Multi-component system for site-specific genome modification

Abstract

The present invention includes systems, compositions, and methods for modular gene editing by reverse transcriptase related methods. Systems and methods of using modified nucleotides and peptides are provided, inter alia. Introduction of transgenes into eukaryotic genomes provides a huge opportunity to improve, correct and / or alter gene expression, while being used to treat or alleviate disease symptoms. Successive transgene insertion will result in rescuing from lost function mutations, inhibiting function-acquired mutations, extrinsic control of RNA and / or protein expression, introduction of isoform expression specific, engineered gene and protein expression, and other useful results.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 63 / 337,564, filed May 2, 2022, the disclosure of which is hereby incorporated by reference in its entirety for all purposes.

[0003] Reference to a sequence listing

[0004] This application is submitted with a sequence listing in electronic format. The sequence listing file is named [[XXXX.xml]], was created on [[XX]], and is [[XX]] bytes in size. The electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0005] Government Support Statement

[0006] This invention was made with government support under Grant Nos. GM139306 and HL156819 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0007] Background of the Public Content

[0008] The introduction of transgenes into eukaryotic genomes offers tremendous opportunities to improve, correct, and / or alter gene expression, and to treat or alleviate disease symptoms. Successful transgene insertion can enable rescue from loss-of-function mutations, suppression of gain-of-function mutations, exogenous control of RNA and / or protein expression, introduction of isoform expression specificity, engineering of gene and protein expression, and other beneficial outcomes.

[0009] At present, the method that genetic material is introduced into cell for inserting into genome still has major obstacle to overcome.For example, the method for DNA delivery to target cell needs DNA to pass through the cytoplasm of cell, and this often brings out destructive or harmful immune response.In addition, the method for introducing the DNA site-specific integration into genome by homologous recombination (HR) introduces double-stranded DNA break that potentially causes mutation, and destroys the subject's genome and epigenome at integration site.In higher eukaryotes, especially in the cell after mitosis, this DNA integration is often not site-specific, because in most of cell cycle, HR is suppressed, is conducive to non-homologous end joining.

[0010] An efficient, site-specific method for inserting transgenes into the genome of living cells with flexibility in DNA length, accomplished without potential effects on DNA in the cytoplasm, would be a tremendous contribution to human, animal, microbial, and plant biology, with powerful research and clinical applications.

[0011] One approach would be to introduce the transgene sequence as RNA that can serve as a template for the synthesis of complementary DNA (cDNA) by reverse transcriptase (RT). However, no molecular signal has yet been identified that would enable the RNA introduced into mammalian cells to be replicated as a template for insertion of the transgene into the genome.

[0012] A class of genes known as non-long terminal repeat (LTR) retrotransposons (REs), also known as non-LTR retrotransposons, offers an exciting potential solution. These genes are capable of self-amplification within their host genomes. They function by expressing non-LTR retrotransposon RT proteins (RTs), which use their own retrotransposon-transcribed RNA as a template and a nick in the genomic DNA (catalyzed by the RT protein's endonuclease (EN) domain) as a primer for initiating cDNA synthesis (RT primer extension) to bind and synthesize cDNA. This process, known as target-primed reverse transcription (TPRT), adds another copy of the double-stranded DNA retrotransposon to the genome.

[0013] WO2022 / 155055 describes a two-component system for inserting site-specific safe-harbor transgenes into the human genome. The two components are a non-LTR reverse transcription factor reverse transcriptase (RT) and a template RNA that matches the RT. The RT is engineered to achieve full-length transgene insertion, rather than the 5' insertion truncation favored by natural reverse transcription factors. The synthesis mechanism of the first inserted DNA chain is target-triggered reverse transcription (TPRT), guided by the template RNA 3' module and enhanced by the non-natural 3' tail portion of the 3' module. The role of the 5' module is to provide template RNA biological stability, improve the bioavailability of template RNA binding to RT protein, and guide the synthesis of the second chain.

[0014] The present disclosure provides compositions and methods for inserting and expressing transgenes into the genome of eukaryotic organisms, particularly human cells, by creating biopolymer constructs derived in part from retroelement sequences.

[0015] Overview of public content

[0016] The present invention provides compositions, methods and / or uses of proteins and nucleotides, as well as modified proteins and polynucleotides, that use components derived from non-long terminal repeat (non-LTR) retrotransposons to achieve targeted primed retrotransposition (TPRT) transgene insertion into the genome of a subject.

[0017] The present invention provides a system for genome editing, comprising (i) at least one reverse transcriptase construct (RTC), wherein the RTC comprises a polynucleotide encoding a polypeptide having an enzymatic activity for reverse transcribing a polynucleotide template; and (ii) at least one gene insertion construct (GIC), wherein the GIC comprises at least one polynucleotide template suitable for reverse transcription of a polypeptide encoded by the at least one RTC.

[0018] In some embodiments, a system for genome editing comprises:

[0019] (i) at least one reverse transcriptase construct (RTC), said RTC comprising at least one reverse transcriptase module (RTC:RT module), at least one reverse transcriptase construct 5' module (RTC:5' module) and / or at least one reverse transcriptase construct 3' module (RTC:3' module), said reverse transcriptase module (RTC:RT module) comprising mRNA encoding reverse transcriptase (RT), and

[0020] (ii) at least one gene insertion construct (GIC), said GIC comprising at least one RNA template suitable for reverse transcription of a polypeptide encoded by at least one RTC, wherein said at least one gene insertion construct comprises at least one GIC:5' module, at least one GIC:payload module and / or at least one GIC:3' module.

[0021] In some embodiments, the RT module comprises an mRNA encoding RT from an organism selected from a bird, an arthropod, a fish, a tunicate, or other animal, including a mammal and a human.

[0022] In some embodiments, a system for genome editing comprises:

[0023] i) an RTC 5' module comprising a 5' untranslated region (5'-UTR), a Kozak sequence, a non-natural translation start codon and / or a 5' cap;

[0024] ii) RT module, which contains the encoding of a gene from the group consisting of white-throated sparrow (Zonotrichia albicollis, ZoAl), chestnut-eared grass finch (Taeniopygia guttata, TaGu), white-throated mRNAs of RT from organisms such as Tinamus guttatus (TiGu), Oryzias latipes (OrLa), and Tribolium castaneum (lineage B), TriCasB;

[0025] iii) RTC 3' module, which contains the reverse transcriptase translation stop codon, the 3' untranslated region (3'UTR) and the poly-A tail;

[0026] iv) GIC: 5' module comprising a sequence derived from the 5' region of a natural retromer, an rRNA sequence, a ribozyme sequence, a folding motif sequence and / or an RNA polymerase I terminator sequence;

[0027] (v) GIC: a payload module comprising at least one transgene ORF or noncoding RNA (ncRNA) sequence, a transgene promoter sequence or internal ribosome entry site (IRES), a transgene 5' untranslated sequence, a transgene 3' untranslated sequence, a transgene polyadenylation signal sequence, and / or a transgene ncRNA processing sequence; and

[0028] (iv) GIC: 3' module, which contains a reverse transcriptase recognition sequence, an rRNA sequence and / or an A-Tract sequence.

[0029] In some embodiments, at least one reverse transcriptase construct comprises at least one biopolymer comprising at least one nucleic acid, at least one amino acid, and any combination thereof. In some embodiments, the RTC polynucleotide of (i) above comprises an mRNA encoding a reverse transcriptase. In some embodiments, the GIC polynucleotide template of (ii) above comprises RNA. In some embodiments, the polynucleotide of (i) above comprises an mRNA encoding a reverse transcriptase, and the GIC polynucleotide template of (ii) above comprises a separate (different) RNA. In some embodiments, the GIC comprises an RNA template different from the mRNA encoding the RT of (i).

[0030] In some embodiments, at least one reverse transcriptase construct comprises at least one reverse transcriptase open reading frame (ORF) module (RTC:RT-module), optionally at least one reverse transcriptase construct 5' untranslated region (UTR) module (RTC:5'module), optionally at least one reverse transcriptase construct 3'UTR module (RTC:3'module), and any combination thereof.

[0031] In some embodiments, at least one reverse transcriptase module comprises or encodes at least one reverse transcriptase.

[0032] In some embodiments, at least one reverse transcriptase module comprises or encodes at least one reverse transcriptase from a non-long terminal repeat (non-LTR) reverse transcription element.

[0033] In some embodiments, at least one reverse transcriptase comprises or encodes a non-natural translation initiation codon.

[0034] In some embodiments, the at least one reverse transcriptase comprises at least one DNA binding domain, at least one RNA binding domain, at least one cDNA synthesis domain, at least one endonuclease domain, and any combination thereof.

[0035] In some embodiments, at least one of the at least one reverse transcriptase domain, at least one subject DNA-binding domain, at least one template RNA-binding domain, and at least one endonuclease domain, and any combination thereof, is derived from a reverse transcriptase that is different from at least one of the other at least one reverse transcriptase domain, at least one subject DNA-binding domain, at least one template RNA-binding domain, and at least one endonuclease domain.

[0036] In some embodiments, at least one reverse transcriptase construct 5' module comprises or encodes at least one RNA polymerase promoter, at least one 5' untranslated region (5'-UTR), at least one Kozak sequence, at least one 5' cap, and any combination thereof.

[0037] In some embodiments, at least one reverse transcriptase construct 3' module comprises or encodes at least one reverse transcriptase translation stop codon, at least one 3' untranslated region (3'UTR), at least one poly-A region and / or tail, and any combination thereof.

[0038] In some embodiments, at least one reverse transcription module comprises or encodes at least one Figure 2-5 The illustrated structure or any combination thereof.

[0039] In some embodiments, the at least one reverse transcriptase construct comprises, encodes, or is encoded by at least one of SEQ ID NOs 1 to 57. In some embodiments, the at least one reverse transcriptase construct comprises mRNA encoding an RT protein from one selected from the group consisting of TriCasB, NaViB, OrLa, ZoAl, TiGu, TaGu, GeFo, DroSi, BoMo.DrMerc, DrMe, GaAc, PuPu, AdVa, HyMaA, CiIn, LiPo, TriCan, LeCo, and any combination thereof.

[0040] In some embodiments, at least one gene insertion construct comprises or encodes at least one nucleic acid biopolymer. In some embodiments, the gene insertion construct comprises a template RNA.

[0041] In some embodiments, at least one gene insertion construct comprises or encodes at least one optional GIC:5' module, at least one GIC:payload module, at least one optional GIC:3' module, and any combination thereof.

[0042] In some embodiments, at least one GIC:5' module comprises or encodes at least one sequence derived from the 5' region of a native retroelement, optionally at least one GIC:5' module rRNA sequence, optionally at least one GIC:5' module ribozyme (RZ) sequence, optionally at least one GIC:5' module folding motif sequence, or any combination thereof.

[0043] In some embodiments, the optional at least one GIC: 5' module rRNA sequence comprises or encodes 1 to 30 nt of a subject rRNA.

[0044] In some embodiments, the optional at least one GIC:5' module ribozyme sequence comprises or encodes at least one self-cleaving ribozyme, optionally wherein the self-cleaving ribozyme comprises a hepatitis delta virus (HDV) ribozyme.

[0045] In some embodiments, the optional at least one GIC:5' module ribozyme sequence comprises or encodes a ribozyme derived from the 5' region of at least one non-long terminal repeat retrotransposition factor. In some embodiments, the optional at least one GIC:5' module folding motif sequence comprises or encodes at least one autonomously folding RNA sequence motif, optionally wherein the autonomously folding RNA sequence motif comprises at least one hairpin motif, at least one stem-loop motif, at least one paired stem motif, or any combination thereof within the RZ.

[0046] In some embodiments, the GIC: 5' module comprises or encodes at least one of SEQ ID NOs 60-154, or a sequence that is at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to at least one of SEQ ID NOs 60-154. In some embodiments, the GIC: 5' module comprises a sequence from a genus selected from the group consisting of OrLa, TriCasB, TriCasA, ZoAl, TiGu, DroSi, LeCo, CiIn, FoRa, TriCan, HDV-28, HDV-24, HDV-21, HDV-13, HDV-36, or any combination thereof.

[0047] In some embodiments, at least one GIC:3' module comprises or encodes at least one GIC:3' module reverse transcriptase recognition sequence, optionally at least one GIC:3' module rRNA sequence, optionally at least one GIC:3' module A-region sequence, or any combination thereof.

[0048] In some embodiments, at least one GIC:3' module reverse transcriptase recognition sequence comprises or encodes at least one sequence that interacts with at least one reverse transcriptase. In some embodiments, at least one GIC:3' module reverse transcriptase recognition sequence comprises a sequence selected from SEQ ID NOs 200-224.

[0049] In some embodiments, at least one GIC:3' module reverse transcriptase recognition sequence is derived from the 3' region of a natural retrotransposition factor.

[0050] In some embodiments, the optional at least one GIC: 3' module rRNA sequence comprises or encodes an rRNA of 1 to 30 nt.

[0051] In some embodiments, the optional at least one GIC: 3' module A-region sequence comprises or encodes a sequence of 1 to 50 adenine bases.

[0052] In some embodiments, at least one GIC: 3' module comprises or encodes at least one of SEQ ID NOs 200-224 or at least one of SEQ ID NOs 300-329. In some embodiments, the GIC: 3' module comprises a sequence from a species selected from the group consisting of OrLa, TriCasB, TaGu, GeFo, ZoAl, NaViB, DroSi, PuPu, LiPo, BoMo, GaAc, LeCo, CiIn, DrMe, DrNa, DrMer, TriCan, AdVa, HyMaA, or any combination thereof.

[0053] In some embodiments, at least one GIC:payload module comprises or encodes at least one transgene ORF sequence, optionally at least one transgene promoter sequence, optionally at least one transgene 5' untranslated sequence, optionally at least one transgene 3' untranslated sequence, optionally at least one transgene polyadenylation signal sequence, optionally at least one transgene non-coding RNA (ncRNA), optionally at least one ncRNA processing sequence and / or other optional 3' end processing or stabilization signals, or any combination thereof.

[0054] In some embodiments, at least one transgenic sequence comprises or encodes at least one sequence of interest for insertion into the genome of a subject.

[0055] In some embodiments, at least one transgene promoter sequence comprises or encodes at least one sequence that promotes expression of the transgene in the genome of the subject.

[0056] In some embodiments, at least one GIC:payload module comprises or encodes at least one transgene 5' untranslated sequence comprising or encoding at least one transgene mRNA 5' untranslated region.

[0057] In some embodiments, the at least one transgene 3' untranslated sequence comprises or encodes at least one transgene mRNA 3' untranslated region.

[0058] In some embodiments, the at least one transgene polyadenylation signal sequence comprises or encodes at least one transgene polyadenylation signal.

[0059] In some embodiments, at least one transgenic noncoding RNA (ncRNA) processing sequence and / or other optional 3' end processing or stabilization signal comprises or encodes at least one termination signal, at least one 3' processing signal, and any combination thereof for at least one transgenic expressed ncRNA.

[0060] In some embodiments, at least one GIC:payload module comprises or encodes a sequence that is at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to at least one of SEQ ID NOs 411-422 or SEQ ID NOs 499-536, or any combination thereof.

[0061] In some embodiments, at least one of the at least one GIC:5' module and the at least one GIC:3' module comprises or encodes at least one sequence derived from a different non-long terminal repeat retroelement species than at least one of the other at least one GIC:5' module and the at least one GIC:3' module.

[0062] In some embodiments, at least one gene insertion construct comprises or encodes the gene shown in FIG. Figure 6-9 At least one structure illustrated in the figure and any combination thereof.

[0063] In some embodiments, the system comprises: (i) at least one reverse transcriptase construct, wherein the at least one reverse transcriptase construct comprises, encodes, or is encoded by at least one sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs 1-57, and (ii) at least one gene insertion construct, wherein the at least one gene insertion construct comprises at least one sequence that is at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to a sequence selected from the group consisting of SEQ ID NOs 60-154, 250-276, 278-279, 280-289, 300-329, 400-404, 405-407, 411-422, or 499-536. In some embodiments, the mRNA sequence transfected to produce the RT protein is isolated from a plasmid and encodes the protein amino acid sequence.

[0064] In some embodiments, the system comprises:

[0065] (i) at least one reverse transcriptase construct, wherein the at least one reverse transcriptase construct comprises or is encoded by at least one sequence that is at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical) to a sequence selected from the group consisting of SEQ ID NOs 1-57; and

[0066] (ii) at least one gene insertion construct, wherein the at least one gene insertion construct comprises:

[0067] GIC: a 5' module comprising a sequence that is at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to a sequence selected from SEQ ID NOs: 60-154;

[0068] An rRNA sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 250-276, or a sequence having one, two, or three nucleotide changes relative to a sequence selected from the group consisting of SEQ ID NOs: 250-276; or a sequence not comprising an rRNA sequence;

[0069] A GIC comprising at least one transgene sequence: a payload module; and

[0070] GIC: a 3' module comprising a sequence that is at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to a sequence selected from SEQ ID NOs 300-329;

[0071] GIC: 3' module reverse transcriptase recognition sequence comprising a sequence having at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity) to a sequence selected from SEQ ID NOs 200-224;

[0072] A GIC: 3' module rRNA sequence selected from SEQ ID NOs 280-289, or a sequence thereof comprising one, two or three nucleotide substitutions; and

[0073] GIC: 3' module A-region sequence containing 1 to 100 adenine bases.

[0074] In some embodiments, the RTC 5' module 5'UTR comprises a sequence at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to SEQ ID NO:58.

[0075] In some embodiments, the RTC 3' module 3'UTR comprises a sequence at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to SEQ ID NO:59.

[0076] In some embodiments, the system comprises a gene insertion construct synthetic construct (GIC: synthetic construct) comprising or encoding at least one gene insertion construct described herein.

[0077] In some embodiments, at least one of the at least one reverse transcriptase construct and the at least one gene insertion construct comprises or encodes at least one sequence that is derived from a different species of reverse transcription factor than at least one of the other at least one reverse transcriptase construct and the at least one gene insertion construct.

[0078] In some embodiments, a system for genome editing includes a combination of at least one of (i) at least one reverse transcriptase construct described herein and (ii) at least one gene insertion construct described herein.

[0079] Also provided is a method for inserting at least one transgene into the genome of a subject, the method comprising administering to the subject an effective amount of at least one gene insertion system (GIS) of the present disclosure.

[0080] In some embodiments, a transgene is inserted into one or more target sites in the genome of a subject, optionally wherein the one or more target sites include at least one safe harbor site.

[0081] In some embodiments, the optional at least one safe harbor site comprises at least one ribosomal DNA (rDNA) sequence, optionally wherein the at least one ribosomal DNA sequence includes at least one 28S rDNA sequence.

[0082] In some embodiments, at least one method comprises administering at least one gene insertion system formulated with at least one delivery agent.

[0083] In some embodiments, the at least one delivery agent is at least one nanoparticle, optionally wherein the at least one nanoparticle comprises at least one lipid nanoparticle.

[0084] Also provided is a pharmaceutical composition comprising at least one gene insertion system according to claim 1, and optionally at least one of at least one excipient, at least one delivery agent, at least one adjuvant, and any combination thereof.

[0085] Also provided is a method of treating a therapeutic indication in a subject in need thereof, comprising administering to the subject an effective amount of at least one gene insertion system of the present disclosure or at least one pharmaceutical composition of the present disclosure.

[0086] In some embodiments, the indication for treatment is due to loss of telomerase activity.

[0087] In some embodiments, at least one gene insertion system comprises at least one TERT transgene.

[0088] Also provided is a kit for making a gene insertion system of the present disclosure. In some embodiments, the kit comprises a pharmaceutical composition of the present disclosure. In some embodiments, the kit optionally further comprises a buffer, a DNA plasmid, or a protocol for preparing the gene insertion system or pharmaceutical composition.

[0089] Also provided is a method comprising de novo design of a 5' module that recruits host machinery for second strand nicking and, thereby, second strand synthesis. In embodiments, the method provides for efficiency of insertion gain by de novo design of a 5' module to (a) encompass a predetermined rRNA length and position (described herein), (b) have an enhanced RZ fold, and / or (c) recruit host cell machinery.

[0090] In another aspect, the present disclosure provides a method for inserting at least one transgene into the genome of a cell, the method comprising contacting the cell with at least one gene insertion system (GIS) of the present disclosure.

[0091] In some embodiments, the transgene is inserted into one or more target sites in the genome of the subject, optionally wherein the one or more target sites include at least one safe harbor site. In some embodiments, the optional at least one safe harbor site comprises at least one ribosomal DNA (rDNA) sequence, optionally wherein the at least one ribosomal DNA sequence includes at least one 28S rDNA sequence.

[0092] In some embodiments, the method comprises administering at least one gene insertion system formulated with at least one delivery agent. In some embodiments, the at least one delivery agent is at least one nanoparticle, optionally wherein the at least one nanoparticle comprises at least one lipid nanoparticle.

[0093] In some embodiments, the transgene is inserted with greater than 90% target site specificity (e.g., greater than 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% target site specificity).

[0094] In some embodiments, the RTC comprises a gene encoding a gene from the white-throated sparrow (ZoAl), chestnut-eared grass finch (TaGu), or white-throated (TiGu), or comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 27, SEQ ID NO: 29, or SEQ ID NO: 25.

[0095] In some embodiments, the transgene is expressed at the target site for 3 months or longer.

[0096] In some embodiments, the cell is contacted with GIS, wherein the molar ratio of RTC to GIC is about 10:1 to 1:20.

[0097] In some embodiments, the method is an in vitro method, an ex vivo method, or an in vivo method.

[0098] In some embodiments, the cell is selected from the group consisting of a primary cell, a transformed cell, an epithelial cell, a fibroblast, a human cell, a monkey cell, and a mouse cell.

[0099] In some embodiments, the cells are allogeneic cells or autologous cells. In some embodiments, the autologous cells are HLA-matched cells.

[0100] The invention includes all combinations of specific embodiments described herein, as if each combination had been expressly described. BRIEF DESCRIPTION OF THE DRAWINGS

[0102] Figure 1 is a diagram illustrating an example subject genome comprising a target insertion site and a native retroelement. The expanded view (bottom) illustrates an example modular structure of the R2 native retroelement.

[0103] Figure 2 is a diagram illustrating the structure of an example reverse transcriptase construct (RTC).

[0104] Figure 3 is a diagram illustrating exemplary domains of the RT protein of the present invention.

[0105] Figure 4 is a diagram depicting exemplary source organisms for RT protein domains, which include a DNA binding domain (DB), an RNA binding domain (RB), a reverse transcriptase (RT) domain, and an endonuclease (EN) domain. Also illustrated is a diagram depicting a small set of example combinations of RT protein domains. Domain identity is defined by the organism in which wild-type RT is found, A1 being the White-throated Bunting (Zonotrichia albicollis), A2 being the Chestnut-eared Grassfinch (Taeniopygia guttata), and A3 being the White-throated (Tinamus guttatus), A4 is Geospiza fortis, B1 is Pungitis pungitis, B2 is Oryzias latipes, B3 is Gasterosteus aculeatus, C1 is Nasonia vitripennis, C2 is Drosophila melanogaster, C3 is Tribolium castaneum (lineage B), C4 is Bombyx mori, C5 is Drosophila asimulans, C6 is Drosophila mercatorum, D1 is Lepidurus scouseii, D2 is Triops cancriformis, E1 is Hydramagnipapillata, E2 is Limulus polyphemus), E3 is Adineta vaga, and E4 is Ciona intestinalis.

[0106] Figure 5 is a set of diagrams illustrating a series of exemplary RTCs of the present invention, comprising sequences comprising or encoding an RT protein (RT) comprising an RT translation initiation codon (M). The RTC may comprise a 5' untranslated sequence (5'-UTR), a translation stop codon (SC) and / or a 3' untranslated sequence (3'-UTR).

[0107] Figure 6 is a diagram illustrating the structure of an example gene insertion construct (middle). An expanded view shows the structure of an example 5' module (lower left), 3' module (lower right), and payload module (top).

[0108] Figure 7 is a diagram depicting exemplary source organisms for the GIC 5' module (5'M) component, the 3' module (3'M) component, and the RTC RT module (RT) component. Also illustrated is a diagram depicting a small set of possible example GICs having potential combinations of 5' and 3' modules flanking a payload module with a paired reverse transcriptase construct (paired RT). Module identity is defined by the organism in which wild-type retroelements and / or reverse transcriptases are found, wherein A1 is Zonotrichia albicollis, A2 is Taeniopygia guttata, and A3 is White-throated (Tinamus guttatus), A4 is Geospiza fortis, B1 is Pungitis pungitis, B2 is Oryzias latipes, B3 is Gasterosteus aculeatus, C1 is Nasonia vitripennis, C2 is Drosophila melanogaster, C3 is Tribolium castaneum (lineage B), C4 is Bombyx mori, C5 is Drosophila asimulans, C6 is Drosophila mercatorum, D1 is Lepidurus scouseii, D2 is Triops cancriformis, E1 is Hydramagnipapillata, E2 is Limulus polyphemus), E3 is Adineta vaga, and E4 is Ciona intestinalis.

[0109] Figure 8 is a diagram illustrating the structure of an example subject's genome after insertion of a transgene by the gene insertion system (GIS) of the present invention.

[0110] Figure 9 is a diagram illustrating the structure of an exemplary GIC synthetic construct.

[0111] Figure 10 is an image of radioactive DNA synthesis products resolved by denaturing PAGE gel. The black solid line box indicates the gel region with the expected product length. The lane numbers correspond to the various RT proteins tested as detailed in Table 3 of Example 10. The reaction in lane 1 contains a negative control purified from cells that do not express the RT protein.

[0112] Figure 11A is a sketch depicting an example experimental design for testing the specificity of RT protein binding to template RNAs derived from cognate and noncognate R2 element 3'UTRs.

[0113] Figure 11B Shown are dot blot results determining the selectivity of Bombyx mori, Drosophila simiana, and Medaka RTs for cognate and non-cognate template 3'UTRs.

[0114] Figure 12A and Figure 12BResults of a denaturing PAGE gel showing TPRT reaction products. Arrows indicate the expected size of the correct TPRT product. Lane B contains the reaction product with Bombyx mori RT, Lane D contains the reaction product with Drosophila simulans RT, Lane O contains the reaction product with Medaka fish, and Lane N contains the reaction product without enzyme. Figure 12A Shown are the results of reactions containing the indicated RT proteins with templates containing the Drosophila simulans template 3'UTR (individually labeled lanes) or with templates containing the Drosophila simulans template 3'UTR and 4nt rRNA (lanes labeled R4). Figure 12B Shown are the results of reactions containing the indicated RT proteins with a template containing the medaka template 3'UTR (lanes labeled individually) or with a template containing the medaka template 3'UTR and 4nt rRNA (lanes labeled R4).

[0115] Figure 13 Results are shown on a denaturing PAGE gel of TPRT reaction products from Bombyx mori RT using the indicated templates. The arrow indicates the expected size of the correct TPRT product, and the circle marks the length of the product generated by internal priming.

[0116] Figure 14A and Figure 14B Shown are the results of a denaturing PAGE gel of TPRT reaction products from medaka RT using the indicated templates.

[0117] Figure 15 Results of a denaturing PAGE gel showing TPRT reaction products from Tribolium castaneum RT using the indicated templates. The arrow indicates the expected TPRT product length.

[0118] Figure 16 Results from a denaturing PAGE gel of TPRT reaction products from the RT protein derived from the white-throated bunting are shown. Table 8 in Example 17 gives the GIC characteristics for each lane shown. The expected length of the TPRT product is indicated by a solid line box (top), the expected length of the precipitation recovery control is indicated by a box with a dashed outline (middle), and the expected length of the radiolabeled target site oligonucleotide is indicated by a box outlined with a dot-dot-dash pattern (bottom).

[0119] Figure 17 Results from a denaturing PAGE gel of TPRT reaction products from a RT protein derived from a chestnut-eared finch are shown. Lane 1 contains a length reference ladder, lane 2 contains only the RT protein (no template RNA), and the GIC properties for each of the other indicated lanes are given in Table 11 in Example 19. The expected length of the TPRT product is indicated by a solid box (top), the expected length of the precipitation recovery control is indicated by a box with a dashed outline (center), and the expected length of the radiolabeled target site oligonucleotide is indicated by a box outlined in a dot-dot-dashed pattern (bottom).

[0120] Figure 18A and Figure 18B The PCR amplification products of the RT protein of Tribolium castaneum were inserted into the genomic DNA of the transgenic template. Figure 18A In the figure, the expected product length is indicated by a box. All correctly inserted PCR products should be the same size. Figure 18B The expected product length is indicated by an arrow. The correct insert PCR product length is different for templates without the 5' module (3) relative to templates with the 5' module (5_3).

[0121] Figure 19 PCR amplification results for genomic DNA are shown. The upper panel corresponds to the expected amplification of the 3' junction, and the lower panel corresponds to the expected amplification of the 5' junction. The lane labeled "L" contains a reference length ladder, lanes labeled 1 and 9 contain PCR products without transfection of a TriCasB-derived RT expression plasmid or GIC, lanes labeled 2-8 contain PCR products after transfection of the GICs described in Table 13 of Example 21 without transfection of an RT expression plasmid, and lanes labeled 10-16 contain PCR products after transfection of both the GICs described in Table 13 of Example 21 and the RT expression plasmids. Some expected PCR product lengths are marked with asterisks. For all included asterisks, see SuppFIGS.

[0122] Figure 20 The results of PCR amplification of genomic DNA are shown. Lanes labeled AJ contain PCR products with the expected sizes for detecting the expected 5' junctions after co-transfection of RTC mRNA and GIS RNA as shown in Table 16 of Example 24.

[0123] Figure 21 Exemplary FACS analysis results of transgenic GFP-negative clonal cell populations (top 2 panels) and transgenic GFP-positive clonal cell populations (bottom 2 panels) are shown.

