stromal sarcoma, a malignant peripheral nerve sheath tumor (MPNST), an Ewing's sarcoma, a leiomyosarcoma, a mesenchymal chondrosarcoma, a lymphosarcoma, a fibrosarcoma, a rhabdomyosarcoma, a teratoma, a neuroblastoma, a medulloblastoma, a glioma, a benign skin tumor, or a leukemia. The lung cancer may be, for example, a small cell lung cancer (SCLC) or a non-small cell lung cancer (NSCLC). The leukemia may be, for example, an acute myeloid leukemia (AML), a chronic myeloid leukemia (CML), an acute lymphocytic leukemia (ALL), or a chronic lymphocytic leukemia (CLL). The subject to be treated may be a subject receiving secondary anti-hyperproliferative therapy. For example, the secondary anti-hyperproliferative therapy can be chemotherapy, radiation therapy, immunotherapy, phototherapy, cryotherapy, toxin therapy, hormone therapy, or surgery.

[0124] Therefore, another aspect of the present invention provides a method for preventing, improving and / or treating cancer, infectious diseases, autoimmune diseases or allergic diseases, comprising administering an effective dose of the fusion protein, vaccine composition and / or immunogenic composition to the patient. The method for preventing, improving and / or treating can be a method for preventing, improving and / or treating a disease, such as cancer, infectious diseases, autoimmune diseases or allergic diseases, by enhancing an immune response. In this article, administering an effective dose of a fusion protein, vaccine composition and / or immunogenic composition to the patient inhibits, stops or delays the occurrence or progression of a disease condition, or causes, induces or otherwise promotes an immune response that is blocked.

[0125] The direct delivery of the composition can generally be systemic, subcutaneous, intradermal, intraperitoneal, intravascular (intravenous), intramuscular or local delivery, or delivered through interstitial spaces of the tissue. The composition can also be administered into the lesion. The administration therapy can be a single dose or a multiple dose regimen.

[0126] The term "effective dose" refers to an amount that achieves a desired result when administered to a subject, including a human, such as an amount effective in treating or preventing cancer. The effective dose may vary depending on factors such as the subject's disease condition, age, sex, and weight. The dose or therapeutic regimen may be adjusted to provide the optimal therapeutic response as understood by those skilled in the art.

[0127] The therapeutic usage of the subject using a therapeutically effective dose can be composed of a single administration, or as another example, can include a series of administrations. The treatment period is determined according to various factors such as the severity of the disease, the age of the subject, the concentration of the vaccine, the patient's responsiveness to the vaccine, or a combination thereof. In addition, it should be understood that the effective dose of the vaccine for treatment can be increased or decreased during the individual treatment usage. Dosage changes can occur and can be illustrated by standard diagnostic analysis as known in the art. Vaccines of the present invention, such as cancer vaccines, can be used before, during or after treatment using common anticancer agents, radiotherapy, hormone therapy, biological therapy and / or surgical tumor resection.

[0128] Beneficial Effects

[0129] The present invention relates to a fusion protein comprising a peptide antigen containing a T cell epitope and a carrier protein connected to the N-terminus or the C-terminus or both of the peptide antigen; a nucleic acid molecule encoding the fusion protein; an expression vector comprising the nucleic acid molecule; a cell transformed by the expression vector; and an immunogenic composition comprising the fusion protein, the nucleic acid molecule, the expression vector or the cell, and has the effects of improving the expression, physical properties, stability and / or immunogenicity of the antigen and improving the delivery of the antigen to immune response cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0130] Figure 1 To confirm the SDS-PAGE results of the preparation of the fusion protein prepared according to one embodiment of the present application.

[0131] Figure 2 The purity test (SE-HPLC) of the fusion protein prepared according to one embodiment.

[0132] Figure 3 The figure shows the results of endotoxin content of size exclusion chromatography fractions of the fusion protein prepared according to one example of the present application.

[0133] Figure 4 The results show the tumor inhibition effect of the anti-cancer vaccine prepared according to one embodiment of the present application when administered to the MC38 mouse model.

[0134] Figure 5 The results show the tumor inhibitory effect of the anti-cancer vaccine prepared according to one embodiment of the present application when administered to the CT26 mouse model.

[0135] Figure 6 The figure shows the TIL analysis results when the anti-cancer vaccine prepared according to one embodiment of the present application is administered to the MC38 mouse model.

[0136] Figure 7 The figure shows the TIL analysis results when the anti-cancer vaccine prepared according to one embodiment of the present application is administered to the CT26 mouse model.

[0137] Figure 8 The figure shows the TIL analysis results when the anti-cancer vaccine prepared according to one embodiment of the present application is administered to the B16-F10 mouse model.

[0138] Fig. 9 The structure of a fusion protein according to one embodiment of the present application is shown. DETAILED DESCRIPTION

[0139] The present invention will be described in more detail below by the following examples. However, they are only intended to illustrate the present invention, but the scope of the present invention is not limited by these examples.

[0140] Example 1. Selection of epitopes

[0141] Whole exome sequencing (WES) was performed on cancer cells and normal cells to identify mutations in mice and select epitopes that bind to MHC, and mRNA sequencing was performed to identify the expression of mutant genes. By analyzing the WES results, mutations (missense mutations, frameshift mutations, indels) that altered the protein sequence and the MHC type of the mouse were identified.

[0142] Specifically, as normal cells, mouse tail tissue was used, and in the case of cancer cells, mouse melanoma cell line B16-F10 and mouse colorectal cancer cell lines MC38 and CT26 were used for sequencing (NGS). NGS was performed at Macrogen, and WES analyzed missense single nucleotide polymorphism (SNP) mutations using the Mutect2 algorithm. According to the SNP, 13-mer sequences were added to find 27-mer amino acids.

[0143] In mRNA sequencing, only genes with expression levels, i.e., RPKM (reads per kilobase per million) values ​​of 10 or above, were selected from the WES sequencing results.

[0144] The epitope sequences obtained from the results were entered into the publicly available programs NetMHCCons and NetMHCPanII. For the MHC type, the appropriate phenotype for the mouse was entered and the strong binding (SB) and weak binding (WB) criteria were set to default. NetMHCCons was analyzed using 9-mers and NetMHCPanII was analyzed using 13-mers. Scores were calculated by entering another program, the IEBD immunogenicity program, and analyzing using 9-mers.

[0145] Prediction score = 10 × number of NetMHCCons binders + Number of NetMHCPanII conjugates + IEDB Immunogenicity Score

[0146] Considering that the higher the prediction score, the greater the possibility of showing drug efficacy, all immune responses were confirmed by selecting the top 20, and anti-cancer efficacy evaluation was performed by selecting substances that showed immune responses or substances that were easy to prepare. In addition, these selected epitopes were used to prepare fusion proteins for anti-cancer vaccines.

[0147] Example 2. Selection of carrier protein

[0148] 2-1. Design of carrier protein

[0149] Neoantigens induce T cell immunity by binding to MHC-I (major histocompatibility complex-I) or MHC-II proteins. When synthetic long peptides (SLPs) containing neoantigens are used as antigens, it is known that the half-life in vivo is generally short and the solubility is known to be low based on the sequence. In order to compensate for this shortcoming of SLP, attempts were made to prepare a fusion protein of a neoantigen and a carrier protein, express the fusion protein in Escherichia coli, and attempt to produce it through a purification process.

[0150] The new antigen is expressed with an ORF (open reading frame) consisting of (CP1)-(linker 1)-(new antigen)-(linker 2)-(CP2)-(linker 3)-(His tag). Since the new antigens of each patient are different, in order to express them consistently above a certain level in E. coli, CP1, which expresses well in E. coli, is arranged at the N-terminus of the ORF. In addition, since there may be problems with purification depending on the sequence of the new antigen, a structurally stable CP2 is arranged at the C-terminus of the ORF. In addition, since the physicochemical properties of the sequences of the expressed antigens are different, an affinity tag His tag is arranged at the C-terminus of the ORF to purify the antigen without considering the characteristics of the antigen sequence. CP2 is arranged between the antigen and the His tag to prevent any antigen sequence from interrupting purification via the affinity tag, and the main elements of the ORF are connected with a linker consisting of glycine and serine. The types of carrier proteins used in the present invention are as follows:

[0151] 2-2. Results of preparing new antigen fusion protein from carrier protein

[0152] Since the protein sequences of the new antigens in the anticancer vaccine are different from each other, even if fused with a carrier protein, the pI and hydrophobicity will be different due to the new antigen protein sequence, so it is difficult to purify all antigens by ion exchange chromatography or hydrophobic interaction chromatography. To this end, the antigen protein was purified by affinity purification, and the His tag with a small tag size of 6 histidine amino acids and a high protein binding capacity of 20 mg / 1 mL resin was selected as an affinity tag for purification. In addition, in order to make and compare the structure in which the new antigen is arranged at the N-terminus, the MBP tag is introduced at the N-terminus and expressed and purified, and then cleaved with TEV protease to prepare the antigen. The antigen was first purified with an affinity tag and then refined using size exclusion chromatography (SEC). The methods of cloning, culturing and purification are the same as in Example 3. The results of preparing new antigen fusion proteins combined with each carrier protein are as follows:

[0153] Example 3. Preparation of recombinant anticancer vaccines for treatment

[0154] 3-1. Preparation of vector

[0155] When synthesizing fusion proteins, if the insert length is short (within 400 polymers), 6 oligonucleotides of 60 to 90 nucleotides in length are obtained and then overlap PCR is performed. If the insert length is long, restriction enzyme sites are ensured before and after the sequence by gene synthesis. Tables 5 and 6 summarize the primers and backbone sequences required for preparing each construct. The corresponding sequence and backbone vector were treated with restriction enzymes for 1 hour, gel extracted, and the resulting gene fragments were treated with ligase for 1 hour before E. coli transformation.

[0156] The fusion protein sequence consists of a carrier protein, an epitope, and a tag sequence for purification. All sequences are prepared by overlapping PCR or gene synthesis and then inserted into the vector. According to tumor sequencing analysis, the epitope sequence can change continuously, so after determining the sequence and order of the fusion protein, it is designed so that there are restriction enzyme sites on both sides of each epitope sequence, so that the vector can be easily prepared. In order to insert additional sequences such as epitopes, two single base sequences (two oligonucleotide base sequences, some of which are complementary to each other) of 5'>3' and 3'>5' are first attached through an annealing process, and then the annealed sequence is used as an insert to prepare the vector. When the additional sequences become longer, they are prepared by increasing the number of inserts.

[0157] For PCR, a mixture of primers, templates, polymerase premix and DW was prepared and a series of processes were performed, starting with denaturation at 95°C for 1 minute, followed by 3 steps of 25 cycles: 95°C for 10 seconds, 60°C for 10 seconds and 72°C for 30 seconds, and finally extended at 72°C for 2 minutes, and 5 minutes at 12°C in a PCR machine. The corresponding sequence and backbone vector were treated with restriction enzymes for 1 hour, gel extracted, and the resulting gene fragments were treated with ligase for 1 hour, followed by E. coli transformation. When inserts were prepared by oligonucleotide annealing, two complementary oligonucleotide sequences were mixed at the same 1 uM concentration, set at 95°C for 5 minutes, decreased to 50°C at a ramp rate of 0.1°C / second, and then incubated for 10 minutes. Table 5 summarizes the primers, backbone sequences and restriction enzyme sites required for preparing each construct.

[0158] First, all prepared vector backbones were derived from pMAL-c2x, pRK793, pET-Duet and pET28a(+). In the case of pET28a(+), in order to change the restriction enzyme site, PCR was performed using the pET-Duet vector as a template and backbone F1 and backbone R1 primers, and then a pET backbone vector mainly used as a backbone vector and which can be used as a pET backbone vector having enzyme sites different from the conventional one was prepared by inserting a fragment cut using restriction enzyme XbaI and XhoI sites into pET-28a(+).

[0159] In addition, to express epitopes by ubiquitin fusion, a pUB-E1 vector was prepared: using the pTr-Ub-E1 fragment synthesized at Cosmogenetech as a template, PCR was performed with UB_NdeI F and UB_SalI R, and then the PCR product and the previously prepared pET backbone vector were cut with NdeI-SalI and ligated. This pUB-E1 vector was used to prepare other vectors using the NdeI-SacI enzyme sites.