[0124] Details of public content

[0125] I. Introduction

[0126] Unless prohibited or otherwise indicated, in these descriptions and throughout the specification, the terms "a" and "an" mean one or more, and the term "or" means and / or. It should be understood that the examples and embodiments described herein are for illustrative purposes only and will suggest various modifications or changes thereto to those skilled in the art, which should be included within the spirit and scope of this application and the scope of the appended claims. All publications, patents, and patent applications cited herein, including citations therein, are hereby incorporated by reference in their entirety for all purposes.

[0127] The present invention provides systems and methods for genome editing and / or genetic modification, which include inserting a transgenic into a subject's genome. The system is referred to herein as a gene insertion system (GIS), and may include at least two components (i.e., two component GIS), (a) at least one reverse transcriptase (RT) construct (RTC), which includes or encodes at least one reverse transcriptase, and (b) at least one gene insertion construct (GIC) expressed separately, which includes or encodes an RNA construct to be used as a reverse transcription template. The term "construct" as used herein may refer to any artificially designed or synthetic biopolymer. The biopolymer may, for example, be composed of nucleic acid (e.g., DNA or RNA), amino acid, or any combination thereof. In some embodiments, both (a) and (b) are RNA constructs. In some embodiments, (a) is an amino acid construct (i.e., protein), and (b) is an RNA construct.

[0128] Also provided are engineered RTCs capable of target-primed reverse transcription (TPRT).The term "target-primed reverse transcription" as used herein refers to any process in which a reverse transcriptase uses the available 3' end of DNA at the target site as a primer to initiate cDNA synthesis.

[0129] In addition, provided system and method can realize the sequence-specific position (herein referred to as target site) of transgenic insertion in subject's DNA, such as safe harbor site.Term used herein " safe harbor " and " safe harbor site " refer to any site in subject's genome, wherein the destruction of subject's DNA sequence, for example, by inserting heterologous sequence to the destruction of subject's DNA sequence does not negatively affect the function of subject's cell.Exemplary safe harbor site used herein is located in the subject's genome portion encoding ribosomal RNA (rRNA), including rRNA precursors transcribed by RNA polymerase I, which are encoded by sequences referred to herein as ribosomal DNA (rDNA) loci, comprising sequences encoding 5.8S, 18S or 28S rRNA.

[0130] The present disclosure demonstrates that RNA delivery alone can program a safe harbor location for insertion of a DNA transgene into the genome of a cell, such as a human cell. In some embodiments, both an RNA template encoding the transgene to be inserted and a messenger RNA encoding a reverse transcriptase are delivered to the cell, which is necessary for converting the RNA template into genomic DNA. It is expected that continued innovation in RNA delivery alone will make it easier to translate gene therapy to humans through the use of non-toxic, highly efficient, cell-type-targeted RNA delivery mechanisms.

[0131] In some aspects, plasmid-based expression of reverse transcriptase (RT) is combined with transfected RNA templates. In some embodiments, a transgenic template 5' module comprising a natural or natural portion of an R2 reverse transcription factor sequence is used in a heterologous combination with RT, which provides the advantage of full-length site-specific sequence insertion rather than truncated reverse transcription factor sequence insertion. In some embodiments, the template RNA comprises a 3' module, wherein the reverse transcription factor 3'UTR sequence is from the same species as RT. In some embodiments, the 3'UTR also comprises a 3' poly-A region, which improves target site-specific insertion efficiency.

[0132] The present disclosure provides the following improvements and advantages over previous systems and methods. The inventors demonstrate that:

[0133] (i) The avian RT protein has significant transgene insertion activity, resulting in more than 20% of transfected cells expressing functional transgenes. Avian RT is highly selective for replicating template RNA containing an avian 3' UTR followed by a 3' poly-A region.

[0134] (ii) heterologous combinations of avian R2 retrotransposition factor 3'UTR and RT protein can be more effective than the natural combination;

[0135] (iii) Non-natural, de novo created and optimized 5' modules can be more efficient, achieving site-specific insertion efficiencies that are one or more orders of magnitude higher.

[0136] (iv) the natural 5′ module (TriCasA) from Tribolium castaneum (TCA, TCA5, TCARZ, etc.) R2 retroelements from a completely different clade than avian RT proteins can be more efficient;

[0137] (v) using a co-transfection 2-RNA system instead of plasmid-expressed RT followed by transfection of template RNA for transgene insertion delivery;

[0138] (vi) 2-RNA transfection can insert multiple transgenes per cell, enabling multiplexing of gene delivery in a single RNA administration. This allows for the insertion of multiple therapeutic transgenes into the genome of the same cell, including transgenes encoding therapeutic proteins or different subunits of therapeutic proteins, or a combination of therapeutic proteins and RNA;

[0139] (vii) 2-RNA delivery enables transgene expression in a wide range of cell types, including primary cell lines and non-dividing or slowly dividing cells, including mouse and monkey as well as human cells;

[0140] (viii) genomic sequencing confirms site-specificity of insertion; and

[0141] (ix) The inserted transgenic expression cassette has stable expression for several months.

[0142] Components that produce retrotransposition factors

[0143] The RTC and / or GIC of the present invention may comprise components (interchangeably referred to as modules) that may be derived from at least one portion of a non-long terminal repeat retrotransposition element (non-LTR) and / or are not known to occur in nature. Without wishing to be bound by theory, Figure 1 Illustration (top) comprises the experimenter genome of natural reverse transcription factor 100, and in this case reverse transcription factor is non-long terminal repeat reverse transcription factor (non-LTR).As can be seen from the figure, experimenter DNA 110 can comprise at least one targeting insertion site 120, and can have natural reverse transcription factor 130 at the targeting insertion site.Can further examine the framework of example natural reverse transcription factor in the expansion view (bottom).Here, reverse transcription factor 5 ' district 131 is before translation start site 132.Reverse transcription factor 5 ' district is not usually translated into amino acid biopolymer, and can comprise the nucleotide sequence recognized by reverse transcription factor RT and / or influence the second chain synthesis of natural reverse transcription factor during later insertion.Translation start site 132 is the first nucleotide that will be translated into amino acid.Reverse transcription factor reverse transcriptase open reading frame 133 encodes reverse transcriptase, and described reverse transcriptase can recognize, combine and use reverse transcription factor RNA transcript as template for reverse transcription.Reverse transcription factor reverse transcriptase open reading frame extends to translation termination site 134 but does not comprise translation termination site 134. The retromer 3' region 135 is generally not translated into an amino acid biopolymer and may comprise a nucleic acid sequence recognized by the native retromer RT. Regions 131 and 135 may or may not be present and, if present, may comprise repeats surrounding the target site sequence and / or sequences not encoded by the retromer RNA template.

[0144] Suitable retrotransposons from which GIS components can be obtained include, but are not limited to, non-LTR retrotransposons, such as RLE-type or APE-type or Penelope-type non-LTR retrotransposons. RLE-type non-LTR retrotransposons can be from any of a number of clades, including but not limited to R2, R4, CRE, Genie, HERO, NeSL. APE-type non-LTR retrotransposons can be from any of a number of clades, including but not limited to I, R1, L1, Tx1, CR1, Rex1, Jockey, L2, Tad, RTE, RTEX, Ingi, Vingi, TRAS, SART, or any combination thereof. In some embodiments, GIS components can be derived from retrotransposons that insert into rDNA, so-called R elements, such as retrotransposons of R1 or R2 clades. In some embodiments, the R2 evolutionary branch retrotransposition factor can have the typical R2 retrotransposition factor insertion site specificity, or can be derived from R8 and / or R9 retrotransposition factors in the larger R2 evolutionary branch, which have altered target sequences relative to the typical R2 retrotransposition factor, or can be derived from R2NS retrotransposition factors that appear to have lost target site specificity.

[0145] The GIS component can be derived from a portion or domain of a retroelement found in any species, including those with distant evolutionary relationships to the subject. For example, suitable retroelement from which the GIS component can be derived may include retroelements found in birds (Zonotrichia albicollis, Taeniopygia guttata, White-throated (Tinamus guttatus) and Geospiza fortis), fish (e.g., nine-spined stickleback (Pungitis pungitis), medaka (Oryzias latipes), zebrafish (Danio rerio), black-spotted medaka (Oryzias melastigma), sea lamprey (Petromyzon marinus), brown trout (Salmo trutta), Atlantic salmon (Salmosalar), or three-spined stickleback (Gasterosteus aculeatus)), insects (Drosophila mercatorum, Drosophila melanogaster, Nasonia vitripennis, Tribolium castaneum, Drosophila simulans, Apis cerana, and silkworm (Bombyx mori)), crustaceans (e.g., Lepidurus cuscus couesii and European tadpole shrimp (Triops cancriformis), other invertebrates (e.g., Limulus polyphemus, Hydramagnipapillata, or Adineta vaga), chordates (e.g., Ciona intestinalis), including those found in mammals, and any combination thereof.

[0146] In some embodiments, GIS components can be derived from portions or domains of any of the sequences disclosed herein.

[0147] II. Gene Insertion System (GIS) Composition

[0148] The system for inserting genetic material (e.g., transgenic) into a subject's genome of the present invention is referred to as a gene insertion system (GIS) throughout this disclosure. The GIS can be composed of a variety of biopolymer constructs that are co-administered to insert at least one transgenic by target-triggered reverse transcription (TPRT). These biopolymer constructs can be amino acid biopolymers, nucleic acid biopolymers, mixed biopolymers containing both amino acids and nucleic acids, or any combination thereof. In some embodiments, the GIS is composed of at least two biopolymer constructs, at least one reverse transcriptase construct (RTC) and at least one gene insertion construct (GIC). In such embodiments, the RTC comprises a tool for reverse transcription, such as by comprising or encoding a reverse transcriptase, and the GIC comprises or encodes at least one RNA sequence that can be used by the RTC as a template for cDNA synthesis.

[0149] The biopolymer constructs of the present invention themselves are composed of multiple modules, such that the modules can be combined as needed to modify the system for a desired function. As used herein, the term "module" refers to a portion of a construct that is defined by its function (e.g., a functional domain of a protein) or its sequence (e.g., an amino acid or nucleic acid sequence).

[0150] Reverse transcriptase construct (RTC)

[0151] The GIS of the present invention comprises at least one RTC comprising or encoding an active RT protein, such as an RT derived from a non-LTR retrotransposition element. As used herein, the term "RTC" refers to a biopolymer construct comprising or encoding at least one reverse transcriptase (RT). In some embodiments, the at least one RTC used in the GIS of the present invention may comprise an amino acid biopolymer, including but not limited to a polypeptide, a protein, a preprotein, or any combination thereof. In some embodiments, the at least one RTC used in the GIS of the present invention may comprise a nucleic acid biopolymer, including but not limited to RNA, DNA, or any combination thereof. In some embodiments, the at least one RTC may comprise at least one mRNA construct.

[0152] RTC Architecture

[0153] The RTC of the present invention may comprise at least one RTC: reverse transcriptase module (RTC:RT-module), at least one optional reverse transcriptase construct 5' module (RTC:5' module), at least one optional reverse transcriptase construct 3' module (RTC:3' module), and any combination thereof. In some embodiments of the RTC, the RTC:5' module and the RTC:3' module may be optional, and one or both may not be present. In some embodiments, at least one RTC may comprise a linear RNA biopolymer or be delivered to a subject as a linear RNA biopolymer. In some embodiments, at least one RTC may comprise an mRNA biopolymer or be delivered to a subject as an mRNA biopolymer.

[0154] Now turn Figure 2 , provides the architecture of an exemplary linear RNA biopolymer (e.g., mRNA) RTC 200. As illustrated, for an mRNA biopolymer RTC, the RTC:5' module 210 is an optional component of the RTC that, when present, can contain sequences that alter the immunogenicity of the RTC and / or control the expression of the RTC:RT module 220. For example, the RTC:5' module can contain or encode at least one 5' cap (e.g., TriLink Clean Cap AG, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG), at least one 5' untranslated region (5'-UTR), at least one Kozak sequence, at least one promoter, and any combination thereof. A start codon, a 3-nucleotide sequence of nucleic acid known to initiate translation, marks the 5' end of the RTC:RT module. The RTC:RT-module (described in detail below) includes the start codon and extends from the start codon to the stop codon, and does not include the stop codon. The optional RTC:3' module 230, when present, comprises a stop codon and extends from the stop codon to the 3' end of the RTC. The RTC:3' module, when present, may comprise sequences that alter the immunogenicity of the RTC and / or control expression of the RTC:RT-module. For example, the RTC:3' module may comprise or encode a translation stop codon, a 3' UTR, polyadenylation sequence(s), a polyadenylation signal, or any combination thereof.

[0155] In some embodiments, at least one RTC may comprise a plasmid or be delivered to a subject as a plasmid. In some embodiments, at least one RTC may comprise an mRNA or pre-mRNA or be delivered to a subject as an mRNA or pre-mRNA. In some embodiments, at least one RTC may comprise a protein or be delivered to a subject as a protein. In some embodiments, at least one RTC may comprise a preprotein or be delivered to a subject as a preprotein.

[0156] RTC: RT module

[0157] The RT module of an RTC comprises or encodes at least one compound or composition having reverse transcription activity, a specific but non-limiting example of which is a class of enzyme proteins known as reverse transcriptases (RTs). In some embodiments, the RT module may comprise or encode a biopolymer derived from at least one RT found in a retrotransposition factor gene (i.e., a retrotransposition factor RT). In some embodiments, the RTC:RT module comprises or encodes at least one reverse transcriptase derived from a non-long terminal repeat retrotransposition factor.

[0158] Reverse transcriptase

[0159] As used herein, the term "reverse transcriptase (RT)" is used in its broadest sense to refer to any biopolymer with reverse transcription activity. In some embodiments, the RT used in the present invention can be or be derived from a RT from Zonotrichia albicollis, Taeniopygia guttata, White-throated (Tinamusguttatus), Middle-billed Ground Finch (Geospiza fortis), Nine-spined Stickleback (Pungitis pungitis), Medaka (Oryzias latipes), Zebrafish (Danio rerio), Black-spotted Medaka (Oryzias melastigma), Sea Lamprey (Petromyzonmarinus), Brown Trout (Salmo trutta), Atlantic Salmon (Salmo salar), or Three-spined Stickleback (Gasterosteusaculeatus), Yellow-spotted Fruit Fly (Drosophila mercatorum), Black-bellied Fruit Fly (Drosophila melanogaster), Nasonia vitripennis, Red Flour Beetle (Tribolium castaneum), Simulated Fruit Fly (Drosophila simulans), Oriental Honey Bee (Apis cerana), Silkworm (Bombyx mori), Cuscuta's Tadpole Shrimp (Lepidurus couesii), European Tadpole Shrimp (Triops cancriformis, Limulus polyphemus, Hydra magnipapillata, Adineta vaga, Ciona intestinalis, other birds, other arthropods, other fish, other tunicates, other animals (including mammals and humans), or the like.

[0160] In some embodiments, at least one RTC:RT module used in the GIS of the present disclosure may comprise, encode, or be encoded by at least one of SEQ ID NOs 1-57. In some embodiments, at least one RTC:RT module may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 1-57. In some embodiments, the RTC:RT-module comprises a non-natural or unnatural sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NOs 1-57.

[0161] In some embodiments, at least one RTC:RT-module may comprise, encode, or be composed of a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homology to at least one of SEQ ID NOs 17-21 (ZoA1 RT sequences). RT sequences) encodes a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10% or 5% homologous to at least one of the RT sequences.

[0162] In some embodiments, at least one RTC:RT module may comprise, encode, or be composed of a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homology to at least one of SEQ ID NOs 26-29 (TaGuRT sequences). RT sequences) encodes a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10% or 5% homologous to at least one of the RT sequences.

[0163] In some embodiments, at least one RTC:RT module may comprise, encode, or be composed of a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homology to at least one of SEQ ID NOs 1-5 (TriCasBRT sequences). RT sequences) encodes a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10% or 5% homologous to at least one of the RT sequences.

[0164] In some embodiments, the RTC:RT module may comprise or encode a protein that is shown to be active for TPRT by a suitable TPRT assay. Non-limiting examples of suitable TPRT assays include (i) transfecting a cell population with an expression plasmid encoding the RT protein having a suitable tag for affinity purification (e.g., a FLAG tag), (ii) lysing the cell population and collecting and purifying the expressed protein product by appropriate methods known in the art, (iii) preparing recombinant template RNA by any method known in the art (e.g., T7 RNA polymerase), (iv) combining the purified RT protein, the recombinant template, and a nucleotide solution containing double-stranded DNA of a target site oligonucleotide with a terminally radiolabeled downstream strand in a culture medium that promotes reverse transcription by RT, and (v) collecting and analyzing the products by any suitable method known in the art (e.g., denaturing PAGE).

[0165] RT suitable for use in the present invention may be composed of multiple functional domains. In some embodiments, such as Figure 3 As illustrated in FIG, at least one reverse transcriptase 300 comprises at least one DNA binding domain 310, at least one RNA binding domain 320, at least one cDNA synthesis domain 330, at least one endonuclease domain 340, and any combination thereof. Note that for this illustration, only one possible domain configuration is presented. In some embodiments, any of the described domains can be present in the RT at different frequencies and / or the domains can be present in any order. In some embodiments, the DNA and RNA binding domains can be derived from a different polypeptide type than the RT or from unknown sequences in the eukaryotic genome (e.g., de novo designed DNA or RNA binding domains).

[0166] Start codon

[0167] At least one non-natural translation initiation codon can be added to the nucleic acid sequence of coding RT by various methods known in the art. Non-natural translation initiation codon can be added to any position of the sequence derived from non-LTR retrotransposition factor, which produces functional RT. For example, at least one non-natural initiation codon can be added to the nucleic acid sequence of coding RT at a distance of about 1, 10, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000 or more bases from a known reference point in the wild-type non-LTR retrotransposition factor (e.g., from the amino acid sequence motif in the natural retrotransposition factor RT ORF). The positioning of the translation initiation codon can be selected based on optimization of polypeptide length, sequence composition, activity, biological stability, lack of aggregation or localization, and / or to confer improved biological stability on the mRNA encoding the protein, in addition to other considerations that will be apparent to practitioners in the art of designing optimal or regulated protein expression in the target cell of interest.

[0168] The translation initiation codon can be any 3 nucleotides known to initiate translation by the ribosome, either dependently or independently of another sequence or structure in the mRNA. In some embodiments, the non-natural translation initiation codon is AUG.

[0169] RTC: 5' module

[0170] The RTC of the present invention may comprise at least one RTC:5' module. Generally speaking, the RTC:5' module comprises an untranslated biopolymer component that, as non-limiting examples, can alter the immunogenicity of the GIC, aid in localizing the GIC to a targeted intracellular region, control or alter expression of the RTC:RT module of the GIC, tag the GIC for identification, aid in purification of the GIC, control degradation of the GIC, enable exogenous or endogenous modulation of the GIC activity and / or function, and any combination thereof.

[0171] In some embodiments, at least one RTC:5' module may comprise or encode at least one 5' UTR. In some embodiments, at least one RTC:5' module may comprise or encode at least one 5' cap. In some embodiments, at least one RTC:5' module may comprise or encode at least one microRNA binding sequence. In some embodiments, at least one RTC:5' module may comprise or encode at least one RNA polymerase promoter.

[0172] In some embodiments, at least one RTC:5' module for use in the GIS of the present disclosure comprises the 5'UTR of SEQ ID NO:58.

[0173] In the embodiment, we used a 5' and a 3'UTR for the transfected mRNA, which was taken from the BioNTech vaccine sequence reported to the WHO. We also used their template-encoded poly A region (instead of using a poly A polymerase after transcription), which consists of an A30-10 nt linker-A70, followed by a TypeIIS restriction site to cut the template for mRNA transcription without any additional 3'nt. All mRNAs were capped with TriLink AG clean capm7 (3'OMeG) (5') ppp (5') (2'OMeA) pG). UTR was selected for tissue-specific RT expression, for example, to impose cell type-specific translation control.

[0174] In some embodiments, the RTC:5' module may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO 58.

[0175] RTC: 3' module

[0176] The RTC of the present invention may comprise at least one RTC:3' module. Generally speaking, the RTC:3' module comprises an untranslated biopolymer component that, as non-limiting examples, can alter the immunogenicity of the GIC, aid in localizing the GIC to a targeted intracellular region, control or alter expression of the RTC:RT module of the GIC, tag the GIC for identification, aid in purification of the GIC, control degradation of the GIC, enable exogenous or endogenous modulation of the GIC activity and / or function, and any combination thereof.

[0177] In some embodiments, at least one RTC:3' module may comprise at least one 3'UTR. In some embodiments, at least one RTC:3' module may comprise or encode at least one poly-A region or poly-A tail. In some embodiments, at least one RTC:3' module may comprise or encode at least one microRNA binding sequence.

[0178] In some embodiments, at least one RTC:3' module used in the GIS of the present disclosure comprises the 3'UTR of SEQ ID NO 59 and a poly-A tail.

[0179] In some embodiments, the RTC:3' module comprises a 3'UTR that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10% or 5% homologous to SEQ ID NO 59.

[0180] Modularity of RTC

[0181] The RTC of the present invention can be designed for a desired function or activity by combining any combination of at least one RTC:RT module, optionally at least one RTC:5' module and / or optionally at least one RTC:3' module. In some embodiments, the RTC comprises at least one RTC:5' module. In some embodiments, the RTC comprises at least one RTC:3' module. In some embodiments, the RTC comprises at least one RTC:RT module. In some embodiments, the RTC comprises at least one RTC:5' module, at least one RTC:RT module and at least one RTC:3' module. In some embodiments, the RTC comprises at least one RTC:5' module and at least one RTC:RT module. In some embodiments, the RTC comprises at least one RTC:RT module and at least one RTC:3' module.

[0182] In some embodiments, the RTC of the present invention may not include at least one RTC:5' module and at least one RTC:3' module. In some embodiments, the RTC of the present invention may not include at least one RTC:5' module or at least one RTC:3' module. In some embodiments, the RTC of the present invention may not include at least one RTC:5' module. In some embodiments, the RTC of the present invention may not include at least one RTC:3' module.

[0183] In some embodiments, at least one RTC may comprise any combination of: (a) at least one RTC:5' module selected from, encoding, or encoded by any one of SEQ ID NO 58, (b) at least one RTC:RT-module selected from, encoding, or encoded by any one of SEQ ID NO 1-57, and / or (c) at least one RTC:3' module selected from, encoding, or encoded by any one of SEQ ID NO 59.

[0184] Exemplary RTC

[0185] The RTC used in the present invention may comprise, encode or be encoded by at least one of SEQ ID NOs 1-57. In some embodiments, the RTC may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 1-57.

[0186] In some embodiments, at least one RTC may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 17-21.

[0187] In some embodiments, at least one RTC may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 26-29.

[0188] In some embodiments, at least one RTC may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 24-25.

[0189] In some embodiments, at least one RTC may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 1-5.

[0190] In some embodiments, at least one RTC may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 35-37.

[0191] In some embodiments, at least one RTC may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 32-34.

[0192] In some embodiments, at least one RTC comprises Figure 5 The structure illustrated in the figure.

[0193] RTC adjustment element

[0194] The RTC of the present invention may also comprise any number of regulatory elements, which may be located within any of the RTC modules.The term "regulatory element" as used herein refers to any sequence, region or domain that effects control over the expression or activity of the biopolymer to which it belongs.

[0195] For example, an RNA-based RTC may contain any number of microRNA (miRNA) or small interfering RNA (siRNA) binding sites. Without wishing to be bound by theory, based on the presence of an RNAi transcriptome, the presence of these RNAi binding sites may prevent expression of the RT protein in a particular cell type. In this way, the GIS of the present invention may be de-targeted from a subject's cell type. As used herein, the term "miRNA or siRNA binding site" refers to an RNA sequence that is complementary to at least one miRNA or siRNA, respectively.

[0196] In some embodiments, the RTC may comprise at least one miRNA and / or siRNA binding site that is complementary to at least one miRNA and / or siRNA contained in or encoded by a transgene inserted into the GIS. Generally speaking, this can enable the GIS of the present invention to self-regulate the number of transgene insertions per single GIS administration and / or prevent repeated transgene insertions after an initial administration. Thus, the GIS can have an increased capacity for re-administration or co-administration to a given subject.

[0197] Gene Insertion Construct (GIC)

[0198] The GIS of the present invention comprises at least one GIC, which generally comprises or encodes at least one sequence of interest (i.e., a "payload sequence") intended for insertion into the genome of a subject. As used herein, the term "GIC" refers to any biopolymer construct that comprises or encodes at least one RNA sequence, such that the RNA sequence is recognized by at least one RT comprised or encoded by at least one RTC:RT module and can serve as a template for reverse transcription. In some embodiments, the at least one GIC used in the GIS of the present invention may comprise a nucleic acid biopolymer, including, but not limited to, RNA, DNA, or any combination thereof.

[0199] GIC Architecture

[0200] The gene insertion constructs (GICs) of the present invention may comprise or encode at least one GIC:5' module, at least one GIC:payload module, at least one GIC:3' module, and any combination thereof. In some embodiments, the at least one GIC may comprise a plasmid or be delivered to a subject as a plasmid. In some embodiments, the at least one GIC may comprise a linear RNA or be delivered to a subject as a linear RNA.

[0201] In some embodiments, at least one GIC:5' module is optional. In some embodiments, at least one GIC:3' module can be optional. In some embodiments, a GIC of the present invention can include or encode at least one GIC:Payload module and not include or encode at least one GIC:5' module and / or at least one GIC:3' module.

[0202] like Figure 6 , which depicts an exemplary linear RNA GIC 400, with an optional GIC:5' module 410 extending from the 5' GIC sequence end to the GIC:5' module end 420. A GIC:payload module 430 is toward the 3' of the GIC:5' module (when present) and extends to the GIC:payload module end 440. Finally, a GIC:3' module 450 extends to the 3' GIC end. Each of these features will be discussed in detail below.

[0203] GIC: 5' module

[0204] The GIC: 5' module for use in the GICs of the present disclosure may comprise or encode at least one sequence derived from the 5' region of a native retrotransposition factor. Without wishing to be bound by theory, the 5' module may comprise or encode an RNA sequence that interacts with at least one RNA binding domain of the retrotransposition factor, affects second strand synthesis during transgene insertion, reduces immunogenicity of the GIC, provides characteristics useful for GIC stability and / or purification, and any combination thereof.

[0205] GIC: 5' modular architecture

[0206] In some embodiments, the 5' module comprises or contains a 5' rRNA sequence and a ribozyme (RZ) sequence. In some embodiments, the 5' rRNA sequence and the RZ sequence are not necessarily completely separate. In some embodiments, the 5' module comprises a "folding sequence," which may be separate from the RZ sequence. In some embodiments, the GIC:5' module may optionally comprise or encode at least one GIC:5' module rRNA sequence (or other target site sequence), optionally at least one GIC:5' module ribozyme (RZ) sequence, optionally at least one GIC:5' module folding sequence, and any combination thereof.

[0207] Back to Figure 6An expanded view of the GIC:5' module 410 (bottom left) illustrates the architecture of an exemplary GIC:5' module. The GIC:5' rRNA sequence 411, when present at the 5' end of the 5' module, may comprise or encode an RNA sequence complementary to a subject DNA sequence located 5' to or otherwise near the target insertion site. The GIC:5' module ribozyme (RZ) sequence 412, when present, may comprise at least one RNA sequence having a self-cleaving RZ fold that may or may not self-cleave to release a functional GIC from the transcribed 5' leader sequence. The GIC:5' module RZ sequence will fold and, when active, will cleave such that the GIC:5' rRNA sequence is included as part of the RZ at or near the 5' end of the GIC. The optional GIC:5' module folding motif sequence 413 may comprise at least one RNA sequence having a predicted or confirmed autonomous folding, which may be used to physically and / or kinetically separate the folding of the GIC:5' module RZ from that of the payload sequence. Additionally, within region 414 or at position 420, between the GIC 5' module 410 and the payload module 430, a GIC sequence may be added to terminate or otherwise regulate transcription initiated from endogenous cellular promoter sequence(s) flanking the target site. In some embodiments, endogenous cellular promoter sequences flanking the target site(s) may be used for payload expression, which is one example of a situation in which GIC sequence(s) may be added at positions 420 and / or 440 to regulate payload expression (e.g., to initiate translation or terminate transcription of a host promoter RNA transcript containing the payload sequence). Additionally, region 414 may contain an RNA polymerase (RNAP) termination sequence to prevent readthrough of RNA polymerase from the gene at the target insertion site. In some embodiments, the RNAP is RNAP I (Pol I), and when the GIC payload module is integrated into the ribosomal DNA gene target site, the termination sequence prevents Pol I from reading through transcription. In some embodiments, the RNAP terminator sequence comprises the sequence 5'-AGGTCGACCAGATGTCCGAGGTCGACCAGTTGTCCG-3' (SEQ ID NO: 537).

[0208] GIC: 5' module rRNA sequence

[0209] At least one GIC:5' module rRNA sequence is an optional component of the GIC:5' module. When present, it may comprise or encode a human ribosomal RNA (rRNA) sequence or other sequence that is homologous and / or complementary to at least one subject DNA sequence located 5' of the target insertion site. Without wishing to be bound by theory, the rRNA sequence may direct second-strand synthesis of the inserted cDNA transgene by recruiting at least one endogenous DNA repair mechanism. In some embodiments, the GIC:5' module rRNA sequence is located 5' of the GIC:5' module RZ sequence. In some embodiments, the GIC:5' module does not comprise a sequence comprising an rRNA genomic sequence.

[0210] In some embodiments, at least one GIC: 5' module rRNA sequence may comprise or encode an rRNA of about 1 to 36 nt. In some embodiments, at least one GIC: 5' module rRNA sequence may comprise or encode an rRNA of about 1 to 30 nt. In some embodiments, at least one GIC: 5' module rRNA sequence may comprise or encode an rRNA of about 1 to 28 nt. In some embodiments, at least one GIC: 5' module rRNA sequence may comprise or encode an rRNA of about 1 to 26 nt. In some embodiments, at least one GIC: 5' module rRNA sequence may comprise or encode an rRNA of about 1 to 13 nt. In some embodiments, at least one GIC: 5' module rRNA sequence may comprise or encode an rRNA of about 1 to 11 nt.

[0211] In some embodiments, at least one GIC:5' module rRNA sequence may comprise or encode about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nt of rRNA.

[0212] In some embodiments, at least one GIC: 5' module rRNA sequence may comprise or encode an rRNA of approximately 30 nt. In some embodiments, at least one GIC: 5' module rRNA sequence may comprise or encode an rRNA of approximately 36 nt. In some embodiments, at least one GIC: 5' module rRNA sequence may comprise or encode an rRNA of approximately 28 nt. In some embodiments, at least one GIC: 5' module rRNA sequence may comprise or encode an rRNA of approximately 26 nt. In some embodiments, at least one GIC: 5' module rRNA sequence may comprise or encode an rRNA of approximately 13 nt. In some embodiments, at least one GIC: 5' module rRNA sequence may comprise or encode an rRNA of approximately 11 nt. In some embodiments, the GIC: 5' module rRNA sequence comprises a 5' G nucleotide.

[0213] In some embodiments, at least one GIC: 5' module rRNA sequence may comprise, encode, or be encoded by at least one of SEQ ID NOs 250-276. In some embodiments, at least one GIC: 5' module rRNA sequence may comprise, encode, or be encoded by a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70% homology to at least one of SEQ ID NOs 250-276. In some embodiments, at least one GIC: 5' module rRNA sequence comprises a sequence having one, two, or three nucleotide changes or substitutions relative to a sequence selected from SEQ ID NOs: 250-276.

[0214] In some embodiments, at least one GIC:5' module rRNA sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70% homologous to at least one of SEQ ID NO 252. In some embodiments, at least one GIC:5' module rRNA sequence comprises a sequence having one, two, or three nucleotide changes relative to SEQ ID NO 252.

[0215] In some embodiments, at least one GIC:5' module rRNA sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70% homologous to at least one of SEQ ID NO 254. In some embodiments, at least one GIC:5' module rRNA sequence comprises a sequence having one, two, or three nucleotide changes relative to SEQ ID NO 254.

[0216] In some embodiments, at least one GIC:5' module rRNA sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70% homologous to at least one of SEQ ID NO 255. In some embodiments, at least one GIC:5' module rRNA sequence comprises a sequence having one, two, or three nucleotide changes relative to SEQ ID NO 255.

[0217] GIC: 5' module RZ sequence

[0218] The GIC:5' module RZ sequence is an optional component of the GIC:5' module that, when present, contains or encodes at least one self-cleaving ribozyme or a sequence having the fold of a self-cleaving ribozyme (collectively referred to as RZ). Without wishing to be bound by theory, this motif may embed the 5'OH terminus of the GIC, such as the 5' terminus generated by self-cleavage, into a stable tertiary structure, which may reduce innate immune responses to foreign RNA, reduce the decay of the GIC by 5'-3' exonucleases that rely on 5' monophosphates to initiate cleavage, and reduce the chance that the subject's cells will recognize the GIC as mRNA or other undesirable RNA species rather than as template RNA.

[0219] In some embodiments, at least one GIC: 5' module RZ sequence comprises or encodes a ribozyme derived from the 5' region of at least one non-LTR retroelement. In some embodiments, at least one GIC: 5' module RZ sequence comprises or encodes a ribozyme derived from the 5' region of at least one non-LTR retroelement. In some embodiments, at least one GIC: 5' module RZ sequence comprises or encodes a ribozyme derived from G. aculeatus, L. polyphemus, P. pungitis, N. vitripennis, G. fortis, O. latipes, Z. albicollis, T. guttata, T. castaneum (e.g., from R2 family A or B), (T. guttatus), other birds, other arthropods, other fish, other tunicates, other animals, etc., and the 5' region of the non-LTR retrotransposition element.

[0220] In some embodiments, the GIC: 5' module RZ sequence comprises or encodes an RZ with the potential to form hepatitis delta virus (HDV) RZ secondary and tertiary structures, which can be modified from sequences found in nature and / or designed de novo without using a known genomic sequence. In some embodiments, the HDV fold RZ sequence bridging the paired stems P1 and P2 can be described as a junction (J)1 / 2, which is composed in part or in whole of a target site sequence of a desired length, such as 5' rRNA, or a desired target site sequence that is additionally protected by forming a stem loop. In some embodiments, the stem 4 (P4) design of the HDV fold RZ pair can achieve non-denaturing GIC purification, for example, by binding to a native or modified sequence of the PP7 or MS2 phage capsid protein. In some embodiments, the sequence of the RZ is designed and optimized to minimize or eliminate alternative non-productive folds. In some embodiments, the sequence of the RZ is designed and optimized to minimize the number of uridine nucleotides. In some embodiments, the sequence of RZ is designed and optimized to enable full or partial replacement of canonical ribonucleotides with incorporated nucleotide analogs during template RNA synthesis.

[0221] In some embodiments, at least one GIC:5' module RZ sequence may comprise, encode, or be encoded by at least one of SEQ ID NOs 60-154. In some embodiments, the RZ sequence spontaneously folds into an active RZ. In some embodiments, the RZ sequence comprises an internal rRNA sequence at the 5' end. In some embodiments, the RZ sequence extends 5' or 3'. In some embodiments, the RZ sequence comprises a catalytically inactive RZ sequence. In some embodiments, at least one GIC:5' module RZ sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 60-154. In some embodiments, the GIC: 5' module RZ sequence comprises a non-native or unnatural sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NOs 60-154.

[0222] In some embodiments, at least one GIC:5' module RZ sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 60.

[0223] In some embodiments, at least one GIC:5' module RZ sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NO 64.

[0224] In some embodiments, at least one GIC:5' module RZ sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NO 67.

[0225] In some embodiments, at least one GIC:5' module RZ sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NO 101.

[0226] In some embodiments, at least one GIC:5' module RZ sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NO 121.

[0227] In some embodiments, at least one GIC:5' module RZ sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NO 122.

[0228] In some embodiments, at least one GIC:5' module RZ sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NO: 137.

[0229] GIC: 5' modular folding sequence

[0230] GIC: The 5' module folding sequence is an optional component of the 5' module that, when present, comprises at least one RNA sequence motif with a specifically designed structure. In some embodiments, the autonomously folding RNA sequence motif comprises at least one hairpin motif, which may, for example, be present after the RZ to protect the RZ sequence from misfolding by base pairing with a subsequently transcribed payload region. In some embodiments, the 5' module region designed to improve the folding of the productive template RNA may base pair with or otherwise interact directly or indirectly with another template RNA region in the payload module or the 3' module. In some embodiments, at least one RNA sequence motif that directs the folding of the template RNA may comprise at least one stem-loop motif that binds a protein bridge to another stem-loop motif. In some embodiments, the 5' module folding sequence may facilitate pairing of the template RNA with the RT-encoding mRNA, for example, to promote 1:1 stoichiometric co-packaging of the RT-encoding mRNA and the template RNA in a separate delivery vector. In some embodiments, the 5' module folding sequence may facilitate pairing of the template RNA with endogenous target cell RNA, for example, for purposes of template RNA stabilization, localization, and / or other useful outcomes.

[0231] In some embodiments, at least one GIC:5' module fold sequence may comprise, encode, or be encoded by at least one of SEQ ID NOs 278-279. In some embodiments, at least one GIC:5' module fold sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 278-279. In some embodiments, the GIC:5' modular fold sequence comprises a non-native or unnatural sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NOs 278-279.

[0232] In some embodiments, at least one GIC:5' module fold sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NO: 278.

[0233] In some embodiments, at least one GIC:5' module fold sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NO: 279.

[0234] GIC: Modularity of 5' modules

[0235] The disclosed 5' module components can be used interchangeably with one another in combination to design a 5' module having the functionality required or desired for a particular GIS.

[0236] In some embodiments, at least one GIC:5' module comprises at least one GIC:5' module rRNA sequence. In some embodiments, at least one GIC:5' module comprises at least one GIC:5' module RZ sequence. In some embodiments, at least one GIC:5' module comprises at least one GIC:5' module fold sequence. In some embodiments, at least one GIC:5' module comprises at least one GIC:5' module rRNA sequence and at least one GIC:5' module RZ sequence. In some embodiments, at least one GIC:5' module comprises at least one GIC:5' module rRNA sequence and at least one GIC:5' module RZ sequence and at least one GIC:5' module fold sequence.

[0237] In some embodiments, at least one GIC:5' module may comprise any combination of: (a) at least one GIC:5' module rRNA sequence selected from, encoding, or encoded by any one of SEQ ID NOs 250-276, (c) at least one GIC:5' module RZ sequence selected from, encoding, or encoded by any one of SEQ ID NOs 60-154, and / or (d) at least one GIC:5' module fold sequence selected from, encoding, or encoded by any one of SEQ ID NOs 278-279.

[0238] Exemplary GIC: 5' module

[0239] In some embodiments, at least one GIC:5' module may comprise, encode, or be encoded by at least one of SEQ ID NOs 60-154. In some embodiments, at least one GIC:5' module may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 60-154. In some embodiments, the GIC: 5' module comprises a non-native or unnatural sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NOs 60-154.

[0240] In some embodiments, at least one GIC:5' module may comprise, encode, or be composed of a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homology to at least one of SEQ ID NOs: 60, 61, 77, and 79-83. at least one of 60, 61, 77 and 79-83 having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10% or 5% homology to encode a sequence.

[0241] In some embodiments, at least one GIC:5' module may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 62 and 63.

[0242] In some embodiments, at least one GIC:5' module may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NO: 121.

[0243] In some embodiments, at least one GIC:5' module may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 117-119.

[0244] GIC: 3' module

[0245] The 3' module of the GIC used in the present disclosure may comprise or encode at least one sequence derived from the 3'UTR of a natural retromer. Generally speaking, the 3' module comprises components that facilitate RT recognition and binding to GIC, position the payload module for reverse transcription, and stabilize the GIC RNA.

[0246] GIC: 3' module architecture

[0247] In some embodiments, the GIC:3' module may comprise or encode at least one GIC:3' module RT recognition sequence, optionally at least one GIC:3' module rRNA sequence, optionally at least one GIC:3' module A-region sequence, and any combination thereof.

[0248] Turn again Figure 6 . The expanded view (lower right) illustrates the architecture of an example GIC:3' module 450. At the 5' end of the GIC:3' module is a GIC:3' module RT recognition sequence 451, which may contain or encode a sequence that is recognized or bound by at least one RT. When present, a GIC:3' module rRNA sequence 452 may be 3' to the GIC:3' module RT recognition sequence and may contain or encode a sequence homologous to a target site region, such as 28S rRNA nucleotides that may base pair with the 3' end of a TPRT primer. Finally, when present, a GIC:3' module A-region sequence 453 may comprise an adenosine-rich or tandem adenosine sequence, which may be limited in length, such as 10 to 60 nt, and may be at the 3' end of the GIC:3' module.

[0249] GIC: 3' module RT recognition sequence

[0250] The GIC:3' module RT recognition sequence may comprise or encode at least one sequence that interacts with or is recognized by at least one reverse transcriptase. Without wishing to be bound by theory, at least one RNA sequence within the GIC:3' module RT recognition sequence may at least transiently bind to at least one template RNA binding domain of a RT, such as a reverse transcription factor RT. The length and sequence identity of the GIC:3' module RT recognition sequence may also serve to position the RT on the GIC such that the first nucleotide reverse transcribed by the RT is at the intended 3' end of the transgene to be inserted. It will be understood that the GIC:3' module RT recognition sequence may be referred to herein as the GIC:3' module 3' UTR.

[0251] In some embodiments, at least one GIC: 3' module RT recognition sequence is derived from the 3' region of a natural retrotransposition element or comprises the 3' region of a natural retrotransposition element. In some embodiments, at least one GIC: 3' module RT recognition sequence is derived from three-spined stickleback (G. aculeatus), Drosophila melanogaster (D. melanogaster), American horseshoe crab (L. polyphemus), nine-spined stickleback (P. pungitis), fly pupa golden wasp (N. vitripennis), medium-billed ground finch (G. fortis), medaka (O. latipes), white-throated bunting (Z. albicollis), chestnut-eared grass finch (T. guttata), red flour beetle (T. castaneum), white-throated In some embodiments, at least one GIC:3' module RT recognition sequence is modified from the 3' region of a native retroelement by increasing folding stability or homogeneity. In some embodiments, at least one GIC:3' module RT recognition sequence is designed and / or selected for a desired affinity and / or specificity for RT interaction, or for another mechanism that confers a desired function as a reverse transcription template. In some embodiments, at least one GIC:3' module RT recognition sequence is designed and / or selected so as not to interact with or affect endogenous target cell components and / or have a deleterious effect on the host cell.

[0252] In some embodiments, at least one GIC:3' module RT recognition sequence (or GIC:3' module 3'UTR sequence) may comprise, encode, or be encoded by at least one of SEQ ID NOs 200-224. In some embodiments, the at least one GIC:3' module RT recognition sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 200-221. In some embodiments, the GIC:3' module RT recognition sequence is a non-natural or unnatural sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NOs 200-224.

[0253] In some embodiments, the at least one GIC:3' module RT recognition sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO:202.

[0254] In some embodiments, at least one GIC:3' module RT recognition sequence may comprise, encode, or be composed of a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homology to at least one of SEQ ID NOs: 204, 222, 223, or 224. At least one of 204, 222, 223 or 224 has a sequence encoding at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10% or 5% homology.

[0255] In some embodiments, the at least one GIC:3' module RT recognition sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO: 203.

[0256] In some embodiments, the GIC: 3' module comprises an RT recognition sequence from a species different from the RT encoded by the RTC construct. For example, in some embodiments, the RT recognition sequence can be from one avian species, while the RT can be from another avian species. In some embodiments, the RT recognition sequence is from a species selected from the group consisting of White-throated Bunting (Zonotrichia albicollis), Chestnut-eared Grassfinch (Taeniopygia guttata), White-throated (Tinamus guttatns) or Geospiza fortis, and the RTs were selected from different bird species (e.g., White-throated Bunting (Zonotrichia albicollis), Chestnut-eared Grassfinch (Taeniopygia guttata), White-throated (Tinamus guttatus) or Geospiza fortis). In some embodiments, the RT encoded by the RTC construct is selected from the group consisting of Zonotrichia albicollis, Taeniopygia guttata, White-throated (Tinamus guttatus) or medium-billed ground finch (Ggospiza fortis), and the RT recognition sequence was selected from different bird species (e.g., white-throated bunting (Zonotrichia albicollis), fruit-eared grass finch (Taeniopygia guttata), white-throated (Tinamusguttatus) or Geospiza fortis). In some embodiments, the RT encoded by the RTC construct is selected from an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NOs 18 or 20, and the RT recognition sequence is selected from an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NOs 203, 204, 205 or 222-224. In some embodiments, the RT encoded by the RTC construct is selected from an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 27 or 29, and the RT recognition sequence is selected from an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO 202, 204, 205 or 222-224. In some embodiments, the RT encoded by the RTC construct is selected from an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO 25, and the RT recognition sequence is selected from an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO 202, 203, 204 or 222-224. In some embodiments, the RT encoded by the RTC construct is selected from an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO 31, and the RT recognition sequence is selected from an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO 202, 203 or 205.

[0257] GIC: 3' module rRNA sequence

[0258] The GIC: 3' module rRNA sequence, or the sequence that base pairs with the TPRT primer immediately downstream of the target site nick at a non-rDNA target site, is an optional component of the 3' module and, when present, may comprise a human ribosomal RNA (rRNA) sequence. Without wishing to be bound by theory, the length and sequence characteristics of the GIC: 3' module rRNA sequence influence the accuracy and efficiency of transgene insertion into the subject's genome by the GIC disclosed herein. For example, selection of certain GIC: 3' module rRNA sequence lengths can result in internal priming of reverse transcription, effectively shortening the inserted transgene, or can result in insertion into off-target sites, both of which can reduce the efficiency and specificity of transgene insertion at the intended target site. RTCs and GICs are engineered to require a specific length of base pairing between the GIC: 3' module rRNA sequence and the primer sequence immediately downstream of the target site nick. This adds additional fidelity to target site insertion and increases the efficiency of precise transgene insertion ligation. The optimal length of the GIC: 3' rRNA is less than 20 nt, specifically 4 nt, which strongly stimulates the formation of all 4 bp at the target site nick. Therefore, if the RTC generates nicks randomly, using a 4nt GIC:3' rRNA, only 1 / 256 nicks will have optimal transgene insertion.

[0259] In some embodiments, at least one GIC: 3' module rRNA sequence may comprise or encode an rRNA of about 1 to 30 nt. In some embodiments, at least one GIC: 3' module rRNA sequence may comprise or encode an rRNA of about 1 to 20 nt. In some embodiments, at least one GIC: 3' module rRNA sequence may comprise or encode an rRNA of about 1 to 10 nt. In some embodiments, at least one GIC: 3' module rRNA sequence may comprise or encode an rRNA of about 1 to 5 nt.

[0260] In some embodiments, at least one GIC: 3' module rRNA sequence may comprise or encode a portion of an rRNA of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nt.

[0261] In some embodiments, at least one GIC:3' module rRNA sequence may comprise or encode an rRNA of approximately 20 nt. In some embodiments, at least one GIC:3' module rRNA sequence may comprise or encode an rRNA of approximately 4 nt. In some embodiments, at least one GIC:3' module rRNA sequence may comprise or encode an rRNA of approximately 10 nt.

[0262] In some embodiments, at least one GIC:3' module rRNA sequence may comprise at least one of SEQ ID NOs 280-285. In some embodiments, at least one GIC:3' module rRNA sequence is selected from SEQ ID NOs 280-289, or a sequence thereof comprising one, two, or three nucleotide substitutions.

[0263] GIC: 3' module A-region sequence

[0264] The GIC: 3' module A-region sequence is an optional component of the 3' module that, when present, comprises a terminal sequence region comprising tandem adenosines (A). Without wishing to be bound by theory, the GIC: 3' module A-region sequence may stabilize or protect the GIC from further 3' processing, but may interfere with recognition, ribonucleoprotein assembly, transport, and translation-related decay of the GIC as an mRNA by the cell. In addition, at least one GIC: 3' module A-region sequence may protect the GIC from binding by general single-stranded RNA binding proteins and aid in positioning the GIC: 3' rRNA sequence for base pairing with a target site primer. For clarity, the A-region sequence is not equivalent to the natural mRNA poly-A tail sequence, which is typically approximately greater than 100-200 nt of tandem A's.

[0265] In some embodiments, the optional at least one GIC: 3' module A-region sequence comprises or encodes a sequence of about 1 to 50 adenosines. For example, the optional GIC: 3' module A-region sequence can comprise or encode about 1 to 50 adenosines, about 5 to 50 adenosines, about 10 to 50 adenosines, about 15 to 50 adenosines, about 20 to 50 adenosines, about 25 to 50 adenosines, about 30 to 50 adenosines, about 35 to 50 adenosines, about 40 to 50 adenosines, about 45 to 50 adenosines, about 1 to 45 adenosines, about 5 to 45 adenosines, or about 1 to 50 adenosines. adenosine, about 10 to 45 adenosines, about 15 to 45 adenosines, about 20 to 45 adenosines, about 25 to 45 adenosines, about 30 to 45 adenosines, about 35 to 45 adenosines, about 40 to 45 adenosines, about 1 to 40 adenosines, about 5 to 40 adenosines, about 10 to 40 adenosines, about 15 to 40 adenosines, about 20 to 40 adenosines, about 25 to 40 adenosines, about 30 to 40 adenosines , about 35 to 40 adenosines, about 1 to 35 adenosines, about 5 to 35 adenosines, about 10 to 35 adenosines, about 15 to 35 adenosines, about 20 to 35 adenosines, about 25 to 35 adenosines, about 30 to 35 adenosines, about 1 to 30 adenosines, about 5 to 30 adenosines, about 10 to 30 adenosines, about 15 to 30 adenosines, about 20 to 30 adenosines, about 25 to 30 adenosines, about 1 to In some embodiments, the GIC: 3' module A-region sequence comprises about 1 to 100, 1 to 90, 1 to 80, 1 to 70, or 1 to 60 adenosines.

[0266] In some embodiments, the optional at least one GIC: 3' module A-region sequence comprises or encodes a sequence of about 20 to 25 adenosines.

[0267] In some embodiments, the optional at least one GIC: 3' module A-region sequence comprises or encodes a sequence of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 adenosines. In some embodiments, the GIC: 3' module A-region sequence comprises 22 adenosines.

[0268] GIC: Modularity of the 3' module

[0269] The disclosed 3' module components can be used interchangeably with one another in combination to design a 3' module having the required or desired functionality for a particular GIS.

[0270] In some embodiments, at least one GIC:3' module comprises at least a GIC:3' module RT recognition sequence. In some embodiments, at least one GIC:3' module comprises at least one GIC:3' module rRNA sequence. In some embodiments, at least one GIC:3' module comprises at least one GIC:3' module A-region sequence. In some embodiments, at least one GIC:3' module comprises at least a GIC:3' module RT recognition sequence and at least one GIC:3' module rRNA sequence. In some embodiments, at least one GIC:3' module comprises at least one GIC:3' module RT recognition sequence and at least one GIC:3' module A-region sequence. In some embodiments, at least one GIC:3' module comprises at least one GIC:3' module RT recognition sequence, at least one GIC:3' module rRNA sequence, and at least one GIC:3' module A-region sequence.

[0271] In some embodiments, at least one GIC:3' module may comprise any combination of the following: (a) at least one GIC:3' module RT recognition sequence selected from, encoding, or encoded by any one of SEQ ID NOs 200-221, (b) at least one GIC:3' module rRNA sequence selected from, encoding, or encoded by any one of SEQ ID NOs 280-289, and / or (c) at least one GIC:3' module A-region sequence.

[0272] Exemplary GIC: 3' module

[0273] In some embodiments, at least one GIC:3' module may comprise, encode, or be encoded by at least one of SEQ ID NOs 300-329. In some embodiments, at least one 3' module may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one sequence selected from SEQ ID NOs 300-329. In some embodiments, at least one GIC: 3' module comprises a sequence having at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to a sequence selected from SEQ ID NOs 300-329, or any combination thereof. In some embodiments, the GIC: 3' module comprises a non-natural or non-natural sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NOs 300-329.

[0274] In some embodiments, at least one GIC:3' module may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 313-320.

[0275] In some embodiments, at least one GIC:3' module can comprise a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homology to a sequence selected from the group consisting of: "GACGGTAGC TAGGTTCGCAAGGCAGCCAC AAGCCAAAGA TAGGTAGGGT GCTCATAGTG AGTAGGGACA GTGCCTTTTG ATTCACAACGCGTCAATACC ATCTGACACG GATACCCTTA CCGGACTTGT CATGATCTCC CAGACTTGTC CAAGGTGGACGGGCCACCTT TACTTAACCC GGAAAAGGAA CATATATTAA TTATATGTGT TCGGAAAA" (SEQ ID In some embodiments, the sequences include "CCGGACTTGT CATGATCTCC CAGACTTGTC CAAGGTGGAC GGGCCACCTT TACTTAACCCGGAAAAGGAA CATATATTAA TTATATGTGT TCGGAAAA" (SEQ ID NO: 223) and "CAAGGTGGACGGGCCACCTT TACTTAACCC GGAAAAGGAA CATATATTAA TTATATGTGT TCGGAAAA" (SEQ ID NO: 224). In some embodiments, these sequences further include the 3' sequence TAGCaaaaaaaaaaaaaaaaaaaaaaaa (SEQ ID NO: 538).

[0276] In some embodiments, at least one GIC:3' module may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO 315.

[0277] In some embodiments, at least one GIC:3' module may comprise, encode, or be encoded by a sequence that is at least 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO 307.

[0278] In some embodiments, at least one GIC:3' module may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO 316.

[0279] GIC: Payload Module

[0280] The GIC: Payload module for use in the GICs of the present invention comprises or encodes at least one payload sequence to be used as part of a template for reverse transcription and inserted into the genome of a subject via the GIS disclosed herein. As used herein, the term "payload sequence," or simply "payload," refers to any biopolymer sequence intended for insertion into a target genome via at least one GIS of the present invention. The payload sequence of the present invention may comprise at least one transgene.

[0281] The term "transgene" as used herein is used in its broadest sense to refer to any gene sequence inserted into the subject's genome by the GIS of the present invention. For example, a transgene may include a sequence not typically found in the subject's genome or a sequence typically present in the subject's genome but not present at the target insertion site. A transgene may include, but is not limited to, a sequence comprising or encoding a desired expression product (e.g., at least one mRNA, microRNA, siRNA, rRNA, tRNA, long noncoding RNA, small cytoplasmic RNA, small nuclear RNA, small nucleolar RNA, small Cajal body RNA, circular RNA, peptides, polypeptides, and / or proteins) and / or a sequence that controls the expression of at least one transgene. In some embodiments, the transgene encodes a protein selected from telomerase reverse transcriptase (TERT, e.g., human TERT), phenylalanine hydroxylase (PAH, e.g., human PAH), factor VIII (e.g., human factor VIII), a factor VIII with a mutation of a variable size B domain (e.g., hFactor VIIIN6 and hFactor VIIIN6 mutants), or factor IX (e.g., human factor IX). In some embodiments, the transgene encodes a regulatory RNA. In some embodiments, the transgene encodes an inhibitor of another protein. In some embodiments, the inhibitor is a single chain antibody. In some embodiments, the transgene encodes a protein that can be used to treat a disease selected from the genes in Table X.

[0282] Table X. Representative transgenes.

[0283]

[0284]

[0285]

[0286]

[0287] GIC: Payload Module Architecture

[0288] The GIC: payload module can comprise at least one (e.g., one, two, or three or more) transgene sequence, and optionally at least one transgene promoter sequence, optionally at least one transgene 5' untranslated sequence, optionally at least one transgene 3' untranslated sequence, optionally at least one transgene polyadenylation signal or poly-A tail sequence, optionally at least one transgene non-coding RNA (ncRNA) processing sequence, and any combination thereof.

[0289] Go to again Figure 6The architecture of an exemplary payload module 430 is illustrated in a top expanded view. When present, the optional transgene promoter sequence 431 may contain or encode at least one promoter that controls expression of the inserted transgene by cells of the subject. The optional transgene 5'UTR sequence 432 may contain or encode a sequence that encodes the 5'UTR of the transgene mRNA when the inserted transgene is expressed. The transgene sequence 433 of the payload module may contain at least one transgene sequence for reverse transcription and insertion via the disclosed GIS; for example, such sequence may contain or encode the ORF of a gene of interest. The optional transgene 3'UTR sequence 434 may contain or encode the 3'UTR of at least one expressed transgene mRNA. Similarly, the optional transgene polyadenylation signal sequence 435 may contain or encode the polyadenylation signal of the expressed transgene mRNA. Finally, the optional transgene non-coding RNA (ncRNA) processing sequence 436 may contain or encode the termination and / or 3' processing signal for the nrRNA expressed by the transgene.

[0290] Transgene promoter sequence and RNAP II 5'UTR sequence

[0291] When present, the transgene promoter sequence may comprise or encode at least one promoter sequence comprising means for promoting expression of the transgene in the subject's genome. Many such means for promoting expression of genes and / or transgenes are known in the art, including inserting known promoter sequences 5' to the gene of interest. Those skilled in the art will appreciate that the properties of the promoter sequence may be selected based on the properties of the transgene and other application-specific factors, and therefore, any suitable promoter may be used in the practice of the present disclosure.

[0292] Exemplary promoters for use in the present disclosure can be constitutive or inducible. In some embodiments, the transgene promoter sequence can comprise or encode a promoter for at least one RNA polymerase I-III (RNAP I, RNAP II, or III). In some embodiments, instead of or in addition to a promoter, the same region of at least one transgene can comprise or encode at least one ribozyme or other motif to enable release of transgene RNA transcripts from host cell rDNA RNAP I transcription.

[0293] In some embodiments, at least one transgenic promoter sequence comprises or encodes at least one human U1 snRNA promoter. In some embodiments, at least one transgenic promoter sequence comprises or encodes at least one human U3 snRNA promoter. In some embodiments, at least one transgenic promoter sequence comprises or encodes at least one human U6 snRNA promoter. In some embodiments, at least one transgenic promoter sequence comprises or encodes at least one human tRNA promoter.

[0294] When present, a transgene 5'UTR sequence comprises or encodes at least one mRNA 5'UTR of an inserted transgene. Generally, the sequence comprises or encodes a sequence that is not translated into an amino acid biopolymer by the cellular ribosomes when the inserted transgene is expressed by the cell. Such sequences include, for example, 5'UTRs naturally associated with the transgene, non-native 5'UTRs of the transgene (including sequences derived from 5' sequences of retrotransposition factors), "synthetic" 5'UTRs that cannot be found in association with any known wild-type gene, and any combination thereof.

[0295] Those skilled in the art will understand that the choice of the transgene 5'UTR sequence will depend on the characteristics of the transgene and other application-specific factors, and thus any known or discovered 5'UTR sequence may be suitable for use as the transgene 5' sequence of the payload module.

[0296] In some embodiments, the at least one transgenic promoter sequence may comprise, encode, or be encoded by at least one of SEQ ID NOs 400-404 or 408-409. In some embodiments, the at least one transgenic promoter sequence may comprise, encode, or be encoded by a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homology to at least one of SEQ ID NOs 400-404 or 408-409. At least one of 400-404 or 408-409 encodes a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10% or 5% homology.

[0297] In some embodiments, the at least one transgenic promoter sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO 400.

[0298] In some embodiments, the at least one transgenic promoter sequence may comprise, encode, or be encoded by a sequence that is at least 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO 401.