[0160] The preparation process of the vector for expressing the two fusion proteins (hTrx-epitope-PSBD, TM1112-epitope-PSBD) used in the evaluation of anticancer efficacy was as follows: First, in the case of the hTrx fusion vector (all hTrx sequences used in the evaluation of anticancer efficacy were designed in the form of hTrx.v3, which is the same as hTrx.v3 in Table 2), it was prepared by inserting different epitopes into a backbone vector designed to insert epitopes in the order of 'hTrx-BsaI enzyme site-PSBD-His' using two BsaI sites located between the two carrier proteins. To prepare the vector, several overlapping PCR steps were performed. The first overlapping PCR was performed using two primers and two templates: a first template prepared by PCR using hTrx.v1 synthesized by Cosmogenetech as a template and two primers hT NdeI F (GCGCATATGGTTAAACAAATTGAGTCGAAAAC: SEQ ID NO: 108) and hTrx.v3 R (TATCATTTTAGATGGACCAGACCAAGTGGCTGAGAAGTCAACTACGAC: SEQ ID NO: 109), a second template prepared by PCR using the hTrx.v1 sequence as a template and two primers hTrx.v3 F (CACTTGGTCTGGTCCATCTAAAATGATAAAGCCTTTTTTCCACTCGTTGAG: SEQ ID NO: 110) and hT BsaI R1 (TGAGACCCAGCGTTGCGGGTCTCTTCCTCCACCACCACCGACCAGTT: SEQ ID NO: 111), and the aforementioned two primers hT NdeI F and BsaI R1. The second overlapping PCR used the first overlapping PCR product as the first template, the PSBD sequence synthesized at Cosmogenetech as a template and two primers BsaI F (agagaccCGCAACGCTGggtctcaGGTGGTGGTGgaGgaGTTATCGCT: SEQ ID NO: 100) and PSBD R (CGACGAGCTCTCAATGGTGGTGATGGTGATGTCCGCCAGCCAGCCACGCGTCGATGTCTTCTTTCAGAACACGG: SEQID NO: 101) prepared by PCR, and two primers hT NdeI F and PSBD.The second overlapping PCR product and the PET backbone vector prepared based on pET-28 and pET-Duet were cut with NdeI-SacI, respectively, and ligated to prepare the hTrx-BsaI enzyme site-PSBD-His vector.

[0161] Later, the epitope expression vector prepared based on the hTrx-BsaI enzyme site-PSBD-His vector showed better physical properties than other carrier proteins in expressing different epitopes, but in the MASS analysis, the 27th glutamine of PSBD was observed to be cleaved. According to the literature, when the corresponding sequence is replaced with A / S / T / G, the corresponding phenomenon is reduced. After MBP-TEV-PSBD expression, the stability of each replacement was confirmed by TEV cleavage, but the single expression effect was not obvious. Therefore, the most effective N27G replacement was named PSBD_G and prepared. In order to prepare the corresponding vector, after PCR using the original hTrx-BsaI enzyme site-PSBD-His vector as a template and G (TCAGGGTACCGGTAAAGGTGGCCGTGTTCTGAAAGAAGACATCG: SEQ ID NO: 142) and T7 R 63 (TTCGCCAATCCGGATATAGTTCCTCCTTTC: SEQID NO: 120) as primers, the original vector hTrx-BsaI enzyme site-PSBD-His to be connected was cut with KpnI-BlpI and ligated to prepare hTrx.v3-BsaI-PSBD_G-His vector.

[0162] The PSBD_G replaced vector based on hTrx.v3-BsaI-PSBD_G-His showed a reduced effect, but to further compensate for the physical properties, a version of the GS linker was prepared extending from the linker length GGGGS between the epitope and the carrier protein for a total of 10 amino acids. Using the first template obtained by PCR with hTrx.v3-BsaI-PSBD_G-His vector as a template and T7F 63 (GTCCGGCGTAGAGGATCGAGATCTC: SEQ ID NO: 131) and G10R (tgagaccCAGCGTTGCGggtctctgcCgcCaCCgCCaCCgcttcCACCACCACCGACCAGTTCATTAATCGTAGCTTCTAAT: SEQ ID NO: 143) as primers, similarly, using the first template obtained by PCR with hTrx.v3-BsaI-PSBD_G-His vector as a template and G10F (agagaccCGCAACGCTGggtctcaGGcGGTGGcGgtGgtagcGGTGGTGgaGgaGTTATCGCTATGCCGTCCGTACGCAAAT: SEQ ID NO: 144) and T7 R 63 (TTCGCCAATCCGGATATAGTTCCTCCTTTC: SEQ ID NO: 120) as the second template obtained by primers, and using T7 F 63 and T7 R 63 as primers, overlapping PCR was performed, and the overlapping PCR product and hTrx.v3-BsaI-PSBD_G-His vector were cut with BglII-SacI, respectively, and ligated to prepare hTrx.v3-G10_BsaI-PSBD_G-His vector.

[0163] Then, in the case of the TM1112 fusion vector, the first prepared platform was TM1112-BsaI-PSBD-His, which was prepared during the screening process of various carrier proteins located in front of the epitope in the order of carrier protein 1-epitope-carrier protein 2-his using a vector designed to allow the insertion of the epitope using two BsaI sites located between the two carrier proteins. In order to prepare the vector, overlapping PCR was performed using: a first template obtained by PCR using the TM1112 base sequence synthesized at Cosmogenetech as a template and TM F (TAGCGCATATGGAAGTTAAAATCGAGAAACCGACTCCGGAAAA: SEQ ID NO: 98) and TM 1R (TGAGACCCAGCGTTGCGGGTCTCTTCCTCCACCACCACCGAACAGGTT: SEQ ID NO: 99) as primers, a second template obtained by PCR using the PSBD sequence synthesized at Cosmogenetech as a template and BsaI F and PSBD R as primers, and corresponding TM F and PSBD R as primers. The overlapping PCR product and the pET backbone vector were cut with NdeI-SacI, respectively, and ligated to prepare the TM1112-BsaI-PSBD-His vector.

[0164] In addition, the epitope expression vector prepared based on TM1112-BsaI-PSBD-His showed better physical properties than other carrier proteins in expressing different epitopes, but in the same way as the hTrx vector, the phenomenon of the 27th glutamine of PSBD being cleaved was observed. According to the literature, when the corresponding sequence is replaced with A / S / T / G, the corresponding phenomenon is reduced. After MBP-TEV-PSBD expression, the stability of each replacement was confirmed by TEV cleavage, but the single expression effect was not obvious, so the expected most effective N27G replacement was named PSBD_G and prepared. In order to prepare the corresponding vector with TM1112-BsaI-PSBD-His as the vector, the TM1112-BsaI-PSBD_G-His vector was prepared by cutting hTrx.v3-BsaI-PSBD_G-His (where PSBD was previously replaced by G as an insert) with KpnI-BlpI and connecting.

[0165] The PSBD_G replaced vector based on TM1112-BsaI-PSBD_G-His showed the effect of attenuating cleavage, but to further compensate for the physical properties, a form of GS linker was prepared extending from the linker length GGGGS between the epitope and the carrier protein for a total of 10 amino acids. The first template obtained by PCR using TM1112-BsaI-PSBD_G-His vector as a template and T7 F 63 (GTCCGGCGTAGAGGATCGAGATCTC: SEQ ID NO: 131) and TM_G10_R (TGAGACCCAGCGTTGCGGGTCTCTTCCTCCACCACCACCGCTTCCACCACCACCGAACAGGTTGTAGTGCATACGAACAGG: SEQ ID NO: 145), and the second template obtained by PCR using pc1068 vector as a template and TM_G10_F (AGAGACCCGCAACGCTGGGTCTCAGGTGGCGGCGGTGGTAGCGGTGGTGGAGGAGTTATCGCTATGCCGTCCGTACGCAAAT: SEQ ID NO: 146) and T7 R 63 (TTCGCCAATCCGGATATAGTTCCTCCTTTC: SEQ ID NO: 120) as primers were used, and T7 F Overlap PCR was performed using primers T7 R 63 and T7 R 63. The overlapping PCR product and TM1112-BsaI-PSBD_G-His vector were cut with BglII-SacI, respectively, and ligated to prepare TM1112-G10_BsaI-PSBD_G-His vector.