[0299] In some embodiments, the at least one transgenic promoter sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO 403.

[0300] In some embodiments, the at least one transgenic promoter sequence comprises a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO 404.

[0301] In some embodiments, at least one transgenic promoter sequence comprises a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO 408.

[0302] In some embodiments, the at least one transgenic promoter sequence comprises a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO 409.

[0303] In some embodiments, the GIC:payload module comprises an RNA polymerase (RNAP) terminator sequence located 5' of the transgene promoter sequence. In some embodiments, the RNAP is RNAP I (Pol I), and the terminator sequence prevents Pol I from reading through transcription when the GIC payload module is integrated into the ribosomal DNA gene target site. In some embodiments, the RNAP terminator sequence comprises the sequence 5'-AGGTCGACCAGATGTCCGAGGTCGACCAGTTGTCCG-3' (SEQ ID NO: 537).

[0304] transgenic sequence

[0305] The transgenic sequence of the payload module comprises or encodes at least one sequence of interest for insertion into the subject's genome. The term "sequence of interest" as used herein refers to a biopolymer sequence comprising or encoding at least one desired expression product. In some embodiments, the transgenic encoding is selected from hTERT, hPAH, hFactor VIII, hFactor VIII with a mutation of a variable size B domain (e.g., hFactor VIII N6 and hFactor VIII N6 mutants), or a protein of Factor IX (e.g., human Factor IX). In some embodiments, the transgenic encoding is a regulatory RNA. In some embodiments, the transgenic encoding is an inhibitor of another protein. In some embodiments, the inhibitor is a single-chain antibody. In some embodiments, the transgenic encoding is a protein that can be used to treat a disease selected from the genes in Table X.

[0306] Any sequence of interest may be suitable for use in the practice of the present disclosure, without limitation as to the source from which the sequence is obtained (ie, its species of origin or whether the sequence is natural or artificial) or the length of the sequence.

[0307] In some embodiments, at least one transgenic sequence may comprise, encode, or be encoded by at least one of SEQ ID NOs 411-422. In some embodiments, at least one transgene sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 411-422.

[0308] In some embodiments, at least one transgene sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 419 or 420.

[0309] In some embodiments, at least one transgene sequence may comprise, encode, or be encoded by a sequence that is at least 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 421-422.

[0310] In some embodiments, at least one transgene sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one of SEQ ID NOs 518-536.

[0311] Transgene 3'UTR sequence and polyadenylation signal

[0312] When present, a transgene 3'UTR sequence comprises or encodes at least one mRNA 3'UTR of an inserted transgene. Generally, the sequence comprises or encodes a sequence that is not translated into an amino acid biopolymer by the cellular ribosomes when the inserted transgene is expressed by the cell. Such sequences may include, for example, a 3'UTR naturally associated with the transgene, a 3'UTR that is not naturally associated with the transgene (including sequences derived from the 3' sequence of a retrotransposition factor), a "synthetic" 3'UTR that is not associated with any known wild-type gene, and any combination thereof.

[0313] Those skilled in the art will understand that the choice of the transgene 3'UTR sequence will depend on the characteristics of the transgene and other application-specific factors, and thus any known or discovered 3'UTR sequence may be suitable for use as the transgene 3' sequence of the payload module.

[0314] When present, the transgene polyadenylation signal sequence comprises or encodes at least one transgene mRNA polyadenylation signal. Any suitable polyadenylation signal known or discovered can be used in the template modules of the present disclosure. For clarity, the at least one transgene polyadenylation signal present or encoded in the inserted transgene enables RNAP II to append a poly-A tail to the transgene mRNA or ncRNA expression product.

[0315] In some embodiments, the at least one transgenic 3'UTR sequence may comprise a sequence selected from at least one of SEQ ID NOs 405-407. In some embodiments, the at least one transgenic 3'UTR sequence may comprise a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homology to at least one of SEQ ID NOs 405-407.

[0316] In some embodiments, at least one transgene 3'UTR sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO: 405.

[0317] In some embodiments, at least one transgene 3'UTR sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO: 406.

[0318] In some embodiments, at least one transgene 3'UTR sequence may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO: 407.

[0319] Transgenic noncoding RNA (ncRNA) processing sequences

[0320] When present, the transgene ncRNA processing sequence comprises or encodes a sequence that controls the expression or processing of a transgene-expressed ncRNA, such as a transfer RNA (tRNA), rRNA, microRNA, siRNA, snRNA, etc. In some embodiments, the at least one noncoding RNA (ncRNA) processing sequence comprises or encodes at least one termination signal, at least one 3' processing signal, and any combination thereof, for at least one transgene-expressed ncRNA.

[0321] In some embodiments, at least one transgenic ncRNA processing sequence comprises or encodes at least one MALAT1 3' processing and / or protection signal. In some embodiments, at least one transgenic ncRNA processing sequence comprises or encodes at least one RNA triplex forming end protection structure. In some embodiments, at least one transgenic ncRNA processing sequence comprises or encodes at least one endonuclease recruitment structure, site or motif. In some embodiments, at least one transgenic ncRNA processing sequence comprises or encodes at least one polythymidine tract. In some embodiments, at least one transgenic RNA 3' termination and / or processing sequence comprises the SalI termination box of RNAP I.

[0322] Modularity of payload modules

[0323] The disclosed GIC:Payload module components can be used interchangeably with one another in combination to design a 3' module having the functionality required or desired for a particular GIS.

[0324] In some embodiments, at least one GIC:payload module may comprise or encode at least one transgene sequence. In some embodiments, at least one GIC:payload module may optionally comprise or encode at least one transgene promoter sequence. In some embodiments, at least one GIC:payload module may optionally comprise or encode at least one transgene 5'UTR sequence. In some embodiments, at least one GIC:payload module may optionally comprise or encode at least one transgene 3'UTR sequence. In some embodiments, at least one GIC:payload module may optionally comprise or encode at least one transgene polyadenylation signal sequence. In some embodiments, at least one GIC:payload module may optionally comprise or encode at least one transgene ncRNA processing sequence.

[0325] In some embodiments, at least one GIC:payload module can comprise or encode at least one transgene sequence, at least one transgene promoter sequence, at least one transgene 5'UTR sequence, at least one transgene 3'UTR sequence, at least one transgene polyadenylation signal sequence, and / or at least one ncRNA processing sequence.

[0326] In some embodiments, at least one GIC:payload module can comprise any combination of the following: (a) at least one transgene promoter sequence and 5'UTR sequence selected from any one of SEQ ID NOs 400-404, or a sequence having at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) to any one of SEQ ID NOs 400-404, (b) at least one transgene sequence selected from, encoding, or encoded by, or encoding any one of SEQ ID NOs 411-422 or SEQ ID NOs 499-536, or a sequence having at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) to any one of SEQ ID NOs 400-404. 499-536, and (c) at least one transgene 3'UTR sequence and polyadenylation signal selected from, or a sequence having at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity) to, any of SEQ ID NOs 405-407.

[0327] Example GIC: Payload Module

[0328] In some embodiments, at least one GIC:payload module may comprise, encode, or be encoded by at least one sequence selected from SEQ ID NOs 499-536. In some embodiments, at least one GIC:payload module may comprise, encode, or be encoded by a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to at least one sequence selected from SEQ ID NOs: 499-536.

[0329] In some embodiments, at least one GIC:payload module may comprise, encode, or be composed of a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homology to SEQ ID NO 419, 420, 518, or 519. NO419, 420, 518 or 519 encodes a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10% or 5% homology.

[0330] In some embodiments, at least one GIC:payload module may comprise, encode, or be composed of a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homology to SEQ ID NO 421, 422, 520, or 521. NO421, 422, 520 or 521 has a sequence encoding at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10% or 5% homology.

[0331] In some embodiments, at least one GIC:payload module may comprise, encode, or be composed of a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homology to SEQ ID NO: 522, 523, 524, or 525. NO522, 523, 524 or 525 encodes a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10% or 5% homologous.

[0332] Modularity of GIC

[0333] The disclosed GIC components (ie, GIC: 5' module, GIC: 3' module, and GIC: Payload module) can be used interchangeably with one another in combination to design a GIC having the functionality required or desired for a particular GIS.

[0334] In some embodiments, at least one GIC includes at least one GIC:5' module. In some embodiments, at least one GIC includes at least one GIC:payload module. In some embodiments, at least one GIC includes at least one GIC:3' module. In some embodiments, at least one GIC includes at least one GIC:5' module and at least one GIC:payload module. In some embodiments, at least one GIC includes at least one GIC:5' module and at least one GIC:3' module. In some embodiments, at least one GIC includes at least one GIC:5' module, at least one GIC:payload module, and at least one GIC:3' module.

[0335] In some embodiments, at least one GIC includes at least one GIC:5' module comprising a GIC:5' module RE sequence derived from a retrotransposition factor from the same species as the GIC:3' module RT recognition sequence. In some embodiments, at least one GIC includes at least one GIC:5' module comprising a GIC:5' module RE sequence derived from a retrotransposition factor from a different species than the GIC:3' module RT recognition sequence. In some embodiments, at least one GIC includes at least one GIC:5' module comprising a GIC:5' module sequence that is not native to eukaryotic biology and is generally applicable to at least one GIC containing any GIC:3' module RT recognition sequence.

[0336] In some embodiments, the GIC comprises Figure 7 The combination of the GIC:5' module sequence origin and the GIC:3' module sequence origin is shown in FIG. Figure 7 Among them, A1 is White-throated Bunting (Zonotrichia albicollis), A2 is Chestnut-eared Grassfinch (Taeniopygia guttata), and A3 is White-throated (Tinamus guttatus), A4 is the ground finch (Geospizafortis), B1 is the nine-spined stickleback (Pungitis pungitis), B2 is the medaka (Oryzias latipes), B3 is the three-spined stickleback (Gasterosteus aculeatus), C1 is the fly pupa golden wasp (Nasonia vitripennis), C2 is the black-bellied fruit fly (Drosophila melanogaster), C3 is the red flour beetle (Tribolium castaneum), C4 is the silkworm (Bombyxmori), C5 is the drosophila simulans, C6 is the yellow-spotted fruit fly (Drosophila mercatorum), D1 is the tadpole shrimp (Lepidurus couseii), D2 is the European tadpole shrimp (Triops cancriformis), E1 is the large nipple hydra (Hydra magnipapillata), E2 is the American horseshoe crab (Limulus polyphemus), E3 is Adineta vaga, and E4 is Ciona intestinalis.

[0337] In some embodiments, the at least one GIC may comprise, encode, or be encoded by any combination of the following: (a) at least one GIC: 5' module selected from, encoding, or encoded by any sequence selected from SEQ ID NOs: 250-276, or a sequence having one, two, or three nucleotide changes or substitutions relative to SEQ ID NOs: 250-276, SEQ ID NOs: 60-154, or a sequence having at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) to SEQ ID NOs: 60-154, SEQ ID NOs 278-279 ... 278-279, (b) at least one GIC: payload module selected from, encoding, or encoded by a sequence selected from any one of SEQ ID NOs 411-422 or 499-525, or a sequence at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical) to SEQ ID NOs 411-422 or 499-522, and / or (c) at least one GIC: 3' module selected from, encoding, or encoded by a sequence selected from any one of SEQ ID NOs 300-329, or a sequence at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical) to SEQ ID NOs 411-422 or 499-522. 300-329 have sequences that are at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical).

[0338] Exemplary GICs

[0339] In some embodiments, at least one GIC may comprise, encode, or be encoded by at least one of SEQ ID NOs 411-422 or 499-525. In some embodiments, at least one GIC may comprise, encode, or be encoded by a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homology to at least one of SEQ ID NOs 411-422 or 499-536. at least one of 411-422 or 499-536 having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10% or 5% homology to encode a sequence.

[0340] In some embodiments, at least one GIC may comprise, encode, or be derived from a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO: 419, 420, 518, or 519. 419, 420, 518 or 519 encodes a sequence having at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10% or 5% homology.

[0341] In some embodiments, at least one GIC may comprise, encode, or be derived from a sequence that is at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NOs 421, 422, 520, or 521. NO421, 422, 520 or 521 has a sequence encoding at least 100%, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10% or 5% homology.

[0342] In some embodiments, at least one GIC may comprise, encode, or be encoded by a sequence that is at least 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 10%, or 5% homologous to SEQ ID NO: 522, 523, 524, or 525.

[0343] GIS Design and Modularity

[0344] The disclosed GIS components (ie, RTC and GIC) can be used interchangeably with one another in combination to design a GIS having required or desired functionality.

[0345] In some embodiments, at least one GIS may include at least one RTC. In some embodiments, at least one GIS may include at least one GIC. In some embodiments, at least one GIS may include at least one RTC and at least one GIC.

[0346] Composition of GIS biopolymers

[0347] Compositions of biopolymers comprising GIS components can be selected combinatorially from those disclosed herein to design a GIS with desired or desirable functionality.

[0348] In some embodiments, at least one RTC can be introduced into at least one subject as an RNA biopolymer. In some embodiments, at least one RTC can be introduced into at least one subject as an mRNA biopolymer.

[0349] In some embodiments, at least one GIC can be introduced into at least one subject as an RNA biopolymer. In some embodiments, at least one GIC can be introduced into at least one subject as a linear RNA biopolymer.

[0350] In some embodiments, at least one RTC can be introduced into at least one subject as an RNA biopolymer, and at least one GIC can be introduced into at least one subject as an RNA biopolymer.

[0351] In some embodiments, at least one RTC can be introduced into at least one subject as an mRNA biopolymer, and at least one GIC can be introduced into at least one subject as an RNA biopolymer.

[0352] In some embodiments, at least one RTC and / or at least one GIC can be introduced into at least one subject as a DNA biopolymer. In some embodiments, at least one RTC and / or at least one GIC can be introduced into at least one subject as a plasmid.

[0353] In some embodiments, at least one RTC can be introduced into at least one subject as an amino acid biopolymer. In some embodiments, at least one RTC can be introduced into at least one subject as a protein.

[0354] In some embodiments, at least one RTC can be introduced into at least one subject as an amino acid biopolymer, and at least one GIC can be introduced into at least one subject as an RNA biopolymer. In some embodiments, at least one RTC can be introduced into at least one subject as a plasmid, and at least one GIC can be introduced into at least one subject as an RNA biopolymer.

[0355] In some embodiments, at least one RTC can be introduced into at least one subject as a plasmid, and at least one GIC can be introduced into at least one subject as a plasmid. In some embodiments, at least one RTC can be introduced into at least one subject as RNA (e.g., mRNA), and at least one GIC can be introduced into at least one subject as a plasmid.

[0356] Paired RT

[0357] The GIS of the present invention can be optimized for desired functions by designing or selecting the composition of the GIC, RTC, or at least one of the GICs, to control the interaction between the GIC and RTC. For example, varying the composition of the GIC and / or RTC can achieve variations in the efficiency, rate, and / or fidelity of full-length payload insertion, as monitored by detecting insertion using PCR, sequencing, and / or by payload transgene expression; the sequence specificity and / or chromosomal location of target site selection for payload insertion, as monitored by sequencing, hybridization, or other visualization of the genomic location of the inserted DNA; the selectivity of the RTC to utilize only the administered GIC as a template for reverse transcription; and the like. The term "paired RT" is used herein to refer to a specific RTC:RT module sequence administered in combination with a specific GIC sequence.

[0358] Without wishing to be bound by theory, altering the interaction between the RTC and the GIC can be achieved by selecting the RTC:RT module and the GIC:5' module and / or the GIC:3' module. For example, the specificity of the RTC for the GIC can be altered by selecting components derived from retrotransposition factors of the same or different species. As used herein, two GIS components are referred to as homologous if they are derived from retrotransposition factors of the same species. Conversely, two GIS components are referred to as heterologous if they are derived from retrotransposition factors of different species.

[0359] In some embodiments, at least one RTC:RT module comprises or encodes at least one sequence derived from a retroelement from a different species than at least one of the retroelement-derived GIC:5' module and / or GIC:3' module sequences (referred to herein as "heterologously paired RT").

[0360] In some embodiments, all retroelement-derived sequences in both the RTC and the GIC are derived from retroelements of the same species (referred to herein as "homologously paired RTs").

[0361] In some embodiments, heterologously paired RTs can have increased specificity compared to homologously paired RTs.

[0362] As used herein, the term "specificity" refers to the likelihood that a paired RT will efficiently and / or preferentially utilize the intended template RNA for transgene insertion.

[0363] In some embodiments, at least one GIS may comprise at least one combination of a GIC and a paired RT, such as Figure 7 Illustrated.

[0364] Exemplary GIS

[0365] In some embodiments, at least one GIS may comprise, encode, or be encoded by any combination of the following: (a) at least one RTC selected from, encoding, or encoded by any sequence selected from SEQ ID NOs: 1-59 or a sequence having at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) to any sequence selected from SEQ ID NOs: 1-59, and (b) at least one GIC selected from, encoding, or encoded by any sequence comprising any sequence of SEQ ID NOs: 250-276, or a sequence having one, two, or three nucleotide changes or substitutions relative to SEQ ID NOs: 250-276; SEQ ID NOs 60-154, or a sequence having one, two, or three nucleotide changes or substitutions relative to SEQ ID NOs: 60-154; NOs 278-279, or a sequence that is at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical) to, or to SEQ ID NOs 278-279; SEQ ID NOs 411-422 or 499-536; and / or SEQ ID NOs NO300-329 has a sequence that is at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical) to, or a sequence that is at least 90% identical (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical) to SEQ ID NOs 300-329.

[0366] III. Formulation and Delivery Mechanism

[0367] Nucleic Acids

[0368] In some embodiments, RTC constructs or GIC constructs can contain one or more modified nucleotides, such as, but not limited to, core base modifications, sugar modified nucleotides and / or backbone modifications. In some embodiments, RTC constructs or GIC constructs can contain combined modifications, such as combined core base and backbone modifications.

[0369] In some embodiments, the modified nucleotides may be nucleobase-modified nucleotides. A modified base refers to a nucleotide base that has been modified by replacing or adding one or more groups or atoms, such as, but not limited to, adenine, cytosine, thymine, guanine, uracil, xanthine, inosine, and quercetin. In some embodiments, the modified nucleotides may be backbone-modified nucleotides.

[0370] The RTC construct and / or GIC construct may comprise one or more substitutions, insertions and / or additions, deletions and covalent modifications relative to a reference sequence, in particular a sequence of interest, which are all included within the scope of the present invention.

[0371] In some embodiments, the RTC construct and / or GIC construct comprises one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, poly-A sequence, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, thiol groups and nitrosylation of tyrosine residues, etc.).

[0372] The RTC constructs and / or GIC constructs can comprise any useful modifications, such as modifications to the sugar, nucleobase, or internucleoside linkage (eg, to the phosphate linkage / to the phosphodiester linkage / to the phosphodiester backbone).

[0373] In some embodiments, the modification may include chemical or cell-induced modification. For example, Lewis and Pan describe some non-limiting examples of intracellular RNA modifications in "RNA modifications and structures cooperate to guide RNA-protein interactions" in NatReviews Mol Cell Biol, 2017, 18: 202-210.

[0374] In some embodiments, chemical modification of RNA can enhance immune evasion. RNA can be synthesized and / or modified by methods recognized in the art.

[0375] In some embodiments, at least one RNA construct may comprise at least one modified uracil. Examples of modified uracils include 5-methyl-uridine, 5-methoxy-uridine, pseudouridine, N1-methyl-pseudouridine, and / or 2-thiouridine. In some embodiments, at least one RNA construct may comprise at least one modified adenosine. Examples of modified adenosines include 2,6-diaminopurine deoxynucleotides.

[0376] In some embodiments, sugar modifications (eg, at the 2' position or the 4' position) or sugar replacements of one or more RNAs and backbone modifications can include modification or replacement of phosphodiester bonds.

[0377] Delivery Mechanism

[0378] The gene insertion system (GIS) of the present invention can be introduced into a subject via any delivery mechanism known in the art. As used herein, "delivery mechanism" refers to a method or composition for introducing a GIS, a component of a GIS, or a product of a GIS into a subject. Non-limiting examples of delivery mechanisms include delivery vectors, direct transfection (such as with a transfection agent), implantation into cells previously transfected with a GIS, and any combination thereof.

[0379] Delivery vehicle

[0380] In some embodiments, the GIS of the present invention may be formulated in a delivery vehicle. Generally speaking, the delivery vehicle can facilitate in vivo or in vitro transfection of a subject's cells by protecting the GIS components from degradation in the extracellular environment, promoting uptake by the subject's cells, enhancing endosomal escape, and any combination thereof. Delivery vehicles may include, but are not limited to, nanoparticles, including lipid-based nanoparticles (e.g., lipid nanoparticles (LNPs), liposomes, and micelles) and non-lipid nanoparticles (e.g., virus-like particles (VLPs) and polymeric delivery particles).

[0381] Nanoparticles

[0382] In some embodiments, the delivery vehicle may comprise at least one nanoparticle. Generally speaking, the term "nanoparticle" as used herein may refer to any particle having a size range of 10-1000 nm, for example, the particle may be 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550 0, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490 90, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660, 665, 670, 675, 680, 685, 690, 695, 700, 705, 710, 715, 720, 725, 730, 735, 740, 745, 750, 755, 760, 765, 770, 775, 780, 785, 790, 795, 800, 805, 810, 815, 820, 825, 830, 835, 840, 845, 850, 855, 860, 865, 870, 875, 880, 885, 890, 895, 900, 905, 910, 915, 920, 925, 930, 935, 940, 945, 950, 955, 960, 965, 970, 975, 980, 985, 990, 995 or 1000 nm.

[0383] lipid-based particles

[0384] In some embodiments, the delivery vehicle may comprise at least one lipid-based nanoparticle, including but not limited to lipid nanoparticles (LNPs), liposomes, micelles, and any combination thereof.

[0385] lipid nanoparticles

[0386] In some embodiments, delivery vehicle can be lipid nanoparticle (LNP). Generally speaking, LNP has external lipid layer, comprises the hydrophilic outer surface, non-aqueous or aqueous inner space (that is, respectively micelle-like and vesicle-like LNP) and at least one hydrophobic intermembrane space that are exposed to non-LNP environment. The LNP film can be non-lamellar or lamellar, and can be made up of 1,2,3,4,5 or more than 5 layers. LNP can be solid or semisolid. In some embodiments, at least one load or payload (such as GIS) can be present in the inner space of LNP, in the intermembrane space, on the external surface or its arbitrary combination.

[0387] LNPs useful herein are known in the art and typically include ionizable (cationic) lipids, phospholipids, cholesterol, and polymer-conjugated lipids. Without wishing to be bound by theory, cholesterol promotes membrane fusion and contributes to LNP stability, phospholipids can contribute to endosomal escape and provide structure to the LNP bilayer, polymer-conjugated lipids reduce LNP aggregation and "protect" LNPs from nonspecific endocytosis by immune cells, and ionizable (cationic) lipids enhance endosomal escape and complex negatively charged payloads (such as polynucleotides of GIS).

[0388] In some embodiments, the GIS of the present invention may be incorporated into LNPs. In some embodiments, the lipid nanoparticles may be composed of at least one cationic lipid (e.g., an ionizable cationic lipid), at least one non-cationic lipid (e.g., a phospholipid), at least one sterol (e.g., cholesterol), at least one polymer-conjugated lipid (e.g., a PEG-lipid), or any combination thereof. In some embodiments, the lipid nanoparticles may be composed of at least one cationic lipid (e.g., an ionizable cationic lipid), at least one non-cationic lipid (e.g., a phospholipid), at least one sterol (e.g., cholesterol), and at least one polymer-conjugated lipid (e.g., a PEG-lipid). In some embodiments, the LNPs may be composed of at least one cationic lipid (e.g., an ionizable cationic lipid), at least one non-cationic lipid (e.g., a phospholipid), and at least one polymer-conjugated lipid (e.g., a PEG-lipid). In some embodiments, LNPs may be composed of at least one non-cationic lipid (e.g., phospholipid), at least one sterol (e.g., cholesterol), and at least one polymer-conjugated lipid (e.g., PEG-lipid). In some embodiments, LNPs may be composed of at least one cationic lipid (e.g., ionizable cationic lipid) and at least one non-cationic lipid (e.g., phospholipid). In some embodiments, LNPs may be composed of at least one cationic lipid (e.g., ionizable cationic lipid) and at least one sterol. In some embodiments, LNPs may be composed of at least one cationic lipid (e.g., ionizable cationic lipid) and at least one polymer-conjugated lipid (e.g., PEG-lipid). In some embodiments, LNPs may be composed of at least one non-cationic lipid (e.g., phospholipid) and at least one sterol (e.g., cholesterol). In some embodiments, LNPs may be composed of at least one non-cationic lipid (e.g., phospholipid) and at least one polymer-conjugated lipid (e.g., PEG-lipid). In some embodiments, LNPs may be composed of at least one sterol (e.g., cholesterol) and at least one polymer-conjugated lipid (e.g., PEG-lipid). In some embodiments, LNP can be composed of at least one cationic lipid (e.g., ionizable cationic lipid). In some embodiments, LNP can be composed of at least one non-cationic lipid (e.g., phospholipid). In some embodiments, LNP can be composed of a sterol (e.g., cholesterol). In some embodiments, LNP can be composed of a polymer-conjugated lipid (e.g., PEG-lipid).

[0389] The LNPs described herein can be formed using techniques known in the art. As a non-limiting example, an organic solution containing lipids is mixed with an acidic aqueous solution containing GIS in a microfluidic channel, resulting in the formation of a GIS-loaded delivery vehicle.

[0390] micelles

[0391] In some embodiments, the delivery vehicle comprises at least one micelle. In some embodiments, micelles can be composed of any or all of the same components as lipid nanoparticles, the main difference being their method of manufacture. As used herein, "micelle" refers to a small particle that does not have an aqueous intragranular space. Without wishing to be bound by theory, the intragranular space of the micelle does not contain any additional lipid-head groups, but is instead occupied by the hydrophobic tails of the lipids that comprise the micellar membrane and possibly the associated GIS.

[0392] liposomes

[0393] In some embodiments, the delivery vehicle includes at least one liposome. In some embodiments, the liposome can be composed of any or all of the same components and the same amount of components as lipid nanoparticles, the main difference being their method of manufacture. "Liposome" as used herein refers to a vesicle consisting of at least one lipid bilayer membrane surrounding the space within the aqueous nanoparticle. In addition, liposomes are different from extracellular vesicles in that they are not usually derived from progenitor cells / host cells. The diameter of the liposome may be hundreds of nanometers, including a series of concentric bilayers separated by narrow aqueous spaces (i.e., (large) multilamellar vesicles (MLVs)), with a diameter of less than 50 nm (small unilamellar vesicles (SUVs)), and a diameter of 50 to 500 nm (large unilamellar vesicles (LUVs)).

[0394] exosomes

[0395] In some embodiments, the delivery vehicle comprises at least one exosome. Generally speaking, "exosome" refers to a small, membrane-bound extracellular vesicle of endocytic origin. The exosome membrane is typically composed of a lipid bilayer and a lamellar structure, with aqueous inter-nanoparticle spaces. In addition to the designed components, exosomes will tend to also include components of the host / progenitor cell membrane from which they are derived. Without wishing to be bound by theory, exosomes are typically released from host / progenitor cells into the extracellular environment after fusion of multivesicular bodies with the plasma membrane.

[0396] virus-like particles

[0397] In some embodiments, the delivery vector includes at least one virus-like particle (VLP). Generally speaking, a virus-like particle is a non-infectious vesicle that is primarily composed of a protein capsid, shell, shell, or sheath (all of which are understood herein to be interchangeable equivalents) derived from a virus that can carry a GIS. In some embodiments, VLPs can be synthesized using cellular machinery to express viral capsid protein sequences, which then self-assemble and bind to the GIS. In some embodiments, VLPs can be formed by providing capsid and GIS components without expressing the relevant cellular machinery and allowing them to self-assemble.

[0398] Non-limiting examples of viral families and species from which VLPs can be obtained include Parvoviridae, Retroviridae, Flaviviridae, Paramyxoviridae, adeno-associated virus, HIV, Hepatitis C virus, HPV, bacteriophage, or any combination thereof.

[0399] polymer delivery particles

[0400] In some embodiments, the delivery vehicle may comprise at least one polymer delivery particle. As used herein, "polymer delivery particle" refers to a non-aggregating delivery particle composed of a soluble polymer conjugated to a GIS moiety via various linking groups. In some embodiments, the polymer delivery agent may comprise any polymer described herein.

[0401] In some embodiments, the delivery vehicle may comprise a nucleic acid nanoparticle (NANP). Generally speaking, a "nucleic acid nanoparticle" is a small particle formed by non-coding nucleic acid sequences that interact to form a three-dimensional structure capable of carrying a payload (e.g., a GIS component).

[0402] Encapsulation

[0403] In some embodiments, the delivery vehicle may completely encapsulate the GIS disclosed herein. In some embodiments, the delivery vehicle may partially encapsulate the GIS disclosed herein. In some embodiments, in the final formulation, substantially 0% of the GIS present is exposed to the environment outside the delivery vehicle (i.e., the GIS is completely encapsulated). In some embodiments, the GIS is associated with the delivery vehicle but is at least partially exposed to the environment outside the delivery vehicle.