[0166] Ten anticancer vaccines and other epitope expression vectors were prepared by ligating two oligonucleotides annealed at the BsaI site and used as purification examples.

[0167] In the case of TM-M30-PS, it was prepared by ligating the linearized TM1112-BsaI-PSBD-His vector cut with BsaI and the annealing product of two nucleotide oligomers M30 F (aGgaCCGAGCAAACCGTCGTTTCAGGAATTTGTGGACTGGGAAAACGTGTCGCCGGAACTGAaCAGCACCGATCAGCCGTTTCTG: SEQ ID NO: 102) and M30 R (CACCCAGAAACGGCTGATCGGTGCTGtTCAGTTCCGGCGACACGTTTTCCCAGTCCACAAATTCCTGAAACGACGGTTTGCTCGG: SEQ ID NO: 103).

[0168] In the case of TM-CT5-PS, an insert was prepared by overlapping PCR using two PCR products as templates: a first template prepared by PCR using a TM sequence synthesized at Cosmogenetech as a template and TM F and TM R5 (GCTCACCATAAACAGCTGCGGCATAATCGCCACGCTTTCCAGATAAATTCCTCCACCACCACCGAACAGGTTGT: SEQ ID NO: 104) as primers, and a second template prepared by PCR using a PSBD sequence synthesized at Cosmogenetech as a template and CT5 F2 (GCGATTATGCCGCAGCTGTTTATGGTGAGCAAAGGCGGTGGTGGAGGAGTTATCGCTATGCCGTCCGTACGCAAATATGCACGTGAAA: SEQ ID NO: 105) and PSBD R as primers. Overlap PCR was performed using these two PCR products as templates and TM F and PSBD R as primers, and the overlapping PCR products and the pET backbone vector were treated with NdeI-SacI restriction enzymes and ligated to prepare a vector.

[0169] hT-M12-PS was prepared by cutting the hTrx-BsaI-PSBD-His vector with BsaI, annealing two nucleotide oligomers M12 F (aGgaACCCCGCCGCCGGAAGAAGCGATGCCGTTTGAATTTAATGGTCCGGCGCAGGGTGATCATAGCCAGCCGCCGCTGCAGGTG: SEQ ID NO: 115) and M12 R (CACCCACCTGCAGCGGCGGCTGGCTATGATCACCCTGCGCCGGACCATTAAATTCAAACGGCATCGCTTCTTCCGGCGGCGGGGT: SEQ ID NO: 116), and ligating the previously cut vector with ligase.

[0170] hT-CT25-PS was prepared by cutting the hTrx-BsaI-PSBD-His vector with BsaI, annealing two nucleotide oligomers CT25 F (aGgaCTGCATCTGGAAGAAACCCTGGCGGGCTTTTGGGCGCGCCTGCTGGAAcgc: SEQ ID NO: 117) and CT25 R (CACCgcgTTCCAGCAGGCGCGCCCAAAAGCCCGCCAGGGTTTCTTCCAGATGCAG: SEQ ID NO: 118), and then ligating the previously cut vector with ligase.

[0171] In the case of TT-hT-M30-PS, the first template hT-M30-PS was prepared by cutting the hTrx-BsaI-PSBD-His vector with BsaI, annealing two nucleotide oligomers M30 F (aGgaCCGAGCAAACCGTCGTTTCAGGAATTTGTGGACTGGGAAAACGTGTCGCCGGAACTGAaCAGCACCGATCAGCCGTTTCTG: SEQ ID NO: 102) and M30 R (CACCCAGAAACGGCTGATCGGTGCTGtTCAGTTCCGGCGACACGTTTTCCCAGTCCACAAATTCCTGAAACGACGGTTTGCTCGG: SEQ ID NO: 103), and then ligating the previously cut vector with ligase. To attach the pre-TT sequence, PCR was performed using hT-M30-PS as a template and htrx TTF (GCAAATTTATTGGCATTACCGAACTGGGCGGCGGCGGGTCTATGGTTAAACAAATTGAGTCGAAAACCG: SEQ ID NO: 119) and T7 R 63 as primers. PCR was performed again using the previous PCR product as a template and TTF (GCGGCATATGCAGTATATTAAAGCGAACAGCAAATTTATTGGCATTACCGAACTG: SEQ ID NO: 121) and T7 R 63 primers, and then cut together through the NdeI-SacI sites and ligated with the pET backbone vector to prepare the vector.

[0172] In the case of TT-hT-CT5-PS, the first template hT-CT5-PS was prepared by cleaving the previously prepared hT-BsaI-PS with BsaI, annealing two nucleotide oligomers CT5 F (aGgaATTTATCTGGAAAGCGTGGCGATTATGCCGCAGCTGTTTATGGTGAGCAAA: SEQ ID NO: 122) and CT5 R (CACCTTTGCTCACCATAAACAGCTGCGGCATAATCGCCACGCTTTCCAGATAAAT: SEQ ID NO: 123), and then ligating the previously cleaved vector with ligase. Next, PCR was performed with htrx TT F and T7 R primers to attach the pre-TT sequence. PCR was then performed again with TT F and T7 R primers, and then the vector was prepared by cleaving through the NdeI-SacI site and ligating with the pET backbone vector.

[0173] In the case of TT-CS-M21-PS, the first fragment obtained by PCR using CSTA as a template and CSTA F (gcgaCTAGtAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGATCCCAGGAGGTCTGTCTGAAGCTAAGcc: SEQ ID NO: 124) and CS_OVA R (CTGTTCCAGACCGCTAACTTCATCGGATCCACCACCACCAAAACCCGTCAGCTCATCATCTTT: SEQ ID NO: 125) and the second fragment obtained by PCR using the OVA sequence as a template and CS_OVA F (GGTGGATCCGATGAAGTTAGCGGTCTGGAACAG: SEQ ID NO: 126) and OVA R (GACGAGCTCTCAGTGATGATGGTGGTGATGACCTCCACTAGACATAACATTGCTGCTGGTCCATTCGGT: SEQ ID NO: 127) and the second fragment obtained by PCR using CSTA F and OVA R (GACGAGCTCTCAGTGATGATGGTGGTGATGACCTCCACTAGACATAACATTGCTGCTGGTCCATTCGGT: SEQ ID NO: 128). The PCR product obtained by overlapping PCR with primer R was cut, and the PCR product and the pET backbone were connected using XbaI-SacI and ligase to prepare CSTA-OVA. Then, the CSTA-OVA was cloned and expressed in the presence of 50 amino acids. The cloned CSTA-OVA was cloned and expressed in the presence of 50 amino acids. Then, the CSTA-OVA was cloned and expressed in the presence of 50 amino acids. The cloned CSTA-OVA was cloned and expressed in the presence of 50 amino acids. Then, the CSTA-OVA was cloned and expressed in the presence of 50 amino acids. The DNA fragment obtained by PCR using primers 129) was cut with BamHI-SacI sites and ligated to prepare CSTA-M21.In addition, PCR was performed using the CSTA-M21 vector as a template and hCS TT F2 (GCGCATATGGGCGGCGGCGGGTCTATGATCCCAGGAGGTCTGTCTGAAG: SEQ ID NO: 149) and T7 R 63 primers, and then PCR was performed again using the PCR product as a template and TT F (GCGCATATGCAGTATATTAAAGCGAACAGCAAATTTATTGGCATTACCGAACTGGGCGGCGGCGGGTCTATGAT: SEQ ID NO: 121) and T7 R 63 primers, and the PCR product and the pET backbone vector were cut using the NdeI-SacI site and ligated to prepare the TT-CS-M21 vector. In addition, the TT-CS-M21-PS vector was prepared by cutting and ligating the overlapping PCR products obtained with T7 F and T7 R as primers and the pET backbone using the first fragment obtained by PCR using the TT-CS-M21 vector as a template and T7 F 63 and CS-M21 R primers (GCGTACGGACGGCATAGCGATAACTCCTCCACCACCACCCATATAATTATCTTTCAGACGCAGATAGGTA: SEQ ID NO: 132) and the second fragment obtained by PCR using the PSBD sequence as a template and PSBD F2 (GGTGGTGGTGGAGGAGTTATCGCTAT: SEQ ID NO: 133) and T7 R 63 primers with NdeI-SacI, and the pET backbone.

[0174] In the case of TT-CS-CT5-PS, CSTA-CT5 was prepared by ligating the CSTA-OVA fragment cut with BamHI-SacI with other DNA products annealed with CT5BamHI F (GATCCATTTATCTGGAAAGCGTGGCGATTATGCCGCAGCTGTTTATGGTGAGCAAAGGCGGACATCACCATCACCACCATTGAGAGCT: SEQ ID NO: 134) and CT5SacI R (CTCAATGGTGGTGATGGTGATGTCCGCCTTTGCTCACCATAAACAGCTGCGGCATAATCGCCACGCTTTCCAGATAAATG: SEQ ID NO: 135). In addition, after PCR was performed using the CSTA-CT5 vector as a template and hCS TT F and T7 R primers, PCR was then performed again using the PCR product as a template and TT F and T7 R primers, and the final PCR product and pET backbone vector were cut with NdeI-SacI sites and ligated. In addition, the TT-CS-CT5-PS vector was prepared by cutting and ligating overlapping PCR products prepared by using T7 F and T7 R as primers using the TT-CS-CT5 vector as a template and the first fragment obtained by PCR using T7 F and CS-CT5 R primers, the second fragment obtained by PCR using the PSBD sequence as a template and PSBD F2 and T7 R primers, and the pET backbone.

[0175] In the case of TT-TM-M44-PS, the first vector was prepared by cutting TM1112-BsaI-PSBD-His with BsaI and ligating it with a DNA fragment prepared by annealing of two nucleotide oligomers M44 F (aGgaGAATTTAAACATATTAAAGCGTTTGATCGTACCTTTGCGAATAACCCGGGTCCGATGGTGGTGTTTGCGACCCCGGGTATG: SEQ ID NO: 137) and M44 R (CACCCATACCCGGGGTCGCAAACACCACCATCGGACCCGGGTTATTCGCAAAGGTACGATCAAACGCTTTAATATGTTTAAATTC: SEQ ID NO: 138). Then, in order to attach the pre-TT sequence, two PCR reactions were performed. The first PCR reaction was performed with the previously prepared vector as a template and htrx TT F and T7 R primers, and the second PCR reaction was performed using the first PCR product as a template and TT F and T7 R 63 primers. The final PCR product and the pET backbone vector were cut and ligated using the NdeI-SacI sites.

[0176] In the case of TT-TM-CT25-PS, the first vector was prepared by cutting the reaction of the TM1112-BsaI-PSBD-His vector with BsaI and ligating it with a DNA fragment prepared by annealing of two nucleotide oligomers CT25 F (aGgaCTGCATCTGGAAGAAACCCTGGCGGGCTTTTGGGCGCGCCTGCTGGAAcgc: SEQ ID NO: 140) and CT25 R (CACCgcgTTCCAGCAGGCGCGCCCAAAAGCCCGCCAGGGTTTCTTCCAGATGCAG: SEQ ID NO: 141). Then, in order to attach the pre-TT sequence, two PCR reactions were performed. The first PCR reaction was performed with the previously prepared vector as a template and htrx TTF and T7 R primers, and the second PCR reaction was performed using the first PCR product as a template and TTF and T7 R primers. The final PCR product and the pET backbone vector were cut and ligated using the NdeI-SacI site.

[0177] Ten vectors used in the evaluation of the efficacy of anticancer vaccines, such as the vectors used in the purification embodiment, were prepared by ligating DNA fragments prepared by annealing two oligonucleotides and a backbone vector cut by the BsaI site.

[0178] Among hTrx.v3-CT4-PSBD-His, hTrx.v3-CT5-PSBD-His and hTrx.v3-CT24-PSBD-His, hTrx.v3-CT5-PSBD-His is the same as hT-CT5-PS, and hTrx.v3-CT4-PSBD-His and hTrx.v3-CT24-PSBD-His are prepared by cleaving the previously prepared hT-BsaI-PS with BsaI and ligating the cleaved vector with two DNA fragments prepared by annealing the following two pairs of oligomers: CT4 F (aGgaGGCGGCATTAGCGTGAAAGAACATATTGAAGTGAACGTGGTGCCGCTgACC: SEQ ID NO: 156) and CT4 R (CACCGGTcAGCGGCACCACGTTCACTTCAATATGTTCTTTCACGCTAATGCCGCC: SEQ ID NO: 157) as a pair, and CT24 F (aGgaCCGCTGGAAGCGATGTATATGCAGTGGCCGGTGATTGCGGTGAACAACgGC: SEQ ID NO: 158) and CT24 R (CACCGCcGTTGTTCACCGCAATCACCGGCCACTGCATATACATCGCTTCCAGCGG: SEQ ID NO: 159) served as another pair.