[0404] In some embodiments, the delivery vehicle may be characterized by its encapsulation efficiency, i.e., the percentage of GIS that is not exposed to the environment outside the delivery vehicle. For clarity, an encapsulation efficiency of about 100% refers to a delivery vehicle formulation in which substantially all of the GIS is completely encapsulated by the delivery vehicle, while an encapsulation efficiency of about 0% refers to a delivery vehicle in which substantially no GIS is encapsulated within the delivery vehicle, such as a delivery vehicle in which the GIS is bound to the outer surface of the delivery vehicle. In some embodiments, the delivery vehicle may have an encapsulation efficiency of less than about 100%, less than about 95%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, or less than 5%. In some embodiments, the delivery vehicle may have a density of about 90 to 100%, 80 to 100%, 70 to 100%, 60 to 100%, 50 to 100%, 40 to 100%, 30 to 100%, 20 to 100%, 10 to 100%, 80 to 90%, 70 to 90%, 60 to 90%, 50 to 90%, 40 to 90%, 30 to 90%, 20 to 90%, 10 to 90%, 70 to 80%, 60 to Packaging efficiencies of 80%, 50 to 80%, 40 to 80%, 30 to 80%, 20 to 80%, 10 to 80%, 60 to 70%, 50 to 70%, 40 to 70%, 30 to 70%, 20 to 70%, 10 to 70%, 40 to 50%, 30 to 50%, 20 to 50%, 10 to 50%, 30 to 40%, 20 to 40%, 10 to 40%, 20 to 30%, 10 to 30% and 10 to 20%.

[0405] Physical properties of delivery vehicle nanoparticles

[0406] In some embodiments, the delivery vehicles can be characterized by their shape. In some embodiments, the delivery vehicle can be, but is not limited to, substantially spherical, substantially rod-shaped (ie, cylindrical), or substantially disc-shaped.

[0407] In some embodiments, the delivery vectors can be characterized by their size. In some embodiments, the size of the delivery vector can be defined as its diameter. As used herein, "diameter" in relation to the size of a delivery vector refers to the diameter of the delivery vector's largest circular cross-section. In some embodiments, the diameter of the delivery vector can be from 30 nm to about 150 nm. For example, the diameter of the delivery vector can range from about 40 to 150 nm, 50 to 150 nm, 60 to 150 nm, about 70 to 150 nm, or 80 to 150 nm, 90 to 150 nm, 100 to nm, 110 to 150 nm, 120 to 150 nm, 130 to 150 nm, 140 to 150 nm, 30 to 30 to 140 nm, 40 to 140 nm, 50 to 140 nm, 60 to 140 nm, 70 to 140 nm, 80 to 140 nm, 90 to 1 40nm, 100 to 140nm, 110 to 140nm, 120 to 140nm, 130 to 140nm, 140 to 140nm, 30 to 140nm, 40 to 130nm, 50 to 130nm, 60 to 130nm, 70 to 130nm, 80 to 130nm, 90 to 130nm, 100 to 130nm, 110 to 130nm, 120 to 130nm, 30 to 120nm, 40 to 120nm, 50 to 120nm, 60 to 120nm, 70 to 120nm, 80 to 120nm, 90 to 120nm, 100 to 120nm, 110 to 120nm, 30 to 110nm, 40 to 110nm, 50 to 110nm, 60 to 110nm, 70 to 110nm, 80 to 110nm, 90 to 110nm, 100 to 110nm, 30 to 100nm, 40 to 100nm, 50 to 100nm, 60 to 100nm, 70 to 100nm, 80 to 100nm m, 90 to 100nm, 30 to 90nm, 40 to 90nm, 50 to 90nm, 60 to 90nm, 70 to 90nm, 80 to 90nm, 30 to 80nm, 40 to 80nm, 50 to 80nm, 60 to 80nm, 70 to 80nm, 30 to 70nm, 40 to 70nm, 50 to 70nm, 60 to 70nm, 30 to 60nm, 40 to 60nm, 50 to 60nm, 30 to 50nm, 40 to 50nm and 30 to 40nm.

[0408] In some embodiments, a population of delivery vehicles can be characterized by measuring the uniformity of a physical property (e.g., size, shape, or mass) of particles in the population, such as all delivery vehicles obtained from the same formulation. In some embodiments, uniformity can be expressed as the polydispersity index (PI) of the population. In some embodiments, uniformity can be expressed as the variance of the population. As used herein, the terms "polydispersity index" and "variability" are understood to be equivalent and may be used interchangeably.

[0409] In some embodiments, the population of delivery vehicles resulting from a given formulation will have a PI of about 0.1 to 1. In some embodiments, the population of delivery vehicles resulting from a given formulation will have a PI of about 0.1 to 1, 0.1 to 0.8, 0.1 to 0.6, 0.1 to 0.4, 0.1 to 0.2, 0.2 to 1, 0.2 to 0.8, 0.2 to 0.6, 0.2 to 0.4, 0.4 to 1, 0.4 to 0.8, 0.4 to 0.6, 0.6 to 1, 0.6 to 0.8, and 0.8 to 1. In some embodiments, the population of delivery vehicles resulting from a given formulation will have a PI of less than about 1, less than about 0.5, less than about 0.4, less than about 0.3, less than about 0.2, less than about 0.1.

[0410] Targeted delivery

[0411] In some embodiments, a delivery vehicle formulated with a GIS can facilitate localization of the GIS to any targeted region, tissue, cell, or physiological system described herein (i.e., the delivery vehicle is "targeted" to a designated location). In some embodiments, targeting can be achieved by formulation of a given delivery vehicle structural component. In some embodiments, a delivery vehicle can comprise a targeting agent.

[0412] Targeted agents

[0413] In some embodiments, the delivery vehicle may include at least one targeting agent. The term targeting agent as used herein may refer to a portion, compound, antibody, etc. (e.g., a portion targeting a specific cell or cell type) that specifically binds to a particular type or class of cells and / or other specific types of compounds in some embodiments. In some embodiments, the targeting agent may have affinity (i.e., specificity) for the surface of certain target cells, target cell surface antigens, target cell receptors, or a combination thereof.

[0414] In some embodiments, a targeting agent can refer to an agent that has a specific effect (e.g., lysis) when exposed to a specific type or class of substances and / or cells, and this effect can drive the delivery vector to target a specific type or class of cells.

[0415] In some embodiments, the term targeting agent may refer to an agent that may be part of a delivery vehicle and that plays a role in the specificity of the delivery vehicle for a target, although the agent itself may or may not be specific for a particular type or class of cells per se.

[0416] In some embodiments, the presence of at least one targeting agent in a delivery vehicle can increase the efficiency (e.g., the total amount or rate) of cellular uptake of a GIS delivered by the delivery vehicle. In some embodiments, the presence of at least one targeting agent in a delivery vehicle can increase the specificity (e.g., the total amount or rate) of cellular uptake of a GIS delivered by the delivery vehicle. As used herein, "specificity" refers to a higher efficiency of cellular uptake by target cells than by non-target cells.

[0417] In some embodiments, suitable targeting agents may include, but are not limited to, one or more small molecule targeting agents (e.g., carbohydrate moieties), antibodies, antibody-like molecules, peptides, vitamins (e.g., folic acid), sugars (e.g., lactose and galactose), artificial affinity molecules (e.g., peptide mimetics or aptamers), antibody fragments, single-chain variable fragments (scFv), cell surface receptors (e.g., T cell receptor (TCR), B cell receptor (BCR), or chimeric antigen receptor (CAR)), and any combination thereof.

[0418] In some embodiments, the cell surface antigen that the targeting agent can target may include any cell surface molecule of the target cell. Examples of suitable cell surface molecules include, but are not limited to, proteins, sugars, lipids, or other antigens on the cell surface. In some embodiments, the cell surface antigen undergoes internalization.

[0419] In some embodiments, a delivery vehicle can contain more than one targeting agent.

[0420] In some embodiments, at least one targeting agent can be incorporated into the lipid membrane of the nanoparticle. In some embodiments, at least one targeting agent can be present on the outer surface of the nanoparticle. In some embodiments, at least one targeting agent can be conjugated to the lipid component of the nanoparticle. In some embodiments, at least one targeting agent can be conjugated to the polymer component of the nanoparticle. In some embodiments, a monomer comprising a targeting agent residue (e.g., a polymerizable derivative of a targeting agent, such as an (alkyl) acrylic acid derivative of a peptide) can be copolymerized to form a polymer-conjugated lipid that forms a delivery vehicle. In some embodiments, at least one targeting agent can be anchored to the nanoparticle by hydrophobic and hydrophilic interactions between at least one targeting agent, the nanoparticle membrane, and the aqueous environment inside or outside the nanoparticle. In some embodiments, at least one targeting agent is conjugated to the peptide / protein component of the nanoparticle membrane. In some embodiments, at least one targeting agent is conjugated to a suitable linker moiety that is conjugated to a component of the nanoparticle membrane. In some embodiments, any combination of forces and bonds can result in the targeting agent being connected to the nanoparticle.

[0421] In some embodiments, one or more targeting agents can be coupled to the polymer of at least one delivery vector by a linking moiety. In some embodiments, the linking moiety can be a shearable linking moiety (e.g., comprising a shearable bond). In some embodiments, the linking moiety can include a bond that can be sheared by a specific enzyme (e.g., a phosphatase or protease). In some embodiments, the linking moiety can include a bond that can be sheared when the intracellular pH, redox potential, or other intracellular parameters change. In some embodiments, the linking moiety can include a bond that can be sheared when exposed to a matrix metalloproteinase (MMP).

[0422] Direct transfection

[0423] In some embodiments, the GIS disclosed herein can be directly transfected into target cells without the use of a delivery vehicle. In some embodiments, the GIS disclosed herein can be transfected into target cells using any technique known in the art. Such techniques may include, but are not limited to, chemical transfection methods (e.g., calcium phosphate exposure), physical transfection methods (e.g., electroporation, microinjection, and bioballistic particle delivery). In some embodiments, direct transfection can be performed using lipid-mediated transfection agents such as, but not limited to, lipofectamine, lipofectamine 2000, and any combination thereof.

[0424] Implantation of transfected cells

[0425] In some embodiments, the GIS of the present invention can be introduced into a cell population in vitro (e.g., by direct transfection as described herein) for subsequent implantation into a subject. In some embodiments, the cell population for implantation can be stem cells. In some embodiments, the cell population for implantation can be derived from a subject. In some embodiments, implantation can be performed by any method known in the art.

[0426] IV. Pharmaceutical Compositions and Routes of Administration

[0427] The present invention provides pharmaceutical compositions for administering a GIS to a subject. In some embodiments, the present invention provides pharmaceutical compositions for use as a medicament in the treatment of a therapeutic indication. In some embodiments, the pharmaceutical composition comprises at least one active ingredient (e.g., a GIS of the present invention) and at least one pharmaceutically acceptable excipient, adjuvant, carrier, diluent, or any combination thereof. In some embodiments, the pharmaceutical composition is formulated for at least one route of administration. In some embodiments, the pharmaceutical composition is formulated to deliver a specified dose of at least one active ingredient (e.g., a GIS), optionally according to a specified schedule.

[0428] As used herein, the term "pharmaceutical composition" refers to a composition comprising at least one active ingredient and, optionally, one or more pharmaceutically acceptable excipients. The phrase "active ingredient" as used herein generally refers to any of a GIS, a gene payload carried by the GIS for insertion into the genome of a subject, or an expression product of a gene payload carried by the GIS as described herein.

[0429] Pharmaceutical preparations and compositions

[0430] GIS can be formulated using one or more excipients to: (1) increase the stability of the GIS or a delivery mechanism comprising the GIS; (2) increase cell transfection or transduction; (3) allow for sustained or delayed introduction of the GIS into the cells of a subject; (4) alter biodistribution (e.g., target the GIS to a specific tissue or cell type); (5) increase expression of the encoding gene; (6) alter the release profile of the encoded protein; and / or (7) achieve regulatable expression of the GIS and / or GIS payload.

[0431] Without limitation, the formulation can comprise saline, liposomes, lipid nanoparticles, polymers, peptides, proteins, cells transfected with GIS (eg, for transfer or transplantation into a subject), and any combination thereof.

[0432] In some embodiments, the formulations of the pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the field of pharmacology. Generally speaking, such preparation methods include the step of combining the active ingredient with an excipient and / or one or more other auxiliary ingredients.

[0433] The formulations of the GIS and pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the art of pharmacology. Generally, such preparation methods include the steps of combining the active ingredient with an excipient and / or one or more other auxiliary ingredients, and then, if necessary and / or desired, dividing, shaping, and / or packaging the product into the desired single-dose or multi-dose units.

[0434] The pharmaceutical compositions described herein can be prepared, packaged, and / or sold in batches, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a "unit dose" refers to a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient. The amount of the active ingredient is generally equal to the dose of the active ingredient to be administered to a subject and / or a convenient fraction of such a dose, such as one-half or one-third of such a dose.

[0435] In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient can be approved by the U.S. Food and Drug Administration (United States Food and Drug Administration). In some embodiments, the excipient can meet the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia and / or the International Pharmacopoeia. In some embodiments, the purity of the pharmaceutically acceptable excipient can be at least 100%, at least 99%, at least 98%, at least 97%, at least 96% or 95%. In some embodiments, the excipient can be pharmaceutical grade.

[0436] In some embodiments, the relative amounts of pharmaceutically acceptable excipients, active ingredients and / or any other ingredients may be different in the pharmaceutical compositions of the present invention. In some embodiments, the relative amounts may be different according to the size, condition and / or characteristics of the subject being treated. In some embodiments, the relative amounts may be different according to the route of administration of the composition. For example, the composition may comprise 0.1% to 100% (e.g., 0.1% to 99%, 0.5 to 50%, 1-30%, 5-80% or at least 80% (weight / weight)) of active ingredient.

[0437] Excipients, diluents, and inactive ingredients

[0438] In some embodiments, the pharmaceutical composition may include any excipient known or discovered in the art. Examples of suitable excipients include, but are not limited to, any and all preservatives, isotonic agents, thickeners or emulsifiers, solvents, dispersion media, diluents or other liquid carriers, dispersion or suspension aids, surfactants, and combinations thereof. In some embodiments, the excipient may be selected based on its suitability for the desired particular dosage form.

[0439] In some embodiments, the formulations described herein may include at least one inactive ingredient. The term "inactive ingredient" as used herein refers to one or more agents included in the formulation that do not contribute to the activity of the active ingredient of the pharmaceutical composition. In some embodiments, some or all of the inactive ingredients in the pharmaceutical composition may be approved by the U.S. Food and Drug Administration (FDA), or none of the inactive ingredients in the pharmaceutical composition may be approved by the U.S. Food and Drug Administration (FDA).

[0440] In some embodiments, the pharmaceutical formulations disclosed herein may comprise cations or anions. In some embodiments, the pharmaceutical formulations comprise metal cations such as, but not limited to, Ca 2+ 、Zn 2+ 、Mn 2+ 、Cu 2+ Mg +and any combination thereof. In some embodiments, the pharmaceutical formulation may comprise a polymer complexed with a metal cation.

[0441] In some embodiments, the pharmaceutical composition may include one or more pharmaceutically acceptable salts. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds in which the parent compound is modified by converting an existing acid or base moiety into its salt form (e.g., by reacting a free base with a suitable organic acid). Pharmaceutically acceptable salts of the present invention include, for example, conventional non-toxic salts of any parent compound formed from non-toxic inorganic or organic acids. Pharmaceutically acceptable salts include, but are not limited to, alkali or organic salts of acidic residues such as carboxylic acids; and mineral or organic acid salts of basic residues such as amines.

[0442] In some embodiments, the pharmaceutical composition may include at least one solvent. In some embodiments, when water is the solvent, the solvate is often referred to as a "hydrate."

[0443] Route of administration

[0444] GIS, including pharmaceutical compositions comprising GIS described herein, can be administered by any delivery route that allows the GIS to be successfully integrated into the cells of the subject. Acceptable routes of administration include, but are not limited to, otic (in or through the ear), biliary infusion, buccal (toward the cheek), cardiac infusion, caudal block, conjunctival, cutaneous, dental (to one or more teeth), intracoronary, diagnostic, ear drops, electroosmosis, intracervical, intrasinus, intratracheal, enema, enteral (into the intestine), epidermal (applied to the skin), epidural (into the dura), extra-amniotic administration, in vitro, eye drops (onto the conjunctiva), gastrointestinal, hemodialysis, infiltration, insufflation (nasal inhalation), interstitial, intraperitoneal, intra-amniotic, intra-arterial (into an artery), intra-articular, Intrabiliary, intrabronchial, intrabursal, intracardiac (into the heart), intracartilaginous (into the cartilage), intracaudal (into the cauda equina), intracavernous (into the pathological cavity), intracavernous (into the base of the penis), intracerebral (into the brain), intraventricular (into the ventricles), intracisternal (into the cisterna magna), intracorneal (into the cornea), intracoronary (into the coronary artery), intracavernous (into the expandable space of the corpus cavernosum), intradermal (into the skin itself), intradiscal (into the intervertebral disc), intraductal (into the glandular duct), intraduodenal (into the duodenum) Intradigital), intradural (inside or below the dura mater), intraepidermal (to the epidermis), intraesophageal (to the esophagus), intragastric (in the stomach), intragingival (in the gums), intraileal (in the distal small intestine), intralesional (into a local lesion or introduced directly into a local lesion), intraluminal (in the lumen), intralymphatic (in the lymphatics), intramedullary (in the bone marrow cavity of a bone), intrameningeal (in the meninges), intramuscular (into a muscle), intramyocardial (into the heart muscle), intraocular (into the eye), intraosseous (into the bone marrow), intraovarian (into the ovary), intraparenchymal (into the brain tissue) ), intrapericardial (in the pericardium), intraperitoneal (infusion or injection into the peritoneum), intrapleural (in the pleura), intraprostatic (in the prostate), intrapulmonary (in the lung or its bronchi), intrasinus (in the nasal or periorbital sinuses), intraspinal (in the spine), intrasynovial (in the synovial cavity of a joint), intratendinous (in the tendon), intratesticular (in the testicle), intrathecal (into the spinal canal), intrathecal (in the cerebrospinal fluid at any level of the cerebrospinal axis), intrathoracic (in the chest cavity), intraluminal (in the tubules of an organ), intratumoral (in a tumor), intratympanic (in the middle ear media), intrauterine, intravaginal, intravascular (into one or more blood vessels), intravenous (into a vein), intravenous push, intravenous drip, intraventricular (into the brain chamber), intravesical infusion, intravitreal (through the eye), iontophoresis (with the help of an electric current, in which ions of soluble salts are moved into body tissues), irrigation (soaking or irrigating an open wound or body cavity), laryngeal (directly in the throat), nasal (through the nose), nasogastric (through the nose and into the stomach), nerve blocks, occlusive dressing techniques (topical routes of administration,Then covered with an occlusive dressing), ocular (to the external eye), oral (through the mouth), oropharyngeal (directly to the mouth and pharynx), parenteral, transdermal, periarticular, epidural, perineural, periodontal, photopheresis, rectal, respiratory (inhaled through the mouth or nasal cavity within the respiratory tract for local or systemic effect), retrobulbar (behind the pons or behind the eye), soft tissue, subarachnoid, subconjunctival, subcutaneous (under the skin), sublabial, sublingual, submucosal, topical, transdermal, transcutaneous (through spread through intact skin for systemic distribution), transmucosal (through spread through mucous membranes), transplacental (through or across the placenta), transtracheal (through the wall of the trachea), transtympanic (through or through the tympanic cavity), transvaginal, ureteral (to the ureters), urethral (to the urethra), vaginal, and spinal.

[0445] In some embodiments, the pharmaceutical compositions can be administered in a manner that enables them to cross the vascular barrier, the blood-brain barrier, or other epithelial barrier. The GIS can be administered in any suitable form, including but not limited to a liquid solution, a suspension, a solid form, a solid form suitable for dissolution in a liquid solution, a solid form capable of being suspended in a liquid solution, and any combination thereof.

[0446] In some embodiments, the GIS can be delivered to a subject via a multi-site administration route. The subject can be administered at 2, 3, 4, 5, or more than 5 sites.

[0447] In some embodiments, the GIS can be delivered to a subject by a single route of administration.

[0448] In some embodiments, GIS can be administered to a subject using a bolus infusion.

[0449] In some embodiments, GIS can be administered to a subject using sustained delivery (i.e., infusion) over a period of minutes, hours, or days. The infusion rate can be varied according to any delivery parameter, including but not limited to the nature of the subject, the desired distribution, the formulation used, etc.

[0450] In some embodiments, GIS can be delivered via an intramuscular delivery route, including but not limited to subcutaneous injection or intravenous injection.

[0451] In some embodiments, GIS can be delivered by oral administration, including but not limited to administration through the digestive tract or oral cavity.

[0452] In some embodiments, GIS may be delivered via an intraocular delivery route including, but not limited to, intravitreal injection or application of eye drops.

[0453] In some embodiments, GIS may be delivered via an intranasal delivery route including, but not limited to, nasal drops or nasal sprays.

[0454] In some embodiments, GIS can be administered to a subject by peripheral injection, including but not limited to intramuscular, intraperitoneal, intravenous, conjunctival, or joint injection.

[0455] In some embodiments, GIS can be delivered by injection into the cerebrospinal fluid, which may include, but is not limited to, intrathecal and intraventricular administration.

[0456] In some embodiments, GIS can be delivered via systemic delivery routes including, but not limited to, intravascular administration.

[0457] In some embodiments, GIS can be administered to a subject via intraparenchymal administration.

[0458] In some embodiments, GIS can be administered to a subject by topical administration.

[0459] In some embodiments, GIS can be administered to a subject via intracranial delivery.

[0460] In some embodiments, GIS can be administered to a subject via intramuscular administration.

[0461] In some embodiments, GIS can be administered to a subject via intravenous administration.

[0462] In some embodiments, GIS can be administered to a subject by subcutaneous administration.

[0463] In some embodiments, GIS can be delivered by more than one route of administration.

[0464] Injection and parenteral administration

[0465] In some embodiments, the pharmaceutical compositions described herein can be administered parenterally. Liquid dosage forms for parenteral and oral administration include, but are not limited to, pharmaceutically acceptable solutions, emulsions, microemulsions, elixirs, suspensions, and / or syrups. In addition to the active ingredient, the liquid dosage form may also include inert diluents commonly used in the art, such as solubilizers, water or other solvents and emulsifiers (e.g., polyethylene glycol, propylene glycol, 1,3-butylene glycol, tetrahydrofurfuryl alcohol, isopropyl alcohol, ethanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, dimethylformamide, oils, fatty acid esters of glycerol and dehydrated sorbitan) and any combination thereof. Exemplary oils may include cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil, and mixtures thereof. In some embodiments, the pharmaceutical composition comprises a solubilizer, such as an alcohol, oil, glycol, Modified oils, polysorbates, polymers, cyclodextrins, and / or combinations thereof. In some embodiments, a surfactant is included, such as hydroxypropyl cellulose.

[0466] In some embodiments, the injection preparation may include a sterile injectable aqueous or oily suspension. Suitable wetting agents, dispersants and / or suspending agents can be used to prepare sterile solutions for injection according to known techniques. Sterile injection preparations can be sterile injectable suspensions, solutions and / or emulsions in nontoxic, parenteral acceptable diluents and / or solvents. In some embodiments, the sterile injection preparation can be a 1,3-butanediol solution. In some embodiments, acceptable carriers and solvents include but are not limited to Ringer's solution, USP, water, isotonic sodium chloride solution and sterile fixed oil. In some embodiments, fixed oil can include any mild fixed oil (e.g., synthetic monoglyceride or diglyceride). In some embodiments, fatty acids such as oleic acid can be used to prepare injectables.

[0467] In some embodiments, the injectable formulations can be sterilized by filtering through a filter that retains bacteria and / or by adding a sterilizing agent. In some embodiments, the sterilizing agent can be in the form of a sterile solid composition that can be dissolved or dispersed in a sterile injectable medium such as sterile water before use.

[0468] It is often desired to slow down the absorption of the active ingredient from subcutaneous or intramuscular injections to prolong the effect of the active ingredient. In some embodiments, delayed absorption of the pharmaceutical composition given parenterally is achieved by dissolving or suspending the pharmaceutical composition in an oil vehicle. In some embodiments, the absorption of the active ingredient can be slowed down by using a liquid suspension of amorphous or crystalline material with poor water solubility. The absorption rate of the active ingredient depends on the dissolution rate, which in turn can depend on crystal size and crystalline form.

[0469] Oral administration

[0470] In some embodiments, the pharmaceutical compositions and / or preparations described herein can be administered orally. Solid dosage forms for oral administration include tablets, capsules, powders, pills, and granules. Generally speaking, for solid dosage forms, the active ingredient is mixed with at least one inert, pharmaceutically acceptable excipient, and inert, pharmaceutically acceptable excipients include but are not limited to dicalcium phosphate or sodium citrate, binders (e.g., carboxymethyl cellulose, alginate, gelatin, polyvinyl pyrrolidone, sucrose, and gum arabic), fillers or extenders (e.g., starch, lactose, sucrose, glucose, mannitol, and silicic acid), disintegrants (e.g., agar, calcium carbonate, potato or tapioca starch, alginic acid, some silicates, and sodium carbonate), absorption accelerators (e.g., quaternary ammonium compounds), humectants (e.g., glycerol), dissolution slowing agents (e.g., paraffin), absorbents (e.g., kaolin and bentonite), wetting agents (e.g., cetyl alcohol and glyceryl monostearate), lubricants (e.g., talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate), and any combination thereof. In the case of tablets, capsules and pills, the dosage form may comprise buffering agents.

[0471] Liquid dosage forms for oral administration may include those described above for parenteral administration.In addition to inert diluents, oral compositions may also include adjuvants such as emulsifying agents, wetting agents, suspending agents, flavoring agents, sweetening agents, and / or perfuming agents.

[0472] Topical or transdermal administration

[0473] In some embodiments, the pharmaceutical compositions and / or formulations described herein can be formulated for topical administration. The skin can be an ideal target site for delivery because it is easily accessible. In some embodiments, routes for delivering the pharmaceutical compositions described herein to or through the skin include, but are not limited to, topical application (e.g., for cosmetic applications and / or local / regional treatments), intradermal injection (e.g., for cosmetic applications and / or local / regional treatments), and systemic delivery (e.g., for treating skin diseases affecting the skin and extracutaneous areas).

[0474] In some embodiments, the pharmaceutical compositions and / or formulations described herein can be delivered using various dressing bandages (e.g., adhesive bandages) or (e.g., wound dressings) to effectively and / or conveniently implement the methods described herein. In some embodiments, a dressing or bandage can contain a sufficient amount of a pharmaceutical composition described herein to allow a user to perform multiple treatments.

[0475] Dosage forms for topical and / or transdermal administration may include lotions, creams, ointments, gels, sprays, pastes, powders, solutions, inhalants and / or patches. Typically, topical and / or transdermal administration can be formulated by mixing the active ingredient with a pharmaceutically acceptable excipient, buffer and / or any desired preservative under sterile conditions.

[0476] In some embodiments, a transdermal patch can be used. A transdermal patch can have another advantage, namely providing controlled delivery of pharmaceutical compositions described herein to health. Generally speaking, a transdermal patch can be prepared by dissolving and / or distributing pharmaceutical compositions described herein in a suitable medium. In some embodiments, the delivery rate can be controlled by dispersing the pharmaceutical compositions in a polymer matrix and / or gel, providing a rate-controlled membrane or any combination thereof.

[0477] In some embodiments, formulations suitable for topical administration may include liquid and / or semi-liquid preparations (e.g., liniments and lotions), oil-in-water and / or water-in-oil emulsions (e.g., ointments, creams, and / or pastes), solutions and / or suspensions, and any combination thereof.

[0478] Ocular or otic administration

[0479] In some embodiments, the pharmaceutical compositions described herein can be formulations suitable for ocular administration, otic administration, or both. Generally speaking, such formulations can be in the form of eye drops and / or ear drops, including but not limited to solutions and / or suspensions of the active ingredient in aqueous and / or oily liquid excipients. In some embodiments, such drops can contain salts, buffers, one or more other any additional ingredients described herein, and combinations thereof. In some embodiments, formulations that can be administered ocularly include liposomal formulations and / or microcrystalline active ingredients. In some embodiments, the pharmaceutical compositions can be administered subretinal.

[0480] Pulmonary drug delivery

[0481] In some embodiments, the pharmaceutical compositions described herein may be in a formulation suitable for pulmonary administration. In some embodiments, pulmonary administration is performed via the buccal cavity. In some embodiments, the pharmaceutical compositions may comprise dry particles comprising the active ingredient. In some embodiments, the diameter of the dry particles for pulmonary administration may range from about 0.5 to 7 nm or from about 1 to 6 nm.

[0482] In some embodiments, a self-propelled solvent / powder dispensing container can be used to administer the pharmaceutical composition. Generally speaking, the active ingredient can be dissolved and / or suspended in a low-boiling-point propellant in a sealed container. In some embodiments, the pharmaceutical composition can be in the form of a dry powder for administering using a device comprising a dry powder reservoir, to which a propellant stream can be directed to disperse such a powder. In some embodiments utilizing dry powders, the powder can comprise particles, wherein at least 98% of the particles by weight have a diameter greater than 0.5 nm, and at least 95% of the particles by number have a diameter less than 7 nm. In some embodiments, at least 95% of the particles by weight have a diameter greater than 1 nm, and at least 90% of the particles by number have a diameter less than 6 nm. In some embodiments, the dry pharmaceutical composition comprising the powder can comprise a solid fine powder diluent (e.g., sugar) and can be provided in a unit dose form for ease of use.

[0483] In some embodiments, the low-boiling-point propellant comprises a liquid propellant having a boiling point below 65°F at atmospheric pressure. In some embodiments, the propellant may comprise 50% to 99.9% (weight / weight) of the pharmaceutical composition, and the active ingredient may comprise 0.1% to 20% (weight / weight) of the pharmaceutical composition. In some embodiments, the propellant may comprise additional ingredients including, but not limited to, liquid nonionic surfactants, solid anionic surfactants, solid diluents (including, for example, solid diluents having a particle size of the same order of magnitude as the particles comprising the active ingredient), and any combination thereof.