[0179] hTrx.v3-Cpne1-PSBD-His, hTrx.v3-Irgq-PSBD-His and hTrx.v3-Aatf-PSBD-His were prepared by cutting the hTrx.v3-G10_BsaI-PSBD_G-His vector with BsaI and ligating it with each of the following annealed DNA oligomers: Aatf F (CGGCCATGTGCTGAGCAAACTGCTGAGCTTTATGGCGCCGATTGATCATACCACCATGAGCGATGATGCGCGCACCGAACTGTTT: SEQ ID NO: 150) and Aatf R (CaCCAAACAGTTCGGTGCGCGCATCATCGCTCATGGTGGTATGATCAATCGGCGCCATAAAGCTCAGCAGTTTGCTCAGCACATG: SEQ ID NO: 151) as a pair, Cpne F (CGGCGGCAGCAACGGCGATCCGAGCAGCCCGTATAGCCTGCATTATCTGAGCCCGACCGGCGTGAACGAATATCTGACCGCGCTG: SEQ ID NO: 152) and Cpne R (CaCCCAGCGCGGTCAGATATTCGTTCACGCCGGTCGGGCTCAGATAATGCAGGCTATACGGGCTGCTCGGATCGCCGTTGCTGCC: SEQ ID NO: 153) As another pair, Irgq F (CGGCCCGGGCGATAGCCAGAACGCGGCGAAAGCGCGCGATGAAACCGCGGCGCTGCTGAACAGCGCGGTGCTGGGCGCGGCGCCG: SEQ ID NO: 154) and Irgq R (CaCCCGGCGCCGCGCCCAGCACCGCGCTGTTCAGCAGCGCCGCGGTTTCATCGCGCGCTTTCGCCGCGTTCTGGCTATCGCCCGG: SEQ ID NO: 155) as another pair.

[0180] Among TM1112-M44-PSBD-His, TM1112-M30-PSBD-His, TM1112-M12-PSBD-His and TM1112-M21-PSBD-His, TM1112-M30-PSBD-His was the same as TM-M30-PS, and the others were prepared by cutting TM1112-BsaI-PSBD-His with BsaI and ligating it with each pair of the following annealed DNA fragments: M44 F and M44 R as a pair, M12 F (aGgaACCCCGCCGCCGGAAGAAGCGATGCCGTTTGAATTTAATGGTCCGGCGCAGGGTGATCATAGCCAGCCGCCGCTGCAGGTG: SEQ ID NO: 115) and M12 R (CACCCACCTGCAGCGGCGGCTGGCTATGATCACCCTGCGCCGGACCATTAAATTCAAACGGCATCGCTTCTTCCGGCGGCGGGGT: SEQ ID NO: 116) as another pair, M21 F (aGgaAGCAGCCCGGATGAAGTGGCGCTGGTTGAAGGTGTGCAGAGCCTGGGTTTTACCTATCTGCGTCTGAAAGATAATTATATG: SEQ ID NO: 147) and M21 R (CACCCATATAATTATCTTTCAGACGCAGATAGGTAAAACCCAGGCTCTGCACACCTTCAACCAGCGCCACTTCATCCGGGCTGCT: SEQ ID NO: 148) as another pair.

[0181] For easy purification of the respective constructs, a His tag was attached to the rear side, and in order to minimize the effect of the addition of this tag sequence on the physical properties of the protein, two glycine linkers were inserted, and between the fusion protein and the epitope, linkers GGGGG or GGGGS or both were inserted for the same purpose.

[0182] As competent cells for cloning, DH5alpha strain (Enzynomics) was used, heat shock was applied for 1 minute and 30 seconds, then stabilized in LB medium for 1 hour, and then selected by plating in solid medium containing antibiotic markers. One to two colonies were grown in 2 ml LB medium for 6 to 8 hours, overnight at 37°C (12 to 16 hours), miniprepped to obtain vectors, and then a portion of each vector was used for sequence analysis.

[0183] 3-2. Cultivation

[0184] For sequence-confirmed vectors, transformation was performed in the clearcoli BL21 (DE3) strain for culture. When electroporating competent cells for the corresponding strains, each mixture of DNA and competent cells was placed in a separate small dish and electroporated. Stabilize in LB medium for 1 hour, and then select by plating in a solid medium containing antibiotic markers. After inoculating a colony into 3 ml of LB medium containing antibiotics at 37°C overnight (16 to 20 hours), it was inoculated twice in 1.2 L of medium the next morning. When OD grew at a level of 0.7 to 1.2, a 0.2 mM concentration of IPTG solution was added for induction, and the culture temperature was reduced from 37°C to 25°C. After culturing overnight, the cells were recovered the next day.

[0185] 3-3. Microbial cell recovery and lysis

[0186] The culture solution containing the recombinant anticancer vaccine expressed for treatment was transferred to a 1 L bottle for centrifugation. The centrifugation conditions were 5±3°C, 7000 rpm, 5 minutes. The supernatant was discarded and the precipitated microbial cells were recovered. After suspending the microbial cells recovered after centrifugation with a lysis solution (20 mM sodium phosphate, 0.3 M NaCl, 10 mM imidazole, 1 mM PMSF pH8.0), the cells were lysed using an ultrasonic generator. After lysis, the cell lysate was transferred to a 50 mL bottle for centrifugation. The centrifugation conditions were 5±3°C, 40,000×g, 30 minutes, and the supernatant was purified by an Akta pure system.

[0187] 3-4. Purification

[0188] Purification of recombinant anticancer vaccines for therapeutic use using filtration and two-step column chromatography.

[0189] Step 1: Ion Metal Affinity Chromatography (IMAC)

[0190] The metal ion affinity column (cobalt fixed column) was equilibrated using 20 mM sodium phosphate / 0.3 M sodium chloride / 10 mM imidazole buffer. After lysis, the centrifugation supernatant was filtered through a 0.22 μm filter and then loaded onto the column and washed with 20 mM sodium phosphate / 0.3 M sodium chloride / 10 mM imidazole buffer (pH 8.0). Subsequently, the recombinant anticancer vaccine was eluted using 20 mM sodium phosphate / 0.3 M sodium chloride / 150 mM imidazole buffer (pH 8.0).

[0191] Step 2: Size Exclusion Chromatography (SEC)

[0192] A size exclusion chromatography column (Hiload Superdex G75) was equilibrated with a phosphate-buffered saline solution. The eluate eluted from the metal ion affinity column was loaded on the column, and then the ultraviolet absorbance (280 nm) was monitored, and fractions at an elution point of about 20 kD were collected.