[0484] In some embodiments, the pharmaceutical composition prepared for pulmonary delivery can be in the form of droplets of solution, suspension and combination thereof. When prepared, packaged and / or sold as a solution, suspension or combination thereof, any atomization and / or spray device can be used to give such a preparation. In some embodiments, the solution and / or suspension can be sterile. Exemplary solutions and / or suspensions include aqueous and / or diluted alcohol compositions. In some embodiments, the pharmaceutical composition prepared for pulmonary delivery can include flavorings (e.g., saccharin sodium), volatile oils, surfactants, buffers, preservatives (e.g., methyl hydroxybenzoates) and any combination thereof. In some embodiments, the average diameter of the droplets provided by this route of administration can be in the range of about 0.1 nm to about 200 nm.

[0485] Intranasal, nasal, or buccal administration

[0486] In some embodiments, the pharmaceutical compositions described herein can be administered intranasally, nasally, or both. In some embodiments, pharmaceutical compositions for intranasal delivery may include those described herein for pulmonary delivery. In some embodiments, pharmaceutical compositions for intranasal administration include coarse powders having an average particle size of about 0.2 μm to 500 μm, the coarse powders comprising active ingredients. In some embodiments, the pharmaceutical compositions can be administered by rapid inhalation through the nasal passages from a powder container held close to the nose, i.e., in the form of snuff. Exemplary pharmaceutical formulations may comprise from about 0.1% (weight / weight) to 100% (weight / weight) of active ingredient, and may comprise one or more additional ingredients described herein.

[0487] In some embodiments, the pharmaceutical composition may be a formulation suitable for buccal administration, including but not limited to tablets, lozenges, and any combination thereof. Generally speaking, such tablets or lozenges can be made using conventional methods and may contain 0.1%-20% (weight / weight) active ingredient (given as non-limiting examples), any combination of orally soluble or orally degradable compositions, and optionally one or more additional ingredients described herein. In some embodiments, a pharmaceutical composition suitable for buccal administration may include any combination of a powder, an aerosolized solution and / or suspension, or an atomized solution and / or suspension, comprising an active ingredient having a dispersed average particle size and / or droplet size of about 0.1 nm to 200 nm. In some embodiments, a pharmaceutical composition for buccal administration may also include one or more of any additional ingredients described herein.

[0488] Depot administration

[0489] In some embodiments, the pharmaceutical compositions described herein are formulated in a depot for extended release. In some embodiments, the pharmaceutical compositions described herein are spatially retained within or near the target tissue.

[0490] Injectable reservoir forms are typically prepared by forming a microcapsule matrix of the pharmaceutical composition in a biodegradable polymer (e.g., polylactide-polyglycolide). Generally speaking, the release rate of the pharmaceutical composition can be controlled by changing the ratio of the pharmaceutical composition to the polymer and the properties of the specific polymer used. Suitable biodegradable polymers include, but are not limited to, poly(orthoesters) and poly(anhydrides). Reservoir injection formulations are prepared by encapsulating the pharmaceutical composition in a liposome or microemulsion compatible with body tissues.

[0491] Rectal and vaginal administration

[0492] In some embodiments, the pharmaceutical compositions described herein can be administered rectally, vaginally, or any combination thereof. Generally, compositions for rectal or vaginal administration are suppositories, which can be prepared by mixing the active ingredient with a suitable non-irritating excipient (e.g., polyethylene glycol, cocoa butter, or suppository wax) that is solid at ambient temperature but liquid at body temperature. The suppository melts in the rectum or vaginal cavity to release the active ingredient.

[0493] dose

[0494] GIS and / or pharmaceutical compositions comprising GIS can be administered in any amount (i.e., dosage) that produces a desired effect in a subject (e.g., a desired therapeutic effect, research results, etc.). In some embodiments, the desired dosage can be determined based on subject parameters (e.g., subject size, condition, or characteristics), effect parameters (e.g., the desired degree of response, therapeutically effective threshold, duration of effect, or presence of side effects), or any combination thereof. In some embodiments, the appropriate dosage can be determined prior to the initial administration, optionally based on at least one measurement that tests at least one subject parameter. In some embodiments, the appropriate dosage can be determined after the initial administration, optionally based on at least one measurement that tests at least one effect parameter. In some embodiments, the dosage can remain unchanged throughout the administration process. In some embodiments, the dosage can be changed once, twice, or more times during the administration process.

[0495] In some embodiments, the dosage can be described as the ratio of the mass of active ingredient to the mass of the subject (eg, in mg / kg). For example, the dose can be 0.1 to 100, 1 to 100, 2 to 100, 3 to 100, 4 to 100, 5 to 100, 6 to 100, 7 to 100, 8 to 100, 9 to 100, 10 to 100, 15 to 100, 20 to 100, 25 to 100, 30 to 100, 35 to 100, 40 to 100, 45 to 100, 50 to 100, 55 to 100, 60 to 100, 65 to 100, 70 to 100, 75 to 100, 80 to 100, 85 to 100, 90 to 100, 95 to 100, 0.1 to 95, 1 to 95, 2 to 95, 3 to 95, 4 to 95, 5 to 95 , 6 to 95, 7 to 95, 8 to 95, 9 to 95, 10 to 95, 15 to 95, 20 to 95, 25 to 95, 30 to 95, 35 to 95, 40 to 95, 45 to 95, 50 to 95, 55 to 95, 60 to 95, 65 to 95, 70 to 95, 75 to 95, 80 to 95, 85 to 95, 90 to 95, 0.1 to 90, 1 to 90, 2 to 90, 3 to 90, 4 to 90, 5 to 90, 6 to 95, 7 to 90, 8 to 90, 9 to 90, 10 to 90, 15 to 90, 20 to 90, 25 to 90, 30 to 90, 35 to 90, 40 to 90, 45 to 90, 50 to 9 0, 55 to 90, 60 to 90, 65 to 90, 70 to 90, 75 to 90, 80 to 90, 85 to 90, 0.1 to 85, 1 to 85, 2 to 85, 3 to 85, 4 to 85, 5 to 85, 6 to 85, 7 to 85, 8 to 85, 9 to 85, 10 to 85, 15 to 85, 20 to 85, 25 to 85, 30 to 85, 35 to 85, 40 to 85, 45 to 85, 50 to 85, 55 to 85, 60 to 85, 65 to 85, 70 to 85, 75 to 85, 80 to 85, 0.1 to 80, 1 to 80, 2 to 80, 3 to 80, 4 to 80, 5 to 80, 6 to 80, 7 to 80 , 8 to 80, 9 to 80, 10 to 80, 15 to 80, 20 to 80, 25 to 80, 30 to 80, 35 to 80, 40 to 80, 45 to 80, 50 to 80, 55 to 80, 60 to 80, 65 to 80, 70 to 80, 75 to 80, 0.1 to 75, 1 to 75, 2 to 75, 3 to 75, 4 to 75, 5 to 75, 6 to 75, 7 to 75, 8 to 75, 9 to 75, 10 to 75, 15 to 75, 20 to 75, 25 to 75, 30 to 75, 35 to 75, 40 to 75, 45 to 75, 50 to 75, 55 to 75, 60 to 75, 65 to 75, 70 to 75, 0.1 to 70, 1 to 70, 2 to 70, 3 to 70, 4 to 70, 5 to 70, 6 to 70, 7 to 70, 8 to 70, 9 to 70, 10 to 70, 15 to 70, 20 to 70, 25 to 70, 30 to 70, 35 to 70, 40 to 70, 45 to 70, 50 to 70, 55 to 70, 60 to 70, 65 to 70, 0.1 to 65, 1 to 65, 2 to 65, 3 to 65, 4 to 65, 5 to 65, 6 to 65, 7 to 65, 8 to 65, 9 to 65, 10 to 65, 15 to 65, 20 to 65, 25 to 65, 30 to 65, 35 to 65, 40 to 65, 45 to 65, 50 to 65, 55 to 65, 60 to 65, 0. 1 to 60, 1 to 60, 2 to 60, 3 to 60, 4 to 60, 5 to 60, 6 to 60, 7 to 60, 8 to 60, 9 to 60, 10 to 60, 15 to 60, 20 to 60, 25 to 60, 30 to 60, 35 to 60, 40 to 60, 45 to 60, 50 to 60, 55 to 60, 0.1 to 55, 1 to 55, 2 to 55, 3 to 55, 4 to 55, 5 to 55, 6 to 55, 7 to 55, 8 to 55, 9 to 55, 10 to 55, 15 to 55, 20 to 55, 25 to 55, 30 to 55, 35 to 55, 40 to 55, 45 to 55, 50 to 55, 0.1 to 50, 1 to 50, 2 to 50, 3 to 50, 4 to 50, 5 to 50, 6 to 50, 7 to 50, 8 to 50, 9 to 50, 10 to 50, 15 to 50, 20 to 50, 25 to 50, 30 to 50, 35 to 50, 40 to 50, 45 to 50, 0.1 to 45, 1 to 45, 2 to 45, 3 to 45, 4 to 45, 5 to 45, 6 to 45, 7 to 45, 8 to 45, 9 to 45, 10 to 45, 15 to 45, 20 to 45, 25 to 45, 30 to 45, 35 to 45, 40 to 45, 0.1 to 40, 1 to 40, 2 to 40, 3 to 40, 4 to 40, 5 to 40, 6 to 40, 7 to 40, 8 to 40, 9 to 40, 10 to 40, 15 to 40, 20 to 40, 25 to 40 , 30 to 40, 35 to 40, 0.1 to 35, 1 to 35, 2 to 35, 3 to 35, 4 to 35, 5 to 35, 6 to 35, 7 to 35, 8 to 35, 9 to 35, 10 to 35, 15 to 35, 20 to 35, 25 to 35, 30 to 35, 0.1 to 30, 1 to 30, 2 to 30, 3 to 30, 4 to 30, 5 to 30, 6 to 30, 7 to 30, 8 to 30, 9 to 30, 10 to 30, 15 to 30, 20 to 30, 25 to 30, 0.1 to 25, 1 to 25, 2 to 25, 3 to 25, 4 to 25, 5 to 25, 6 to 25, 7 to 25, 8 to 25, 9 to 25, 10 to 25, 15 to 25, 20 to 25, 0.1 to 20, 1 to 20, 2 to 20, 3 to 20, 4 to 20, 5 to 20, 6 to 20, 7 to 20, 8 to 20, 9 to 20, 10 to 20, 15 to 20, 0.1 to 15, 1 to 15, 2 to 15, 3 to 15, 4 to 15, 5 to 15, 6 to 15, 7 to 15, 8 to 15, 9 to 15, 10 to 15, 0.1 to 10, 1 to 10, 2 to 10, 3 to 10, 4 to 10, 5 to 10, 6 to 10, 7 to 10, 8 to 10, 9 to 10, 0.1 to 9, 1 to 9, 2 to 9, 3 to 9, 4 to 9, 5 to 9, 6 to 9, 7 to 9, 8 to 9, 0.1 to 8, 1 to 8, 2 to 8, 3 to 8, 4 to 8, 5 to 8, 6 to 8, 7 to 8, 0.1 to 7, 1 to 7, 2 to 7, 3 to 7, 4 to 7, 5 to 7, 6 to 7, 0.1 to 6, 1 to 6, 2 to 6, 3 to 6, 4 to 6, 5 to 6, 0.1 to 5, 1 to 5, 2 to 5, 3 to 5, 4 to 5, 0.1 to 4, 1 to 4, 2 to 4, 3 to 4, 0.1 to 3, 1 to 3, 2 to 3, 0.1 to 2, 1 to 2, or 0.1 to 1 mg / kg.

[0496] Dosage regimen

[0497] GIS and / or pharmaceutical compositions comprising GIS can be administered at any frequency (i.e., dosing regimen) that produces a desired effect in a subject (e.g., a desired therapeutic effect, research outcome, etc.). In some embodiments, the dosing regimen can be determined by any of the methods used to determine dosages described herein. In some embodiments, GIS can be administered only once.

[0498] In some embodiments, the GIS may be administered more than once. For example, the GIS may be administered 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times. In some embodiments, the GIS may be administered intermittently and / or continuously during the course of treating the subject for the therapeutic indication. In some embodiments, the GIS may be administered repeatedly throughout the subject's lifetime.

[0499] V. How to use

[0500] Target area, tissue or cell for GIS delivery

[0501] Provided herein are methods for delivering the pharmaceutical compositions and / or formulations described herein to at least one target location in a subject by contacting at least one target site (including one or more target cells), such as a physiological system, anatomical location, organ, tissue, cell type, cell population, etc., with at least one pharmaceutical composition and / or formulation described herein.

[0502] The pharmaceutical compositions and / or formulations described herein contain sufficient active ingredient (eg, a GIS of the invention) to produce the effect of interest in at least one cell at the target site (eg, insertion of at least one transgene into the genome of a subject).

[0503] In some embodiments, the pharmaceutical compositions and / or formulations described herein generally comprise one or more cell permeation agents, although "naked" formulations (such as without a cell permeation agent or other agent) are also contemplated, with or without a pharmaceutically acceptable carrier.

[0504] Physiological system

[0505] In some embodiments, the pharmaceutical compositions and / or formulations described herein target a physiological system.

[0506] In some embodiments, the physiological systems may include the auditory system, cardiovascular system, central nervous system, chemoreceptor system, circulatory system, digestive system, endocrine system, excretory system, exocrine system, reproductive system (genital), integumentary system, lymphatic system, muscular system, musculoskeletal system, nervous system, peripheral nervous system, renal system, reproductive system (reproductive), respiratory system, urinary system and visual system.

[0507] In some embodiments, the pharmaceutical compositions and / or formulations described herein target the amine precursor uptake and decarboxylation (APUD) system (a series of cells that have endocrine function and secrete a variety of small amine or polypeptide hormones), such as, but not limited to, pituitary tissue, parathyroid tissue, thyroid tissue, bronchial tissue, adrenal medulla tissue, pancreatic tissue, stomach and intestines, carotid body, and chemoreceptor system tissue.

[0508] organ

[0509] In some embodiments, the pharmaceutical compositions and / or formulations described herein target organs. Organs include anal canal, arteries, ascending colon, bladder, bone marrow, brain, bronchi, bronchioles, bulbourethral glands, capillaries, cecum, cerebellum, cerebral hemispheres, brain, cervix, choroid plexus, clitoris, cranial nerves, descending colon, diencephalon, duodenum, ear, enteric nervous system, epididymis, esophagus, external genitalia, fallopian tubes, gallbladder, ganglia, taste organs, gut-associated lymphoid tissue, heart, ileum, internal genitalia, interstitial tissue, jejunum, joints, kidneys, large intestine, larynx, ligaments, liver, lungs, lymph nodes , lymphatic vessels, mammary glands, medulla oblongata, mesentery, midbrain, oral cavity, respiratory muscles, nasal cavity, nerves, olfactory organs, ovaries, pancreas, parotid glands, penis, pharynx, placenta, pons, prostate, rectum, salivary glands, scrotum, seminal vesicles, sigmoid colon, bones, skin, small intestine, spinal nerves, spleen, stomach, subcutaneous tissue, sublingual glands, submandibular glands, teeth, tendons, testicles, brainstem, spinal cord, ventricular system, thymus, tongue, tonsils, trachea, transverse colon, ureters, urethra, uterus, vagina, vas deferens, veins and vulva.

[0510] In some embodiments, the pharmaceutical compositions and / or formulations described herein are targeted to one or both eyes.

[0511] In some embodiments, the pharmaceutical compositions and / or formulations described herein are targeted to the liver.

[0512] In some embodiments, the pharmaceutical compositions and / or formulations described herein are targeted to the brain.

[0513] cell

[0514] In some embodiments, the pharmaceutical compositions and / or formulations described herein are targeted to specific cells and / or cell types.

[0515] Cells include adipocytes, adrenergic neurons, α cells, amacrine cells, ameloblasts, anterior lens epithelial cells, anterior / intermediate pituitary cells, apocrine sweat gland cells, astrocytes, auditory inner hair cells of the organ of Corti, auditory outer hair cells of the organ of Corti, B cells, Bartholin's gland cells, basal cells (stem cells) of the cornea, tongue, oral cavity, nasal cavity, distal anal canal, distal urethra and distal vagina, basal cells of the olfactory epithelium, basket cells, basophils and precursors, β cells, Bates cells, bone marrow reticular fibroblasts, marginal fibroblasts of the organ of Corti Boundary cells, border cells, Bowman's gland cells, brown fat cells, Brenner's gland cells, bulbourethral gland cells, shrub cells, C cells, Cajal-Retzius cells, cardiomyocytes, cardiomyocytes, cartwheel cells, glucocorticoid-producing zona fasciculata cells, mineralocorticoid-producing zona glomerulosa cells, androgen-producing zona reticularis cells, adrenal cortical cells, cementoblasts, cardiomyocytes, cerumen cells, chandelier cells, chemoreceptor bulb cells of carotid body cells, principal cells, cholinergic neurons, chromaffin cells, club cells cells), cold-sensitive primary sensory neurons, connective tissue macrophages (all types), corneal fibroblasts (keratinocytes), luteal cells of ruptured ovarian follicles that secrete progesterone, cortical hair stem cells, corticotrophin-producing cells, lens fiber cells containing crystallin, keratinocyte hair stem cells, cytotoxic T cells, d cells, delta cells, dendritic cells, bifascicular cells, duct cells, eccrine sweat gland clear cells, eccrine sweat gland dark cells, efferent duct cells, elastic chondrocytes, endothelial cells, enteric glial cells, enterochromaffin cells, enterochromaffin-like cells, enteroendocrine cells, eosinophils and their precursors, ependymal cells, epidermal basal cells, epidermal Langerhans cells, epididymal basal cells, epididymal chief cells, epithelial reticular cells, epsilon cells, erythrocytes, fibrochondrocytes, forked neurons, foveolar cells, g cells, gallbladder epithelial cells, germ cells, and gland cells of litter cell), Morel gland cells in the eyelids, glial cells, Golgi cells, gonadal stromal cells, gonadotroph cells, granule cells, granulosa cells, granulosa-lutein cells, grid cells, and head direction cells.

[0516] In some embodiments, the cell can be a cancer cell.In some embodiments, the cell can be a non-cancerous cell.

[0517] In some embodiments, the eukaryotic cell can be a stem cell. A variety of stem cell types are known in the art, any one or all of which can be used in the practice of the present disclosure. Example stem cells include, but are not limited to, embryonic stem cells, hematopoietic stem cells, neural stem cells, epidermal neural crest stem cells, induced pluripotent stem cells, mammary stem cells, intestinal stem cells, mesenchymal stem cells, olfactory adult stem cells, testicular cells, and progenitor cells (e.g., neural, angioblasts, osteoblasts, chondroblasts, pancreas, epidermis, etc.). In some embodiments, the stem cell can be a stem cell line derived from cells taken from a subject.

[0518] In some embodiments, the eukaryotic cell is a cell found in the circulatory system of a human, non-human primate, and / or other mammal, including a mouse and / or rat. Exemplary circulating system cells include, but are not limited to, platelets, plasma cells, erythrocytes, B cells, T cells, natural killer cells, macrophages, neutrophils, their precursors, and the like. In some embodiments, the at least one eukaryotic cell may be derived from any of these circulating eukaryotic cells.

[0519] In some embodiments, the at least one eukaryotic cell is a natural killer cell, or a precursor or progenitor cell of a natural killer cell.

[0520] In some embodiments, the at least one eukaryotic cell is a B cell, or a B cell precursor or progenitor cell.

[0521] In some embodiments, the eukaryotic cell can be a plant cell. In some embodiments, the plant cell is a cell of a monocot or dicot plant, including but not limited to squash, woody plants such as conifers and deciduous trees, wheat, turnips, tomatoes, tobacco, sunflowers, sugarcane, sugar beets, strawberries, spinach, soybeans, sorghum, rye, rice, raspberries, rapeseed, radishes, pumpkins, potatoes (including sweet potatoes), plums, pineapples, peanuts, peas, papayas, oats, melons, mangoes, corn, lettuce, lentils, herbs, hemp, grasses, flowers, eucalyptus, cucumbers, cotton, coffee, citrus, chicory, cherries, celery, cauliflower, carrots, rapeseed, cabbage, broccoli, Brassica spp. Plants, blackberries, beans, barley, bananas, avocados, asparagus, Arabidopsis and other fruiting plants, ornamentals, almonds, alfalfa, perennial grasses, forage crops, other vegetables, other stone fruits (e.g., peaches, nectarines, apricots, pears, plums, etc.), other pome fruits (e.g., apples, pears, etc.), other fruits, other bulb vegetables (e.g., garlic, onions, leeks, etc.), other crops, perennial plant parts (e.g., bulbs; tubers; roots; crowns; stems; runners; tillers; shoots; cuttings, including unrooted cuttings, rooted cuttings, callus cuttings or plantlets produced from callus; apical meristem, etc.), and any combinations or hybrids thereof. As used herein, the term "plant" refers to all physical parts of a plant, including seeds, seedlings, saplings, roots, tubers, stems, stalks, leaves, and fruits.

[0522] tumor

[0523] In some embodiments, the pharmaceutical compositions and / or formulations described herein target a tumor. The tumor can be a benign tumor, a premalignant tumor, or a malignant tumor.

[0524] Insertion of transgene

[0525] The present invention provides methods for introducing a transgene into a subject, such as a human subject. In some embodiments, the methods comprise introducing into the subject an effective amount of at least one GIS described herein. In some embodiments, the methods comprise introducing into the subject an effective amount of at least one GIS comprising a transgene.

[0526] In some embodiments, the method may include inserting a transgene into one or more target insertion sites. Figure 8, which illustrates a subject's genomic region 500 with an inserted transgene. In this example, the subject's genomic DNA includes the target insertion site 120 and the surrounding genomic DNA 110. For clarity, it should be understood that the target insertion site is a portion of the subject's DNA. A 5' junction 510 marks the transition point between the subject's DNA and the inserted transgene 520, at the 5' end of the transgene; this junction 510 may contain a partial or complete duplication of any upstream target site sequence present both in the subject's genome and at the 5' end of the template RNA. Conversely, a 3' junction 530 marks the transition point between the 3' end of the transgene and the subject's DNA; this junction 530 may contain a partial or complete duplication of any downstream target site sequence present both in the subject's genome and in the 3' module of the template RNA. Junctions 510 and / or 530 may also contain additional nucleotide(s), such as may be derived from the addition of non-templated nucleotides to the unextended primer or to the 3' end of the cDNA by RT prior to enzyme dissociation from the template-product duplex.

[0527] Target insertion site

[0528] In some embodiments, one or more target insertion sites include safe harbor sites. Term used herein " safe harbor site " refers to the position in the subject's genome where the insertion of a transgenic gene does not result in the unexpected interruption of cellular function. Generally speaking, if (a) the insertion of genetic material at this site does not change the expression of the subject's gene, or (b) the insertion of genetic material at this site changes the expression of the gene, but the change does not change normal subject's cell function (e.g., due to a large number of repetitions of destroyed genes in the subject's genome), the site in the subject's genome can be determined as a safe harbor site. As a non-limiting example of situation (b), the gene encoding ribosomal RNA (rRNA) is repeated so many times in the genome that the destruction of some rRNA genes does not disrupt normal cellular function.

[0529] In some embodiments, at least one safe harbor site and / or target insertion site comprises at least one ribosomal DNA (rDNA) sequence. As used herein, the term "ribosomal DNA" refers to any gene encoding rRNA. In some embodiments, at least one safe harbor site and / or target insertion site comprises at least one 28S rDNA sequence.

[0530] genetically modified

[0531] The methods and compositions of the present invention can be used to insert any payload sequence (ie, transgene) and are not limited by the length or source of the payload sequence.

[0532] In some embodiments, the transgene comprises a therapeutically active gene. As used herein, the term "therapeutically active gene" refers to any gene having an expression product that is used to treat, ameliorate, or prevent at least one therapeutic indication.

[0533] In some embodiments, at least one transgene may include at least one telomerase reverse transcriptase (TERT) gene. In some embodiments, at least one transgene may include at least one Factor VIII short form gene. In some embodiments, at least one transgene may include at least one phenylalanine hydroxylase (PAH) gene.

[0534] In some embodiments, at least one transgene is a reporter gene.The term "reporter gene" as used herein refers to any gene having an expression product that is detectable by any assay.

[0535] In some embodiments, the at least one reporter gene may include or encode, but is not limited to, at least one green fluorescent protein (GFP), at least one red fluorescent protein (RFP), luciferase (LUC), β-galactosidase (LacZ), chloramphenicol acetyltransferase (cat), and the like.

[0536] Non-wild-type transgenic

[0537] Those skilled in the art will appreciate that, while many of the primary examples of transgenes given reference natural or wild-type sequences, the GIS disclosed herein are in no way limited to the insertion of wild-type or naturally occurring genes or portions of gene sequences. The GIS of the present invention can be used to insert, for example, genes that are derived from a wild-type gene, comprise only portions of a wild-type gene, are assemblies of portions from different wild-type genes, and / or are genes whose sequences are not known to exist in nature. Furthermore, the GIS of the present invention can be used to insert transgenes whose expression products are not normally present in the cells of the subject and / or are not normally the result of gene expression.

[0538] Transgene regulatory elements

[0539] In some embodiments, the GIS of the present invention can be used to insert at least one transgene comprising or encoding at least one regulatory element. For example, a transgene can be designed and / or engineered to include any number of miRNA and / or siRNA binding regions within the transgene expression product. Generally, the inclusion of miRNA and / or siRNA allows for the detargeting of transgene expression from cell types that contain the complementary miRNA or siRNA in their transcriptomes.

[0540] In some embodiments, the transgene may comprise or encode both a first expression product (or more), wherein the first expression product comprises or encodes at least one miRNA and / or siRNA, and a second expression product (or more), wherein the first expression product comprises or encodes at least one miRNA and / or siRNA binding site complementary to the first expression product. Without wishing to be bound by theory, this may prevent long-term expression of the second expression product.

[0541] Antibody

[0542] The term "antibody" as used herein refers to and specifically encompasses various embodiments in the broadest sense, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies formed from at least two complete antibodies) and antibody fragments (e.g., diabodies), as long as they exhibit the desired biological activity (e.g., "functionality"). Antibodies are primarily amino acid-based molecules that are monomeric or multimeric polypeptides comprising at least one amino acid region derived from a known or parent antibody sequence. Antibodies may comprise amino acid motifs that recruit one or more endogenous or non-natural modifications (including but not limited to added sugar moieties, fluorescent moieties, chemical tags, etc.). For the purposes of this article, an "antibody" may include heavy and light chain variable domains and an Fc region.

[0543] The GIS of the present invention can be used to insert a transgene comprising or encoding at least one or more functional antibodies.

[0544] Treatment for indications

[0545] The present invention provides methods for treating or preventing at least one therapeutic indication in a subject in need thereof. In some embodiments, the methods comprise introducing into the subject an effective amount of at least one GIS described herein. In some embodiments, the methods comprise introducing into the subject an effective amount of at least one GIS comprising at least one therapeutically active transgene.

[0546] In some embodiments, the at least one therapeutic indication comprises at least one loss-of-function genetic disorder. In some embodiments, at least one method for treating at least one therapeutic indication comprises administering at least one transgene that rescues the subject from the loss-of-function genetic disorder. As used herein, the term "rescue" refers to providing a subject with at least one composition that enables the subject to perform a natural function that was otherwise absent.

[0547] In some embodiments, at least one method comprises rescuing insufficient telomerase activity in a subject by administering to the subject an effective amount of a GIS comprising at least one TERT transgene.

[0548] In some embodiments, the methods and compositions of the present invention can be used to treat or prevent a condition caused by insufficient telomerase function in a subject. In some embodiments, at least one method comprises administering a therapeutically effective amount of at least one GIS comprising at least one TERT gene to a subject exhibiting insufficient telomerase activity. In some embodiments, at least one method comprises administering a therapeutically effective amount of at least one GIS comprising at least one TERT gene to a subject suspected of developing a condition caused by insufficient telomerase activity.

[0549] Regulation of heterologous genes

[0550] The GIS of the present invention, including the formulations and pharmaceutical compositions described herein, can be used in methods for modulating expression of heterologous genes. For clarity, the term "heterologous gene" as used herein to modulate gene expression refers to any gene in the genome of a subject other than the gene into which the GIS is inserted.

[0551] Generally speaking, methods for regulating heterologous gene expression can include using the GIS of the present invention to insert a sequence whose expression product affects the expression pathway of another gene. For example, the expression product of the inserted gene can affect the rate of transcription of the heterologous gene into mRNA, translation of the heterologous gene mRNA into a polypeptide, degradation or inactivation of the heterologous gene mRNA in the cytoplasm, or any combination thereof.

[0552] In some embodiments, at least one GIS of the present invention can be used to insert a transgene comprising or encoding at least one microRNA (miRNA). In some embodiments, miRNAs suitable for practicing the present disclosure may include any miRNA known or not yet discovered in the art. In some embodiments, at least one GIS can be used to insert a transgene comprising or encoding at least one artificial miRNA, wherein the artificial miRNA is designed to bind to at least one gene expression product present in a subject. As used herein, the term "artificial miRNA" is used to refer to a miRNA whose sequence has been altered or designed to bind to a desired target sequence. Artificial miRNAs can be designed by various methods known in the art.

[0553] In some embodiments, at least one GIS of the present invention can be used to insert a transgene that contains or encodes at least one small interfering RNA (siRNA). As used herein, the term "small interfering RNA" refers to a double-stranded ribonucleic acid (dsRNA) having a nucleotide sequence substantially identical to at least a portion of a target gene. Typically, siRNAs are typically 21-25 nt in length, but can be shorter or longer, and interfere with (inhibit) target gene expression by promoting the degradation of the target gene's mRNA. Any known or yet-to-be-discovered siRNA may be suitable for use in the present invention.

[0554] In some embodiments, at least one GIS of the present invention can be used to insert a transgene comprising or encoding at least one artificial siRNA. As used herein, the term "artificial siRNA" refers to an siRNA whose sequence has been designed to complement at least one gene of interest.

[0555] In some embodiments, at least one GIS of the present invention can be used to insert a transgene comprising or encoding at least one transcription factor (TF). As used herein, the term "transcription factor" refers to any polypeptide that binds to DNA and alters or influences the transcription of at least one gene. Any known or yet-to-be-discovered TF is suitable for use in the present invention.