[0193] Step 3: Sterile Filtration

[0194] Perform process control (anti-cancer vaccine protein concentration) on the obtained fractions. Determine if additional concentration is needed to meet the protein concentration target. Concentrate them if necessary to achieve a final protein concentration of 2.0 mg / mL or more.

[0195] Finally, the anticancer vaccine protein was filtered (0.22 μm) and distributed in a sterilized 1.5 mL polyethylene (Cyrotube) container. In this step, as in the process control (IPC), confirmation tests (SDS-PAGE), protein content (UV method), endotoxin content (kinetic method), and purity test (SE-HPLC) were performed, and the results were as follows: Figure 1 , Figure 2 As shown in Table 7 ( Figure 1 The results for hT-CT25-PSBD are as follows: Figure 2 The final sterilized anticancer vaccine active substance was stored at -70±10°C.

[0196] 3-5. Preparation of recombinant anti-cancer vaccine proteins for therapeutic use

[0197] The preparation of therapeutic recombinant anticancer vaccine proteins is carried out in a biological safety cabinet (BSC). The required volume of each anticancer vaccine active substance is calculated based on the batch volume and anticancer vaccine protein concentration. In addition, the combined anticancer vaccine protein is diluted to the target concentration by adding a buffer containing sodium chloride, phosphate (pH 7.4) and polysorbate 80. After thorough mixing, the prepared therapeutic anticancer vaccine is mixed with Poly IC and administered to animals.

[0198] Table 8 below shows the final composition of the therapeutic recombinant anti-cancer vaccine in adjuvant form.

[0199] Example 4. Removal of endotoxin using size exclusion chromatography

[0200] The host cell Escherichia coli used in the present invention is a Gram-negative bacterium, which is a substance that secretes endotoxins and causes safety problems when injected into the body. Therefore, protein drugs using Escherichia coli as host cells must be thoroughly quality controlled for endotoxins, and the endotoxin removal process should be verified. Therefore, in the present invention, size exclusion chromatography is used to perform quality control on trace endotoxins.

[0201] Endotoxins of Gram-negative bacteria are in the form of lipopolysaccharides (LPS), which are hydrophilic and hydrophobic, and will form micelles under certain concentrations and conditions. By forming endotoxin micelles, the size of endotoxins is increased. In the present invention, a substance with a molecular weight as small as possible is designed to separate endotoxin micelles and target proteins in size exclusion chromatography. As a result of actually collecting fractions according to retention time and analyzing the endotoxin content, the endotoxin content decreases from the fraction with a short retention time (large size) to the fraction with a long retention time (small size). Through this method, it is confirmed that the fraction corresponding to the size of the anti-cancer vaccine protein contains trace amounts of endotoxins.

[0202] Endotoxin content of size exclusion chromatography fractions was determined as Figure 3 As shown in Table 9 ( Figure 3 ) are the results for TrxA-M30-His and are the arrangement for observing endotoxin differences according to SEC fractions, corresponding to the batch number: pc0735 described in Table 3).

[0203] Example 5. Evaluation of the immunogenicity of anticancer vaccines

[0204] In order to evaluate whether the anticancer vaccine composition prepared in the above examples induces an immune response in mice, a study was conducted to confirm the immune response by conducting ELISPOT on the concentration of interferon gamma (IFN-γ).

[0205] In addition, at least 1 to 4 anti-cancer vaccine proteins were mixed at 1 to 10 nmol each and injected subcutaneously. Poly IC (Invvivogen) was mixed into the anti-cancer vaccine protein at 50 ug per mouse and administered twice a week for 2 weeks. Immunogenicity was confirmed by mouse spleen 4 to 5 days after the last vaccination. The details are as follows.

[0206] 5-1. Mouse Uniform Anticancer Model

[0207] Six-week-old female C57BL / 6 mice and Balb / c mice were purchased from Koatech and acclimated for one week before the start of the study. 100 ul of mouse melanoma cell line B16-F10 (5×10 4 ) or mouse colorectal cancer cell line CT26 (1×10 6 ) were subcutaneously transplanted into the right flank of mice. Before inoculation, cells were cultured for up to 5 times in DMEM or RPMI medium supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine. Cells were cultured in a 37°C, 5% CO2 incubator. When filled with 80% to 90% cells, cells were harvested and resuspended in a 1:1 mixture of serum-free medium and Matrigel.

[0208] For mice, measurements were taken three times a week after cell transplantation. For tumor measurements, the length and width of each tumor were measured using calipers, and the volume was calculated according to the following formula: Tumor volume (mm 3 ) = (Width (mm) 2 × length (mm) / 2). All tumors were measured 5 to 10 days after inoculation and divided into groups (8 to 10 mice / group). The average tumor volume of all animals was 50 to 100 mm 3 The anticancer vaccine substance (10 nmol) and polyIC (50 ug) were administered by subcutaneous injection of 300 ul twice a week for 2 weeks, when the tumor volume reached 1000 to 2000 mm 3 Tumors were measured continuously.

[0209] Therefore, if Figure 4 and Figure 5 As shown, in the case of the MC38 model, TCV001 and the peptide mixture showed equivalent tumor regression results. This was statistically significant compared to the vehicle control. In the case of the CT26 model, TCV001 showed strong anticancer efficacy, and the tumor reduction was statistically significant compared to the peptide mixture.

[0210] As a sample of TCV001 used in the mouse uniform anticancer model, the new antigen was mixed with a recombinant protein for antigen delivery having the structure of Table 3. For the CT26 model, pc0885 (CT4), pc0886 (CT5) and pc0888 (CT24) were mixed and used, and for the MC38 model, pc1304 (Cpne1), pc1307 (Irgq) and pc1308 (Aatf) were mixed and used as antigens. In the case of a peptide mixture, a synthetic peptide antigen having the amino acid sequence of Table 1 was mixed and used. For the CT26 model, CT4, CT5 and CT24 were mixed and used, and for the MC38 model, Cpne1, Irgq and Aatf were mixed and used as antigens.

[0211] 5-2. TIL analysis

[0212] In order to measure the activity of lymphocytes present in the tumor, FACS analysis was performed (4 mice / group). When the tumor of the mouse grew to the appropriate size, it was removed and then chopped with scissors. Collagenase was used and shaken at 200 rpm for 1 hour at 37°C. After centrifugation and washing with HBSS, fercoll was used to obtain the lymphocyte fraction. The obtained lymphocytes were treated with PMA, ionomycin and transport inhibitors and then cultured in a 37°C, 5% CO2 incubator for 4 hours. After permeation and fixation, CD45, CD4, CD8 and IFN-r antibodies were stained for 15 minutes. After a washing process, FACS analysis was performed.

[0213] Therefore, if Figure 6 , Figure 7 and Figure 8 As shown, hTrx-epitope-PSBD and TM1112-epitope-PSBD increased activated T cells in TILs compared to the peptide mixture. This result was not shown in all animal models, but T cell activation was increased overall.

[0214] As samples of hTrx-epitope-PSBD used in TIL analysis, the new antigen was mixed with a recombinant protein for antigen delivery having the structure of Table 3. For the CT26 model, pc0885 (CT4), pc0886 (CT5) and pc0888 (CT24) were mixed and used, for the MC38 model, pc1304 (Cpne1), pc1307 (Irgq) and pc1308 (Aatf) were mixed and used, and for the B16F10 model, pc924 (M44), pc923 (M30), pc903 (M12) and pc933 (M21) were mixed and used as antigens. In the case of the peptide mixture, the synthetic peptide antigens having the amino acid sequence of Table 1 were mixed and used. For the CT26 model, CT4, CT5, and CT24 were mixed and used, for the MC38 model, Cpne1, Irgq, and Aatf were mixed and used as antigens, and for the B16F10 model, M44, M30, M12, and M21 were mixed and used as antigens. As samples of TM1112-epitope-PSBD, pc0924 (M44), pc0923 (M30), pc0903 (M12), and pc0933 (M21) were mixed and used as antigens.

[0215] According to the above description, those skilled in the art to which the present invention belongs will be able to understand that the present invention can be implemented in other specific forms without changing its technical purpose or basic features. Therefore, it should be understood that the above embodiments are illustrative in all aspects, rather than restrictive. The scope of the present invention should be understood to include all changes or modifications derived from the meaning and scope of the claims and their equivalent principles rather than from the specific embodiments.

Claims

1. A fusion protein comprising Peptide antigens, and A carrier protein is linked to the N-terminus, C-terminus or both of the peptide antigens.

2. The fusion protein according to claim 1, The fusion protein comprises a peptide antigen, a first carrier protein connected to the N-terminus of the peptide antigen, and a second carrier protein connected to the C-terminus of the peptide antigen.

3. The fusion protein according to claim 2, In the fusion protein, the affinity tag is connected to its N-terminus, C-terminus or both.

4. The fusion protein according to claim 2, Wherein a linker exists between the peptide antigen and the first carrier protein, or a linker exists between the peptide antigen and the second carrier protein, or both.

5. The fusion protein according to claim 1, Wherein the peptide antigen comprises a T cell epitope.

6. The fusion protein according to claim 1, The peptide antigen comprises a T cell epitope derived from a tumor antigen, an infectious antigen, a self antigen or an allergy-inducing antigen.

7. The fusion protein according to claim 6, The tumor antigen comprises a tumor-associated antigen (TAA), a tumor-specific antigen (TSA) or a tumor-derived new antigen.

8. The fusion protein according to claim 7, The tumor-derived neoantigens comprise mutations that are specifically expressed in cancer cells.

9. The fusion protein according to claim 7, The tumor-associated antigen (TAA) is CT (testicular cancer) antigen, EGFR, M12, M20, M21, M30, M44, Ova, Melan-A, PSMA (prostate-specific membrane antigen), survivin, MAGE-A, ADAbp (adenosine deaminase binding protein), cyclophilin b, gp100, CRC (colorectal-associated antigen)-C017-1 A / GA733, CEA (carcinoembryonic antigen), CAP-1, CAP-2, etv6, AML1, PSA (prostate-specific antigen), PSA-1, PSA-2, PSA-3, MAGE (melanoma antigen E), GAGE ​​(G antigen), BAGE (B melanoma antigen), RAGE (renal tumor antigen), LAGE (L antigen), NAG, GnT-V, MUM-1, CDK4, p53, tyrosinase, Muc1 (mucin 1), HER2 / neu, p21ras, N-RAS, K-RAS, RCAS1, α-fetoprotein, E-cadherin, α-catenin, β-catenin, γ-catenin, p120ctn, PRAME, NY-ESO-1, TRP2, mammaglobulin-A, metallo-pan-kinase-1 (MPS-1), cytochrome P450 isoform 1B1, 90K / Mac-2 binding protein, Ep-CAM (MK-1), HSP-70, hTERT (TRT), LEA, TAGE-1, 5T4, gp70, SCP-1, c-myc, cyclin B1, MDM2, p62, Koc, IMP1, TA90, OA1, CT-7, HOM-MEL-40 / SSX-2, SSX-1, SSX-4, HOM-TES-14 / SCP-1, HOM-TES-85, HDAC5, MBD2, TRIP4, NY-CO-45, KNSL6, HIP1R, Seb4D, KIAA1416, IMP1, 90K / Mac-2 binding protein, MDM2, or LMNA.

10. The fusion protein according to claim 6, The infectious antigen is an antigen derived from a virus, bacteria, parasite or fungus.

11. The fusion protein according to claim 1, The carrier protein is a protein that improves the recombinant expression of the peptide antigen or improves the purification of the peptide antigen.

12. The fusion protein according to claim 2, The first carrier protein is a protein that improves the recombinant expression of the peptide antigen, and the second carrier protein improves the improvement of the peptide antigen.

13. The fusion protein according to claim 2, The first carrier protein and the second carrier protein are the same or different, and are respectively at least one of NDPK (nucleoside diphosphate kinase B), CSTA (cystatin-A), Trx (thioredoxin), RPL7Am (50S ribosomal protein L7Ae), Samp2a (microarchaea modification protein 2), TE (tendon protein), TM1112 (protein containing Thermotoga maritima Cupin-3 domain), TrxA (thioredoxin 1), TTrx (Thermosiphoafricanus thioredoxin), PSBD (peripheral subunit binding domain) or a fragment thereof.

14. The fusion protein according to claim 3, The affinity tag is His or streptavidin.

15. The fusion protein according to claim 4, The linker is (GS)n, (G2S)n, (G3S)n, (G4S)n, Gn, LE, SSGG or GGGGSGGGGG (wherein, G is Gly, S is Ser, L is Leu, E is Glu, and n is an integer of at least 1).

16. The fusion protein according to claim 1, The size of the fusion protein is less than 30 kDa.

17. A nucleic acid molecule encoding the fusion protein according to any one of claims 1 to 16.

18. An expression vector comprising the nucleic acid molecule according to claim 17.

19. A cell transformed with the expression vector according to claim 18.

20. An immunogenic composition comprising The fusion protein according to any one of claims 1 to 16; A nucleic acid molecule encoding the fusion protein; An expression vector comprising the nucleic acid molecule; or Cells transformed with the expression vector.

21. The immunogenic composition of claim 20, further comprising an adjuvant.

Images