[0556] The GIS of the present invention can be used to insert a transgene comprising or encoding any combination of miRNAs, siRNAs, and / or TFs. For example, at least one GIS can be used to insert a transgene comprising or encoding any of the following: at least one miRNA and at least one siRNA; at least one miRNA and at least one TF; at least one siRNA and at least one TF; or at least one miRNA, at least one siRNA, and at least one TF.

[0557] Preventive use

[0558] In some embodiments, the pharmaceutical compositions and / or formulations described herein can be used to prevent the progression of a disease or stabilize a therapeutic indication.

[0559] In some embodiments, the pharmaceutical compositions and / or formulations described herein may be used as prophylactic agents to prevent future treatment indications.

[0560] In some embodiments, the pharmaceutical compositions and / or formulations described herein can be used to prevent further progression of a therapeutic indication.

[0561] vaccine

[0562] In some embodiments, the pharmaceutical compositions and / or formulations described herein can be used as vaccines, and / or used in a manner similar to vaccines. As used herein, a "vaccine" is a biological preparation that increases immunity to a specific therapeutic indication or infectious agent.

[0563] In some embodiments, the pharmaceutical compositions and / or formulations described herein can be used as vaccines, and / or in a manner similar to vaccines, in therapeutic areas such as, but not limited to, dermatology, CNS, cardiovascular, oncology, endocrinology, immunology, respiratory, and anti-infective.

[0564] antigen

[0565] The GIS of the present invention can be used to insert a transgene that contains or encodes at least one antigen, which can optionally be elicited by or presented on the surface of at least one subject cell. The term "antigen" as used herein refers to a composition that elicits an immune response in an organism. For example, a composition that elicits antibodies against the composition in the subject organism, and in particular, the antibodies in turn elicit an adaptive immune response in the subject organism. The antigen can be any immunogenic substance, including, for example, polypeptides, proteins, polysaccharides, nucleic acids, lipids, etc. In some embodiments, the antigen can be derived from an infectious agent, including but not limited to bacteria, viruses, protozoa, fungi, prions, etc.

[0566] In some embodiments, an antigen can include a portion or subunit of an infectious agent, e.g., a coat, a coat component, a coat protein, a coat polypeptide, a surface component, a surface protein, a surface polypeptide, a capsule component, a cell wall component, a flagellum, a pili, a toxin, or a toxoid.

[0567] In some embodiments, at least one GIS of the present invention can be used to insert a transgene comprising or encoding at least one antigen for vaccinating a subject for at least one therapeutic indication.

[0568] Research

[0569] In some embodiments, the pharmaceutical compositions and / or formulations described herein may be used for diagnostic purposes or as research tools for any of the therapeutic indications disclosed herein.

[0570] In some embodiments, the pharmaceutical compositions and / or formulations described herein can be used in any research experiment, such as in vivo or in vitro experiments.

[0571] In some embodiments, the pharmaceutical compositions and / or formulations described herein can be used to detect biomarkers for research.

[0572] In some embodiments, the pharmaceutical compositions and / or formulations described herein can be used in cultured cells. The cultured cells can be from any source known to those skilled in the art, and can be, as non-limiting examples, from stable cell lines, animal models, or human patients or control subjects.

[0573] In some embodiments, the pharmaceutical compositions and / or formulations described herein are useful for in vivo experiments in animal models (i.e., mice, rats, rabbits, cats, dogs, non-human primates, guinea pigs, fruit flies, ferrets, C. elegans, zebrafish, or any other animal known in the art for research purposes).

[0574] In some embodiments, the pharmaceutical compositions and / or formulations described herein may be used for stem cells and / or cell differentiation.

[0575] In some embodiments, the pharmaceutical compositions and / or formulations described herein may be used in human research experiments or human clinical trials.

[0576] The present invention provides methods for conducting scientific and / or medical research on a subject. In some embodiments, the methods comprise introducing into the subject an effective amount of at least one GIS described herein. In some embodiments, the methods comprise introducing into the subject an effective amount of at least one GIS comprising at least one reporter transgene.

[0577] Monotherapy and combination therapy

[0578] In some embodiments, the pharmaceutical compositions and / or formulations described herein can be used as monotherapy or combination therapy for treating a disease.

[0579] In some embodiments, the pharmaceutical compositions and / or formulations described herein can be used as monotherapy. In some embodiments, the pharmaceutical compositions and / or formulations described herein can be used in combination therapy. Combination therapy can be with one or more neuroprotective agents, such as small molecule compounds, growth factors, and hormones, that have been tested for their neuroprotective effects against neuronal degeneration.

[0580] In some embodiments, the pharmaceutical compositions and / or formulations described herein can be used in conjunction with one or more other therapeutic agents. "In conjunction" is not intended to imply that the agents must be administered simultaneously and / or formulated together for delivery, although these delivery methods fall within the scope of the present invention. The pharmaceutical compositions and / or formulations described herein and other therapeutic agents can be administered simultaneously with, before, or after one or more other desired treatments or medical procedures. Generally speaking, each agent will be administered according to the dosage and / or schedule determined for the agent.

[0581] The therapeutic agents that can be used in combination with the pharmaceutical compositions and / or formulations described herein can be small molecule compounds that are antioxidants, anti-inflammatory agents, anti-apoptotic agents, calcium regulators, anti-glutamatergic drugs, structural protein inhibitors, compounds involved in muscle function, and compounds involved in metal ion regulation.

[0582] GIC synthesis in vivo

[0583] The present invention provides methods for synthesizing GIS biopolymers, such as GIC biopolymers. In some embodiments, the methods comprise administering at least one GIC synthetic construct to a subject cell population, maintaining the cell population for a sufficient period of time to allow expression of the at least one GIS synthetic construct by the subject cells, and collecting and purifying the GIS synthetic construct expression product by such methods as are known in the art.

[0584] In some embodiments, at least one GIC synthetic construct comprises or encodes a GIC of the present invention. In some embodiments, at least one GIC synthetic construct comprises or encodes a GIC and means for in vivo synthesis of at least one recombinant RNA. Such means may include providing or encoding an RNA polymerase promoter, sequences for selection and purification of recombinant RNA, a complementary GIC sequence, and processing signals for post-recombinant RNA production. In some embodiments, at least one GIC synthetic construct is administered in the form of a DNA plasmid, which enables production of the encoded RNA by endogenous cellular machinery.

[0585] Figure 9 An exemplary GIC synthetic construct 600 is illustrated in FIG. At the 5' end of the construct, an RNAP module 610 may include any suitable RNA polymerase promoter (e.g., a T7 RNAP promoter). When present, an optional 5' leader module 620 is located 3' of the RNAP module and may include components that improve folding and self-cleavage of the template 5' module and / or allow for rapid removal of GIC transcripts with immunogenic and / or transcriptionally unstable 5' ends (e.g., due to failure of RZ self-cleavage). Prior to use as a GIC, any expressed 5' leader module RNA is cleaved at the RZ self-cleavage site 630. 5' module compliment 640, template module compliment 650, and 3' module compliment 660 encode the GIC 5' module, template module, and 3' module, respectively. Finally, a linearization restriction enzyme site 670 may be located at the 3' end, which is a point of cleavage by a restriction enzyme, providing linearization of the GIC RNA and ensuring that all excess vector components remain on the vector.

[0586] VII. Examples of Implementation

[0587] Embodiment 1. A system for genome editing, comprising (i) at least one reverse transcriptase construct (RTC), wherein the RTC comprises a polynucleotide encoding a polypeptide having enzymatic activity for reverse transcribing a polynucleotide template, and (ii) at least one gene insertion construct (GIC), wherein the GIC comprises at least one polynucleotide template suitable for reverse transcription of the polypeptide encoded by the at least one RTC.

[0588] Embodiment 2. The system of embodiment 1, wherein the at least one reverse transcriptase construct comprises at least one biopolymer comprising at least one nucleic acid, at least one amino acid, and any combination thereof.

[0589] Embodiment 3. The system of any of embodiments 1 or 2, wherein the at least one reverse transcriptase construct comprises at least one reverse transcriptase module (RTC: RT-module), optionally at least one reverse transcriptase construct 5' module (RTC: 5' module), optionally at least one reverse transcriptase construct 3' module (RTC: 3' module), and any combination thereof.

[0590] Embodiment 4. The system of embodiment 3, wherein the at least one reverse transcriptase module comprises or encodes at least one reverse transcriptase.

[0591] Embodiment 5. The system of any one of embodiments 3 or 4, wherein the at least one reverse transcriptase module comprises or encodes at least one reverse transcriptase derived from a non-long terminal repeat (non-LTR) reverse transcription factor.

[0592] Embodiment 6. The system of any one of embodiments 4 or 5, wherein the at least one reverse transcriptase comprises or encodes a non-natural translation start codon.

[0593] Embodiment 7. The system of any one of embodiments 4-6, wherein the at least one reverse transcriptase comprises at least one DNA binding domain, at least one RNA binding domain, at least one cDNA synthesis domain, at least one endonuclease domain, and any combination thereof.

[0594] Embodiment 8. The system of embodiment 7, wherein at least one of the at least one reverse transcriptase domain, at least one subject DNA-binding domain, at least one template RNA-binding domain, and at least one endonuclease domain structures, and any combination thereof, is derived from a different reverse transcriptase species than at least one of the other at least one reverse transcriptase domain, at least one subject DNA-binding domain, at least one template RNA-binding domain, and at least one endonuclease domain structures.

[0595] Embodiment 9. The system of embodiment 3, wherein the optional at least one reverse transcriptase construct 5' module comprises or encodes at least one RNA polymerase promoter, at least one 5' untranslated region (5'-UTR), at least one Kozak sequence, at least one 5' cap, and any combination thereof.

[0596] Embodiment 10. The system of embodiment 3, wherein the optional at least one reverse transcriptase construct 3' module comprises or encodes at least one reverse transcriptase translation stop codon, at least one 3' untranslated region (3'UTR), at least one poly-A tail, and any combination thereof.

[0597] Embodiment 11. The system of any one of embodiments 1-10, wherein the at least one reverse transcription module comprises or encodes Figure 2-5At least one structure illustrated in FIG or any combination thereof.

[0598] Embodiment 12. The system of any one of embodiments 1-11, wherein the at least one reverse transcriptase construct comprises, encodes, or is encoded by at least one of SEQ ID NOs 1-57 and any combination thereof.

[0599] Embodiment 13. The system of embodiment 1, wherein the at least one gene insertion construct comprises or encodes at least one nucleic acid biopolymer.

[0600] Embodiment 14. The system of any one of embodiments 1 or 13, wherein the at least one gene insertion construct comprises or encodes at least one optional GIC:5' module, at least one GIC:payload module, at least one optional GIC:3' module, and any combination thereof.

[0601] Embodiment 15. The system of embodiment 14, wherein the at least one GIC:5' module comprises or encodes at least one sequence derived from the 5' region of a native retroelement, optionally at least one GIC:5' module rRNA sequence, optionally at least one GIC:5' module ribozyme sequence, optionally at least one GIC:5' module folding motif sequence, or any combination thereof.

[0602] Embodiment 16. The system of embodiment 15, wherein the optional at least one GIC:5' module rRNA sequence comprises or encodes 1 to 30 nt of the subject's rRNA.

[0603] Embodiment 17. The system of embodiment 15, wherein the optional at least one GIC:5' module ribozyme sequence comprises or encodes at least one self-cleaving ribozyme, optionally wherein the self-cleaving ribozyme comprises a hepatitis delta virus ribozyme.

[0604] Embodiment 18. The system of embodiment 17, wherein the optional at least one GIC:5' module ribozyme sequence comprises or encodes a ribozyme derived from the 5' region of at least one non-long terminal repeat retroelement.

[0605] Embodiment 19. The system of embodiment 15, wherein the optional at least one GIC:5' module folding motif sequence comprises or encodes at least one autonomously folding RNA sequence motif, optionally wherein the autonomously folding RNA sequence motif comprises at least one hairpin motif, at least one stem-loop motif, at least one paired stem-4 motif, or any combination thereof.

[0606] Embodiment 20. The system of any one of embodiments 14-19, wherein the GIC:5' module comprises or encodes at least one of SEQ ID NOs 60-154, 250-276, or 278-279, or any combination thereof.

[0607] Embodiment 21. The system of embodiment 14, wherein the at least one GIC:3' module comprises or encodes at least one GIC:3' module reverse transcriptase recognition sequence, optionally at least one GIC:3' module rRNA sequence, optionally at least one GIC:3' module A-region sequence, or any combination thereof.

[0608] Embodiment 22. The system of embodiment 21, wherein the at least one GIC:3' module reverse transcriptase recognition sequence comprises or encodes at least one sequence that interacts with at least one reverse transcriptase.

[0609] Embodiment 23. The system of any one of embodiments 21 or 22, wherein at least one GIC:3' module reverse transcriptase recognition sequence is derived from the 3' region of a natural retrotransposition factor.

[0610] Embodiment 24. The system of embodiment 21, wherein the optional at least one GIC:3' module rRNA sequence comprises or encodes an rRNA of 1 to 30 nt.

[0611] Embodiment 25. The system of embodiment 21, wherein the optional at least one GIC: 3' module A-region sequence comprises or encodes a sequence of 1 to 50 adenine bases.

[0612] Embodiment 26. The system of embodiment 14 or any one of embodiments 21-25, wherein the at least one GIC:3' module comprises or encodes at least one of SEQ ID NOs 300-329 or any combination thereof.

[0613] Embodiment 27. The system of embodiment 14, wherein the at least one GIC:payload module comprises or encodes at least one transgene sequence, optionally at least one transgene promoter sequence, optionally at least one transgene 5' untranslated sequence, optionally at least one transgene 3' untranslated sequence, optionally at least one transgene polyadenylation signal sequence, optionally at least one transgene non-coding RNA (ncRNA) processing sequence, or any combination thereof.

[0614] Embodiment 28. The system of embodiment 27, wherein the at least one transgenic sequence comprises or encodes at least one sequence of interest for insertion into the genome of a subject.

[0615] Embodiment 29. The system of embodiment 27, wherein at least one transgene promoter sequence comprises or encodes at least one sequence that promotes expression of the transgene in the genome of the subject.

[0616] Embodiment 30. The system of embodiment 27, comprising at least one transgene 5' untranslated sequence comprising or encoding at least one transgene mRNA 5' untranslated region.

[0617] Embodiment 31. The system of embodiment 27, wherein the at least one transgene 3' untranslated sequence comprises or encodes at least one transgene mRNA 3' untranslated region.

[0618] Embodiment 32. The system of embodiment 27, wherein the at least one transgene polyadenylation signal sequence comprises or encodes at least one transgene polyadenylation signal.

[0619] Embodiment 33. The system of embodiment 27, wherein the at least one transgenic noncoding RNA (ncRNA) processing sequence comprises or encodes at least one termination signal, at least one 3' processing signal, and any combination thereof, of at least one transgenic-expressed ncRNA.

[0620] Embodiment 34. The system of embodiment 14 or any one of embodiments 27-33, wherein at least one GIC:payload module comprises or encodes at least one of SEQ ID NOs 499-525 or any combination thereof.

[0621] Embodiment 35. The system of any one of embodiments 13-34, wherein at least one of the at least one GIC:5' module and the at least one GIC:3' module comprises or encodes at least one sequence derived from a non-long terminal repeat retroelement of a different species than at least one of the other at least one GIC:5' module and the at least one GIC:3' module.

[0622] Embodiment 36. The system of embodiment 1 or any one of embodiments 13-35, wherein the at least one gene insertion construct comprises or encodes Figure 6-9 At least one structure illustrated in the figure and any combination thereof.

[0623] Embodiment 37. The system of embodiment 1 or any one of embodiments 13-36, wherein the system comprises: (i) at least one reverse transcriptase construct, wherein the at least one reverse transcriptase construct consists of or is encoded by at least one of SEQ ID NOs 1-57, and (ii) at least one gene insertion construct, wherein the at least one gene insertion construct consists of or is encoded by at least one sequence of SEQ ID NOs 60-154, 250-276, 278-279, 280-289, 300-329, 400-404, 405-407, 411-422, or 499-536.

[0624] Embodiment 38. The system of embodiment 1 or any one of embodiments 13-37, comprising a gene insertion construct synthetic construct (GIC: synthetic construct) comprising or encoding at least one gene insertion construct described in embodiments 13-37.

[0625] Embodiment 39. The system of any of embodiments 1-38, wherein at least one of the at least one reverse transcriptase construct and the at least one gene insertion construct comprises or encodes at least one sequence derived from a reverse transcription factor of a different species than at least one of the other at least one reverse transcriptase construct and the at least one gene insertion construct.

[0626] Embodiment 40. The system of any one of embodiments 1-39, wherein the system for genome editing comprises at least one combination of: (i) at least one reverse transcriptase construct described in embodiments 2-12, and (ii) at least one gene insertion construct described in embodiments 13-37.

[0627] Embodiment 41. A method for inserting at least one transgene into the genome of a subject, comprising administering an effective amount of at least one gene insertion system (GIS) of embodiments 1-40.

[0628] Embodiment 42. The method of embodiment 41, wherein the transgene is inserted into one or more target sites in the genome of the subject, optionally wherein the one or more target sites include at least one safe harbor site.

[0629] Embodiment 43. The method of embodiment 42, wherein the optional at least one safe harbor site comprises at least one ribosomal DNA (rDNA) sequence, optionally wherein the at least one ribosomal DNA sequence includes at least one 28S rDNA sequence.

[0630] Embodiment 44. The method of any one of embodiments 40-43, comprising administering at least one gene insertion system formulated with at least one delivery agent.

[0631] Embodiment 45. The method of embodiment 44, wherein the at least one delivery agent is at least one nanoparticle, optionally wherein the at least one nanoparticle comprises at least one lipid nanoparticle.

[0632] Embodiment 46. A pharmaceutical composition comprising at least one gene insertion system according to embodiments 1-40, and optionally at least one of at least one excipient, at least one delivery agent, at least one adjuvant, and any combination thereof.

[0633] Embodiment 47. A method of treating a therapeutic indication in a subject in need thereof, comprising administering an effective amount of at least one gene insertion system of embodiments 1-40 or at least one pharmaceutical composition of embodiment 46, optionally comprising at least one method of embodiments 41-45.

[0634] Embodiment 48. The method of embodiment 47, wherein the indication for treatment is caused by loss of telomerase activity.

[0635] Embodiment 49. The method of any one of embodiments 46 or 47, wherein the at least one gene insertion system comprises at least one TERT transgene.

[0636] Embodiment 50. A kit for preparing a gene insertion system, comprising the method of the gene insertion system of embodiments 1-40, optionally the pharmaceutical composition of embodiment 46, and optionally further comprising a buffer, a DNA plasmid, or a protocol for preparing the gene insertion system or pharmaceutical composition.

[0637] VIII. Definitions

[0638] 28S rDNA: As used herein, the term "28S rDNA" refers to the portion of a subject's genome that encodes the large structural ribosomal RNA (rRNA) of the large subunit (LSU) of eukaryotic cytoplasmic ribosomes.

[0639] 3' junction: As used herein, the term "3' junction" refers to the location where the 3' end of an inserted sequence is joined to the 5' end of the subject's genome.

[0640] 3' region: As used herein, the term "3' region" refers to the portion of the retroelement gene located 3' to the open reading frame.

[0641] 5' junction: As used herein, the term "5' junction" refers to the location where the 3' end of the subject's genome is joined to the 3' end of the inserted sequence.

[0642] 5' region: As used herein, the term "5' region" refers to the portion of the retroelement gene located 5' to the open reading frame.

[0643] Activity: As used herein, the term "activity" refers to a condition under which something occurs or is accomplished. The proteins and nucleic acids of the present disclosure can have an activity, and the activity can be involved in one or more biological events.

[0644] Adapted: As used herein, the term "adapted" refers to altering a protein or amino acid sequence to change, add or remove properties and / or activities.

[0645] Assay: When used as a verb herein, the term "assay" is used in its broadest sense to refer to the act of testing by any suitable method known in the art. When used as a noun herein, the term "assay" refers to a test used to determine a property, state, and / or activity of an assay subject.

[0646] Biological property: As used herein, the terms "biological property" and "property" refer to any characteristic or activity of an organism, physiological system, organ, tissue, cell, or molecule that can be measured or observed.

[0647] Load: In the context of a delivery vehicle, the terms "load" and "payload" generally refer to any compound or structure (e.g., a GIS of the present invention) that is intended for delivery to, onto, or near a cell, tissue, organ, or physiological system of a subject.

[0648] Cell: As used herein, the term "cell" is given its broadest possible meaning to refer to any living membrane-bound structure.

[0649] Cellular process: As used herein, the term "cellular process" and its grammatical equivalents refer to any process that occurs at the cellular level, which may or may not be limited to a single cell.

[0650] Characteristics: As used herein, the term "characteristic" refers to a characteristic or quality typically attributed to a person, place, or thing that identifies it. The terms "characteristic" and "property" have the same meaning and can be used interchangeably.

[0651]

[00146] To impart: As used herein, the term "impart" and its grammatical equivalents refers to the process of adding a characteristic to a subject.

[0652] Construct: As used herein, the term "construct" refers to an artificially designed biopolymer. Example biopolymers include DNA, RNA, and polypeptides. Generally, the constructs described herein are designed for use in GIS.

[0653] Degradation: As used herein, "degradation" refers to the loss of functionality of a composition over time.

[0654] Delivery: As used herein, the term "delivery" refers to the act or manner of delivering a compound, substance, entity, moiety, load, or payload within a living cell or organism. Unless otherwise indicated, the terms "delivery" and "biodelivery" are used interchangeably.

[0655] Delivery system: As used herein, the term "delivery system" refers to any composition, method, or combination thereof that, when formulated with the GIS of the present invention, delivers components of the GIS to the cytoplasm of target cells. Non-limiting examples of delivery systems include systems consisting of delivery vectors and systems for direct transfection.

[0656] Derived from: As used herein, the term "derived from" refers to a nucleic acid or protein sequence that is isolated or obtained from a particular source, such as a non-long terminal repeat (non-LTR) retrotransposon. The term includes naturally occurring sequences that are isolated or obtained from a particular source. The term also includes man-made variants of a sequence from the original source that have the same or similar functional properties, for example, a variant may comprise a nucleic acid or amino acid sequence that has been modified from the original source to have improved functional properties compared to the original source molecule.

[0657] Engineered: As used herein, the term "engineered" refers to compositions that have been altered from their native or current state to possess new and desired properties and / or activities.

[0658] DNA and RNA: As used herein, the terms "RNA" or "RNA molecule" or "ribonucleic acid molecule" refer to a polymer of ribonucleotides; the terms "DNA" or "DNA molecule" or "deoxyribonucleic acid molecule" refer to a polymer of deoxyribonucleotides. DNA and RNA can be synthesized naturally, for example, by DNA replication and DNA transcription, respectively; or chemically synthesized. DNA and RNA can be single-stranded (i.e., ssRNA or ssDNA, respectively), or multi-stranded (e.g., double-stranded, i.e., dsRNA and dsDNA, respectively). As used herein, the terms "mRNA" or "messenger RNA" refer to single-stranded RNA that encodes the amino acid sequence of one or more polypeptide chains. If deoxyribonucleotides are used to describe an RNA sequence, any thymidine ("T") can be replaced with uridine ("U") or a uridine analog to convert a DNA sequence to an RNA sequence.

[0659] DNA repair: As used herein, the term "DNA repair" refers to any endogenous process in a cell that corrects damage to the cell's genome.

[0660] Efficient: The term "efficient" and its grammatical equivalents as used herein in reference to transgene insertion refers to the effectiveness of a given combination of RT protein, GIC:5' module and GIC:3' module to achieve insertion of the full-length payload module at the desired target site.

[0661] Element: As used herein, the term "element" refers to any discrete component of a molecule or system, or an individual step of a method.

[0662] Expression product: As used herein, the term "expression product" refers to RNA (eg, mRNA) transcribed from a sequence of interest or a polypeptide translated from mRNA transcribed from a sequence of interest.

[0663] Encapsulate: As used herein, the term "encapsulate" means to enclose, surround, or wrap.

[0664] Encoding: The term "encoding" as used herein broadly refers to any process that utilizes information in a polymer macromolecule to direct the production of a second molecule that is different from the first molecule. The second molecule may have a chemical structure that is different in chemical nature from the first molecule.

[0665] Endonuclease: As used herein, the term "endonuclease" refers to any protein or portion of a protein that cleaves a polynucleotide chain by cleaving nucleotides other than the two terminal nucleotides.

[0666] Exosomes: As used herein, "exosomes" are vesicles secreted by mammalian cells or complexes involved in RNA degradation.

[0667] Ex vivo: The term "ex vivo" refers to cells removed from a donor subject, modified using the methods described herein, and added back to a recipient subject. The term includes autologous cells obtained from the same individual subject (i.e., the same subject is both the donor of unmodified cells and the recipient of ex vivo modified cells), as well as allogeneic cells obtained from a donor subject who is a different individual than the recipient subject. The allogeneic donor and recipient can be HLA-matched.

[0668] Facilitate: As used herein, the term "facilitate" is used in its broadest sense to mean making an action or process more likely to occur by adding a specified element.

[0669] Fidelity: The term "fidelity" as used herein refers to the accuracy with which a gene of interest is inserted into a subject's genome. The term "high fidelity" corresponds to a gene of interest being inserted with a relatively small number of errors in nucleotide identity, sequence length, and target site position. For example, if the template RNA contains approximately 5,000 nucleotides and can be replicated by the RT protein to produce cDNA without base pair mismatches, the gene insertion has high fidelity. Depending on the purpose of the transgene insertion, a limited number of mismatches can occur and the fidelity is still high enough to produce a functional transgene.

[0670] Flanking: As used herein, the term "flanking" refers to positioning one element 5' (5' flank) or 3' (3' flank) of another element. The elements referred to as flanking can be directly connected to each other or can have other elements interposed between them.

[0671] Formulation: As used herein, a "formulation" comprises at least one GIS component described herein, and at least one delivery agent, a pharmaceutically acceptable excipient, or both.

[0672] Functional / active: The term "functional" as used herein with respect to a biomolecule refers to a biomolecule in a form that exhibits its characteristic properties and / or activities.

[0673] Gene: As used herein, the term "gene" is used in its broadest sense to refer to a distinct sequence of nucleotides that forms or may form part of a chromosome, the order of which determines the order of monomers in a polypeptide or nucleic acid molecule.

[0674] Gene Insertion Construct: As used herein, the term "gene insertion construct" or GIC refers to an RNA construct comprising an RNA template for a RT protein.

[0675] Gene Insertion System: The term "Gene Insertion System" or "GIS" as used herein is a system of components (modules) that can be used to insert a gene sequence (transgene) into a specific location in the genome of a subject by reverse transcription, including TPRT.

[0676] GIC: 3' module: The term "3' module" as used herein refers to a portion of a GIC comprising at least one element derived from or functionally replacing the 3' region of a retroelement gene.

[0677] GIC:5' module: As used herein, the term "GIC:5' module" refers to the portion of the GIC that facilitates insertion of a full-length transgene, which may or may not be derived from the 5' region of the retroelement gene.

[0678] Generate: As used herein, the verb "generate" and its conjugations are used in its broadest sense to refer to any process that brings a specified product into existence.

[0679] Genome: As used herein, the term "genome" is used in its broadest sense to refer to all the genetic material present in a cell.

[0680] HDV RZ fold: As used herein, the term "HDV RZ fold" refers to any RNA sequence that can adopt the fold of the hepatitis delta virus (HDV) ribozyme and retain ribozyme function.

[0681] Heterologous: As used herein, the term "heterologous" refers to any gene or protein sequence or structure that is placed into a cell that does not normally produce that gene or protein sequence or structure. The term also includes individual elements, modules, or portions of an RTC or GIC of the present disclosure that comprise nucleic acid (DNA or RNA) sequences or amino acid sequences from a different species. For example, a 5' module of an RTC or GIC may comprise a sequence from one (or first) avian species, and a 3' module of the same RTC or GIC may comprise a sequence from a different (or second) avian species.

[0682] Homologous recombination: As used herein, the term "homologous recombination" refers to any process of transgene insertion that relies on sequence homology between the transgene and the subject's genome.

[0683] In vitro: As used herein, the term "in vitro" is used to refer to a reaction or process that is performed outside a living cell or organism.

[0684] In vivo: As used herein, the term "in vivo" is used to refer to reactions or processes that take place inside or on the surface of a living cell or organism.

[0685] Inactive: As used herein with respect to a biomolecule, the term "inactive" refers to a form of the biomolecule that does not exhibit its characteristic properties and / or activities.

[0686] Inactive ingredient: As used herein, the term "inactive ingredient" refers to one or more agents that do not contribute to the activity of the active ingredient of the pharmaceutical composition contained in the formulation. In some embodiments, all or some of the inactive ingredients that can be used in the formulations of the present invention may be approved by the U.S. Food and Drug Administration (FDA), or the inactive ingredients that can be used in the formulations of the present invention may not be approved by the U.S. Food and Drug Administration (FDA).

[0687] Induce: As used herein, the term "induce" and its grammatical equivalents refer to a process that results in a stated result without any particular limitation as to the steps in the process.

[0688] Introduced: As used herein, the term "introduced" refers to the addition of genetic material, often DNA, into a cell.

[0689] Insertion: As used herein, the term "insertion" refers to the addition of nucleotides to a DNA sequence.

[0690]

[00146] Linked: As used herein, the term "linked" refers to the location in the subject's genome where the subject's insertion site DNA is joined to the cDNA of the inserted transgene.

[0691] At least one: As used herein, the term "at least one" refers to one, two, three, four, five or more modified objects, eg, constructs, modules or sequences of the disclosure.

[0692] Lipid nanoparticle: As used herein, "lipid nanoparticle" or "LNP" refers to a delivery vehicle comprising one or more lipids (eg, cationic lipids, non-cationic lipids, PEG-modified lipids).

[0693] Liposome: As used herein, "liposome" generally refers to a vesicle composed of lipids (eg, amphiphilic lipids) arranged into one or more spherical bilayers or layers.

[0694] Loss of function: As used herein, the term "loss of function" refers to any change in a subject's gene that results in an altered gene product that lacks the function of the wild-type gene.

[0695] Modified: As used herein, "modified" refers to an altered state or structure of a molecule. A molecule can be modified in a variety of ways, including chemical, structural, and functional ways.

[0696] Modular system: As used herein, "modular system" refers to a system that can be divided into groups of strongly interacting parts that are autonomous with respect to each other.

[0697] Motif: As used herein, the term "motif" refers to any sequence of a biopolymer having a recognizable structure, which may or may not be defined by a unique chemical or biological function.

[0698] Natural: As used herein, the term "natural" refers to a wild-type or naturally occurring compound, biomolecule (eg, protein or nucleic acid), or composition.

[0699] Non-LTR retrotransposition factor reverse transcriptase: The term "non-LTR retrotransposition factor reverse transcriptase (RT)" as used herein refers to a protein having reverse transcription activity that is derived from a non-LTR retrotransposition factor.

[0700] Non-LTR retroelements: The term "non-LTR retroelements" as used herein refers to a class of retroelements genes that do not contain long terminal repeats (also known as retrotransposons).

[0701] External: With respect to the insertion site, the term "external" as used herein refers to any part of the genome that is more than about 60 bp 5' or 3' from the insertion site.

[0702] Paired RT: As used herein, the term "paired RT" refers to a combination of a reverse transcriptase (RT) and at least one module comprising an insert payload module. A module can be homologous to its paired RT, meaning that the RT and all elements in the module are derived from the same retrotransposition factor gene. A module can be heterologous to its paired RT, meaning that at least one element of the module is not derived from the same retrotransposition factor gene as the RT.

[0703] Payload: Except when used in the context of a delivery vector, the term "payload" may refer to any nucleic acid sequence (eg, a gene of interest) contained in a gene insertion system (GIS) intended for insertion into the genome of a subject.

[0704] Percent homology: The term "percent homology" or "% homology" refers to the amount of identical or identical sequence between two nucleic acid or amino acid sequences. The term "percent homology" can be used interchangeably with the term "percent identity" or "percent sequence identity" as defined herein.

[0705] As used herein, "percent identity" or "percent sequence identity" or "percent homology" is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the sequence in the comparison window may contain additions or deletions (i.e., gaps) compared to the reference sequence (which does not contain additions or deletions) for optimal alignment of the two sequences. The percentage is calculated as follows: the number of positions where the identical nucleic acid base or amino acid residue occurs in the two sequences is determined to yield the number of matched positions, the number of matched positions is divided by the total number of positions in the comparison window, and the result is multiplied by 100 to yield the percent sequence identity.

[0706] In the context of two or more nucleic acids or peptide sequences, the terms "identical," "identity," or "homology" refer to two or more identical sequences or subsequences. When compared and aligned for maximum correspondence within a comparison window or designated region, as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection, sequences are "substantially identical" to each other if they have a specified percentage of identical nucleotides or amino acid residues (e.g., at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, at least 99.5% identity, or at least 99.9% identity within a designated region). Therefore, unless otherwise indicated, all nucleic acid and amino acid sequences provided herein comprise sequences that are substantially identical to the reference sequence.

[0707] For sequence comparison, usually one sequence acts as a reference sequence to which a test sequence is compared. When using a sequence comparison algorithm, the test sequence and the reference sequence are input into a computer, and if necessary, subsequence coordinates are specified, and sequence algorithm program parameters are specified. Default program parameters are usually used, or alternative parameters can be specified. The sequence comparison algorithm then calculates the sequence identity or similarity percentage of the test sequence relative to the reference sequence based on the program parameters.

[0708] Suitable algorithms for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (Nuc. Acids Res. 25:3389-402, 1977) and Altschul et al. (J. Mol. Biol. 215:403-10, 1990), respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). The algorithm involves first identifying high-scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is called the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence, and the cumulative alignment score is increased as much as possible. For nucleotide sequences, the cumulative score is calculated using the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatched residues; always < 0). For amino acid sequences, a scoring matrix is ​​used to calculate the cumulative score. Extension of word hits in each direction stops when: the cumulative alignment score drops by an amount X from its maximum achieved value; the cumulative score becomes zero or below due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses a word length (W) of 11, an expectation (E) of 10, M = 5, N = -4, and a comparison of both chains by default. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915, 1989), alignments (B) of 50, expectation (E) of 10, M=5, and N=-4.

[0709] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-87, 1993). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability that a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, typically less than about 0.01, and more typically less than about 0.001.

[0710] Peptide: As used herein, "peptide" refers to an amino acid chain or strand of less than or equal to 50 amino acids in length, such as an amino acid chain or strand of about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.

[0711] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to a composition comprising at least one active ingredient and optionally one or more pharmaceutically acceptable excipients.

[0712] Poly(A): As used herein, the term "poly(A)" refers to a sequence of adenosine nucleotides of any length.

[0713] Poly(A) tail: As used herein, the term "poly(A) tail" or "poly-A tail" is used to refer to an adenosine nucleotide sequence of about 80 or more nucleotides in length.

[0714] Poly(A) tract: As used herein, the terms "poly(A) tract," "poly(A)-tract," and "A-tract" (all abbreviated PA) are equivalent and used interchangeably to refer to adenosine nucleotide sequences of about 1-50 nucleotides in length.

[0715] Promoter: As used herein, the term "promoter" refers to any DNA sequence to which proteins bind that initiate transcription.

[0716] Proprotein: As used herein, the terms "protein precursor," "proprotein," and "propeptide" refer to an inactive protein that can be converted to an active form by post-translational modification.

[0717] Protect: As used herein, the term "protect" and its grammatical equivalents refer to any composition or process that prevents the full or partial degradation of a biopolymer.

[0718] Protein: As used herein, "protein" is used to refer to amino acid biopolymers greater than 50 amino acids in length. Non-limiting examples of proteins as described herein are enzymes, reverse transcriptases, and endonucleases.

[0719] Region: As used herein, the term "region" refers to a portion of a nucleotide or amino acid sequence. A region may be of unknown or indeterminate length, in which case it is specified by the function to which it is involved or its position relative to other elements in the sequence.

[0720] Retroelements / Retrotransposons: As used herein, the terms "retroelements" and "retrotransposons" refer interchangeably to a class of eukaryotic genes that are able to replicate themselves to a new location within the genome via an RNA intermediate.

[0721] Reverse transcriptase: As used herein, the term "reverse transcriptase" refers to any protein capable of synthesizing cDNA from an RNA template sequence.

[0722] Reverse transcriptase construct: As used herein, the term "reverse transcriptase construct" (RTC), as previously described, refers to a biopolymer construct comprising or encoding at least one RT.

[0723] RTC:RT module: As used herein, the term "RTC:RT module" or "reverse transcriptase module" refers to a biopolymer construct comprising or encoding at least one RT.

[0724] Ribosomal DNA: As used herein, the term "ribosomal DNA (rDNA)" refers to the portion of a subject's genome that encodes the precursor ribosomal RNA synthesized by RNAP I.

[0725] Ribosomal RNA: As used herein, the term "ribosomal RNA (rRNA)" refers to the non-coding RNA component of the ribosome.

[0726] Fragment: As used herein, the term "fragment" refers to a portion of a sequence. For example, a fragment of a nucleotide sequence may include any portion of a gene that is less than its full length.

[0727] Selective: As used herein, the terms "selective" and "selectivity" refer to molecules that tend to bind to a very limited variety of other molecules, structures of other molecules, proteins or genetic sequences, including but not limited to enzymes, enzyme proteins and genes.

[0728] Self-cleaving ribozymes: As used herein, the term "self-cleaving ribozymes" refers to a class of RNAs that catalyze sequence-specific intramolecular (or intermolecular) cleavage.

[0729] Selectivity: As used herein, "selectivity" refers to the likelihood that an RT will efficiently utilize either the heterologously paired 5' or 3' module of a GIC.

[0730] Sequence: As used herein, the term "sequence" refers to the order of amino acids given from N-terminus to C-terminus, or the order of nucleotides given from 5' to 3' of a biopolymer.

[0731] Site-specific: As used herein, the phrase "site-specific" refers to a locus, such as a locus of about 60 bp sequence.

[0732] Stability: As used herein, the term "stability" refers to the ability of a composition to retain its properties over time.

[0733] Successful TPRT: As used herein, the phrase "successful TPRT" refers to the synthesis of cDNA and / or insertion of a transgene using primers that nick through the target site.

[0734] Suitable: As used herein, the term "suitable" means anything that is effective, functional, or suitable for a particular purpose or use.

[0735] Synthetic: As used herein, the term "synthetic" refers to anything produced, prepared and / or manufactured by the hand of man. The synthesis of a polynucleotide or polypeptide or other molecule of the present invention may be chemical synthesis or enzymatic synthesis.

[0736] Target cell: As used herein, the phrase "target cell" refers to any one or more cells of interest. The cell can be present in vitro, in vivo, in situ, or in a tissue or organ of an organism. The organism can be an animal, preferably a mammal, more preferably a human, and most preferably a patient.

[0737] Target-primed reverse transcription: As used herein, the term "target-primed reverse transcription" refers to any process in which the reverse transcriptase uses the 3' end of the genomically embedded nicked DNA at the target site as a primer to initiate cDNA synthesis.

[0738] Template: As used herein, the terms "template" and "RNA template" refer to an RNA sequence that is transcribed into cDNA by RT.

[0739] Template end: As used herein, the term "template end" refers to the 5' end or the 3' end of an RNA template.

[0740] Therapeutically active: As used herein, the term "therapeutically active" refers to a gene or gene product that treats or alleviates a therapeutic indication in a subject.

[0741] Transcription: As used herein, the term "transcription" refers to the formation or synthesis of an RNA molecule by an RNA polymerase using a DNA molecule as a template.

[0742] Transfection: The term "transfection" as used herein refers to a method of introducing exogenous nucleic acid into cells. Transfection methods include, but are not limited to, chemical methods, physical treatments, and cationic lipids or mixtures.

[0743] Transgene: As used herein, the term "transgene" refers to any gene that is inserted into the genome of a subject.

[0744] Translation: As used herein, the term "translation" refers to the formation of a polypeptide molecule by ribosomes from an RNA template.

[0745] Treatment and Prevention: As used herein, the terms "treatment" or "prevention," and words derived therefrom, do not necessarily require 100% or complete treatment or prevention. Rather, there are varying degrees of treatment or prevention, and those skilled in the art recognize that such treatment or prevention has a potential benefit or therapeutic effect. In addition, "prevention" can include delaying the onset of a disease, symptom, or condition.

[0746] Unmodified: As used herein, the term "unmodified" refers to any substance, compound, or molecule prior to being altered in any way. Unmodified can, but does not always, refer to the wild-type or native form of a biomolecule. A molecule can undergo a series of modifications, where each modified molecule can serve as an "unmodified" starting molecule for subsequent modifications.

[0747] Vector: As used herein, the term "vector" is any molecule or moiety that transports, transduces, or otherwise serves as a vehicle for a heterologous molecule.

[0748] IX. EQUIVALENTS AND SCOPE

[0749] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments in accordance with the disclosure described herein.The scope of the present invention is not intended to be limited to the above description, but is instead set forth in the appended claims.

[0750] In the claims, articles such as "a," "an," and "the" may refer to one or more than one, unless indicated to the contrary or otherwise clear from the context. A claim or description that includes "or" between one or more group members is deemed to satisfy the requirement if one, more than one, or all of the group members are present in, used in, or otherwise relevant to a given product or method, unless indicated to the contrary or otherwise clear from the context. The present disclosure includes embodiments in which exactly one member of the group is present in, used in, or otherwise relevant to a given product or method. The present disclosure includes embodiments in which more than one or all of the group members are present in, used in, or otherwise relevant to a given product or method.

[0751] It should also be noted that the term "comprising" is intended to be open ended and allows but does not require the inclusion of additional elements or steps. When the term "comprising" is used herein, the term "consisting of" is also encompassed and disclosed.

[0752] When ranges are given, endpoints are included. Further, it should be understood that, unless otherwise indicated or otherwise apparent from the context and understanding of one skilled in the art, values ​​expressed in ranges may take any specific value or sub-range within the ranges described in different embodiments of the present disclosure, up to one-tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0753] In addition, it should be understood that any specific embodiment of the present invention that falls within the prior art may be expressly excluded from any one or more claims. Since such embodiments are considered to be known to those skilled in the art, they may be excluded even if the exclusion is not expressly set forth herein. Any specific embodiment of the composition of the present disclosure (e.g., any antibiotic, therapeutic or active ingredient; any production method; any method of use; etc.) may be excluded from any one or more claims for any reason, whether or not related to the existence of the prior art.

[0754] It is to be understood that the words used are words of description rather than limitation and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the disclosure in its broader aspects.

[0755] Although the present invention has been described at length and with a certain degree of detail with respect to several described embodiments, it is not intended that the invention should be limited to any such detail or embodiment or to any particular embodiment, but rather that it should be interpreted with reference to the appended claims to provide the broadest possible interpretation of such claims in light of the prior art so as to effectively encompass the intended scope of the present disclosure.

[0756] The present invention is further illustrated by the following non-limiting examples.

[0757] X. Examples

[0758] Example 1. Gene Insertion Construct (GIC) In Vitro Transcription (IVT) - GIC without Payload

[0759] GIC RNA biopolymers smaller than about 1000 nt, such as RNA used in TPRT assays employing in vitro purified RT, are typically prepared by in vitro RNA transcription (IVT) reactions as follows.

[0760] GIC DNA template for RNA transcription was generated by PCR using Q5 DNA polymerase (NEB) and purified by column clean-up (Bio Basic).

[0761] IVT reactions were performed using T7 RNA polymerase (RNAP) using one of two protocols that produced equivalent purified RNA. The first method used purified reaction components to transcribe 1 μg of DNA template in a 25 μL reaction solution containing 40 mM Tris pH 7.9, 2.5 mM spermidine, 26 mM MgCl2, 0.01% Triton X-100, approximately 30 mM DTT, 8 mM GTP, 4 mM all other rNTPs, 0.5 μL RiboLock (Thermo Scientific), 0.5 μL inorganic pyrophosphatase (NEB), and 0.5 μL T7 RNAP (purified after overexpression in bacteria and stored at 50 mg / mL in 20 mM KPO4 pH 7.5, 100 mM NaCl, 50% glycerol, 10 mM DTT, 0.1 mM EDTA, and 0.2% NaN3). The reaction was incubated at 37°C for 3-4 hours, followed by the addition of 1 μL of DNase RQ1 (Promega), 1.5 μL of 20 mM CaCl2, and 2 μL of H2O. The second method used the NEB HiScribe T7 Kit according to the manufacturer's instructions, using 1 μg of digested plasmid per 20 μL reaction solution. The reaction was incubated at 37°C for 2 hours, followed by the addition of 1 μL of DNase RQ1 (Promega), 1.5 μL of 20 mM CaCl2, and 2 μL of H2O.

[0762] The product RNA was then purified by desalting (Roche Mini Quick Spin Columns), organic extraction, and precipitation following routine procedures known in the art.

[0763] Example 2 Gene Insertion Construct (GIC) In Vitro Transcription (IVT) - GIC with Transgene Payload

[0764] GIC RNA biopolymers containing the transgene expression cassette payload were prepared by in vitro RNA transcription (IVT) reactions as follows.

[0765] The GIC DNA transcription template sequence was cloned into the pUC57-mini backbone (SEQ ID NO 350) with the T7 RNAP promoter upstream and the BbsI site downstream of the expected GIC RNA template. Purified plasmid DNA was linearized by digestion with BbsI-HF (NEB) at 37°C for 4 hours. The digested plasmid was then purified using a Qiagen PCR purification column and eluted in nuclease-free water.

[0766] IVT reactions were performed using the NEB HiScribe T7 Kit, with 1 μg of digested plasmid used per 20 μl reaction solution. Specifically, each IVT reaction contained 2 μl of various rNTPs, 2 μl of 10X buffer, 2 μl of T7 polymerase mix, 1 μg of digested plasmid, and ddH2O, and was incubated at 37°C for 2 hours.

[0767] After IVT, the DNA template was removed by treatment with RNase-free deoxyribonuclease I at 37°C for 30 minutes. Next, the synthesized RNA was purified by adding an equal volume of phenol:chloroform:isoamyl alcohol, pH 6.7 (25:24:1), vortexing vigorously, centrifuging, and precipitating the aqueous layer with 10% volume of 3M sodium acetate, pH 5, and 3 volumes of 100% ethanol. After washing three times in 70% ethanol, the RNA pellet was air-dried and dissolved in 1 mM sodium citrate, pH 6.5.

[0768] Example 3. Preparation of Reverse Transcriptase (RT) Protein for TPRT Assay

[0769] RT protein was produced by transient expression in human cells and purified as follows.

[0770] The codon-optimized ORF encoding the RT (GenScript) was cloned between the Kpn I and Xba I sites of the pcDNA3.1N-DYK plasmid (GenScript) to fuse with the vector-encoded N-terminal FLAG tag (SEQ ID NO.351). The Kpn I site adds a glycine-threonine linker between the FLAG tag and the RT amino acid sequence. The Xba I site is located after the (multiple) translation stop codons near the start of the 3' UTR. 12 ug of plasmid DNA was reversely transfected using Lipofectamine 3000 (Invitrogen). First, the DNA was gently mixed with 500 uL of OPTI-MEM and 24 uL of P3000. Then 500 uL of OPTI-MEM and 24 uL of Lipofectamine were mixed together and added to the DNA mixture. The Lipofectamine / DNA complex was incubated at room temperature for 10 minutes and added to the cells prepared as follows. Briefly, for each transfection, 80% confluent HEK 293T cells (hereinafter referred to as 293T) in a 10 cm culture dish were split onto the Lipofectamine / DNA complex and replated at 80% confluence. After 18-24 hours, the cells were trypsinized to remove them from the plate, resuspended in 5 mL of culture medium, and centrifuged at a low speed of approximately 2000 g for 3 minutes in a 15 mL conical tube. The pellet was washed with PBS containing 1 mM PMSF, transferred to a 1.5 mL tube, and re-pelleted at 2000 g for 1 minute at 4°C.

[0771] The cell pellet was suspended in 4x pellet volumes of 1X hypotonic lysis buffer [HLB; 20mM HEPES (pH 8), 2mMMgCl2, 200uM EGTA, 10% glycerol, 1mM DTT, 0.2% serine protease inhibitor cocktail (SPIC, Sigma), 1mM PMSF] and placed on ice for 5 minutes to allow the cells to swell. The cells were then lysed by three cycles of rapid freezing the sample in liquid nitrogen and thawing it in a room temperature water bath. The sample was then moved to 400mM NaCl, gently vortexed, and placed on ice for another 5 minutes. The sample was then centrifuged at 17000g for 5 minutes at 4°C. The supernatant was collected and the concentration of NaCl was reduced to 200mM and the concentration of NP-40 was increased to 0.1% by adding an equal volume of 1X HLB containing 0.2% NP-40. The sample was gently vortexed and centrifuged at 17000g for 10 minutes at 4°C.

[0772] The clear supernatant was collected in a new tube and 20 uL of blocked and balanced FLAG antibody resin (Sigma) was added. The sample was rotated at 4 ° C for 2 hours to immunoprecipitate the protein. The FLAG resin was then washed 4 times (2 times quickly, 2 times at 4 ° C for 5 minutes) with IP buffer (1X HLB, 200mM NaCl, 0.1% NP-40). After the last wash, all buffers were removed with a 30G needle and the resin was resuspended in 40 uL IP buffer. The protein was partially eluted by adding 50 ng / uL three FLAG peptides (Sigma) and incubated at room temperature for 1 hour. The eluted protein was quickly frozen in liquid nitrogen and stored at -80 ° C for subsequent use.

[0773] Example 4. RTC mRNA production

[0774] RNA (mRNA) RTC biopolymers were prepared as follows.

[0775] A codon-optimized ORF encoding RT (GenScript) was amplified by PCR to append a BamHI site before the ORF and an XhoI site after the stop codon that terminates the ORF. The BamHI site is located in frame between the N-terminal FLAG tag and the RT ORF and adds a glycine-serine linker at this junction.

[0776] The RT ORF was cloned into pUC57-mini (SEQ ID NO 350) between the 5'UTR (SEQ ID NO 58) and 3'UTR and the template-encoded poly(A) tail (SEQ ID NO 59), with the T7 RNAP promoter sequence located upstream and the BbsI site located downstream. The mRNA transcription template plasmid was then linearized with BbsI and repurified as described in Example 2. AGClean cap mRNA synthesis and purification using silica membranes were performed by a commercial supplier (TriLink) or using TriLink reagents and protocols, typically using 100% replacement of uridine ribonucleoside triphosphate (U) with 5-methoxyuridine ribonucleoside triphosphate (5moU). Comparison of 100% uridine replacement by 5moU versus N1-methylpseudouridine showed that mRNA with either modified nucleotide functioned equivalently.

[0777] Example 5. In vitro RT activity screening

[0778] Candidate proteins are tested for reverse transcriptase activity in vitro using DNA primers annealed to RNA templates as follows, a field standard RT assay.

[0779] The RT protein was prepared according to Example 3. The primer DNA oligonucleotide (SEQ ID NO 352 purchased from IDT) and the template RNA (SEQ ID NO 353) were generated by the first protocol of Example 1.

[0780] For each screening reaction, 2 uL of 8 uM DNA oligonucleotide and 2 uL of 4 uM template RNA were annealed by heating the sample to 65°C for 3 minutes and placing the sample on ice for at least 5 minutes.

[0781] A non-radioactive master mix was formed containing the following components: 2 uL of 10X RT buffer (50 mM MgCl2, 250 mM Tris (pH 7.5), and 750 mM KCl), 2 uL of 100 mM DTT, 2 uL of 20% PEG-6K, and 5 uL of nuclease-free H2O.

[0782] A radioactive master mix was also formed containing the following components: 1 uL of 10 mM dA, dC, and dTTP; 1 uL of 2 mM dGTP; 4 uL of the above annealed DNA-RNA and 1 uL of 32 Pα-dGTP (Perkin Elmer).

[0783] For each reaction, 11 uL of non-radioactive master mix, 2 uL of candidate RT protein, and 7 uL of radioactive master mix were mixed to make each reaction volume 20 uL. The reaction was allowed to proceed at 37°C for 30 minutes and then heat-inactivated at 70°C for 5 minutes. 80 uL of stop solution (50 mM Tris (pH 7.5), 20 mM EDTA, and 0.2% SDS) containing a 100 nt oligonucleotide (SEQ ID NO 290) previously prepared using γ 32 DNA was 5'-end radiolabeled with ATP and T4 polynucleotide kinase (NEB), then purified and concentrated by PCI extraction, followed by ethanol precipitation (dry ice ethanol bath). DNA was pelleted in a benchtop centrifuge at 14,000 g for 20 minutes, washed once with 75% ethanol, air-dried, and resuspended in 5 μL H2O + 5 μL 2x formamide loading buffer.

[0784] Samples were run on 9% urea-PAGE denaturing gels, dried, exposed on a phosphorimager screen, and imaged the next day on a Typhoon Trio imaging system.

[0785] Example 6. In vitro TPRT activity assay

[0786] The RT protein was prepared according to Example 3. The template RNA for TPRT was prepared by the IVT reaction as described in Example 1. The RT protein and template RNA were combined with the target site oligonucleotide double strands. The double stranded DNA was 64 or 84 bp in length (SEQ ID NO. 291 and SEQ ID NO. 292, respectively). The bottom strand was γ 32 5'-end radiolabeling was performed using ATP and T4 polynucleotide kinase (NEB) in magnesium reaction buffer at 37°C for 30 minutes. Products were resolved by denaturing PAGE, and gels were imaged using the Typhoon Trio imaging system.

[0787] Example 7. Cell culture and co-transfection of RNA-based RTC and GIC

[0788] The indicated mammalian cell lines were plated into 6-well plates immediately prior to transfection at a density of 1.25-2.5 million cells per well.

[0789] Dilute 5 μl of Messenger Max in 125 μl of Opti-MEM and incubate for 10 minutes.

[0790] RTC mRNA and GIC RNA (prepared according to Examples 4 and 2, respectively) were mixed at the indicated molar ratios and then diluted in 125 μl of Opti-MEM. Messenger Max in Opti-MEM solution and GIS RNA in Opti-MEM solution were then thoroughly mixed and incubated at room temperature for 5 minutes.

[0791] The resulting mixture was added dropwise to the cells in one well of a 6-well plate, the plate was returned to the cell incubator, and the cells were analyzed after a sufficient period of time.

[0792] Example 8. FACS analysis

[0793] Flow cytometric analysis

[0794] One day after transfection (unless otherwise noted), cells were harvested by trypsinization in DMEM supplemented with 5% FBS and analyzed on an Attune NxT flow cytometer (Thermo) or equivalent. Live single cells were gated by forward and side scatter. The mCherry channel on the Attune was YL2, with excitation at 561 nm and an emission filter of 620 / 15 nm. The eGFP channel on the Attune was BL1, with excitation at 488 nm and an emission filter of 530 / 30 nm. Flow cytometry results were analyzed using FlowJo 10.8.1. Transfections with GIC RNA alone, without RT mRNA, served as background controls; background was subtracted from the signal for quantification.

[0795] Cell sorting

[0796] One day after transfection (unless otherwise stated), cells were harvested by trypsinization into DMEM medium containing 5% FBS and sorted on a Sony SH800 sorter with a 130 μm chip in ultrapure mode or equivalent. Sorted cells were collected by centrifugation and washed with PBS.

[0797] Example 9. RNA-based RTC and GIC compositions

[0798] RTC mRNA used for transfection was produced according to Example 4 and described in Table 1.

[0799] Table 1: 2-RNA Components GIS RTC

[0800] RTC logo RTC: RT-module source organism SEQ ID NO. F-ZoAl RT mRNA White-throated Bunting 19 F-TaGu RT mRNA Chestnut-eared Grass Finch 28 F-TriCasB RT mRNA Tribolium castaneum 3 OrLa-3F RT mRNA Medaka 10 ZoAl RT mRNA (unlabeled) White-throated Bunting 21 ZoAl_catdead RT mRNA White-throated Bunting 23 TriCasB RT mRNA (unlabeled) Tribolium castaneum 5

[0801] GIC RNA used for transfection was produced according to Examples 1 and 2 and is described in Table 2.

[0802] Table 2: 2-RNA Components GIS GIC

[0803]

[0804]

[0805] Example 10. Screening of candidate proteins for reverse transcription activity

[0806] Candidate R2 family retrotransposition factor proteins (see Table 3) were prepared for reverse transcription screening according to Example 3 and tested for reverse transcription activity according to Example 5. Some TPRT or RT proteins were detected as active in only a small set of assays (shown as low / no).

[0807] Table 3: Reverse transcriptase activity of candidate proteins

[0808]

[0809]

[0810] RT activity varies greatly among species. Figure 10As shown in the PAGE image results, for the candidate RT proteins TriCasB, DroSi, TaGu, NaViB, BoMo, OrLa, AdVa (when normalized to relative protein expression), ZoAl, LiPo (variably detectable products), PuPu and TiGu, and GeFo (variably detectable products), initial reverse transcription products of the expected length were observed in the dark solid line box. For CiIn, LeCoB, TriCan, DroMer, DroMe, HyMa, and GaAc, no reproducible RT products were detected. Sometimes very low activities were detected for DrMe and GeFo. The opacity of the bands at the expected product length, combined with the amount of purified protein detected by immunoblotting using an antibody against the RT protein FLAG epitope tag, enables comparative estimation of the level of reverse transcription activity and sorting of candidate proteins into those with high, medium, low, or no (undetectable by the assay used) reverse transcription activity, as shown in Table 3. In general, the candidate proteins TriCasB, DroSi, TaGu, NaViB, and BoMo exhibited the highest levels of reverse transcriptase ability and are therefore strong candidates for inclusion in the RTCs of the present invention.

[0811] Example 11. In vivo RT assay for 3' module specificity

[0812] Nine HEK293T cell populations were transfected with different plasmid combinations consisting of one of the pcDNA3.1 backbone plasmids expressing the modified RT protein ORFs from B. mori (SEQ ID NO. 35), D. simulans (SEQ ID NO. 32), and O. latipes (SEQ ID NO. 8) and an additional plasmid expressing the 3'UTR RNA from the R2 element of B. mori (SEQ ID 209), D. simulans (SEQ ID NO. 210), or O. latipes (SEQ ID NO. 200) (see Figure 11A ). Each RT protein was co-expressed with each 3'UTR RNA.

[0813] After allowing sufficient time for the RT protein plasmid to be transcribed and translated and to bind to the transcribed 3'UTR RNA, the cells were lysed and any RT protein + RNA template complexes were purified by FLAG immunopurification (Sigma FLAG antibody resin). RNA present in each input cell lysate and RNA associated with each immunopurified sample was purified. Equal aliquots of each input RNA sample and each RT-bound RNA sample were immobilized on HybondN+ membrane (Cytiva) in the form of a spotted grid. The membrane containing spots of each type of 3'UTR RNA was probed together for the presence of 3'UTR RNA, such as by PCR with T4 polynucleotide kinase (NEB). 32 The detection was performed by hybridization of a complementary oligonucleotide probe radiolabeled at the 5' end of P. In other words, the B. mori 3'UTR sequence (B. mori 3'UTR probes are CATCATGGATTAGGATCGGAAGACCCCCG (SEQ ID NO. 539), GTACGCCGGCGAAATTGGATCAGTAGATG (SEQ ID NO. 540), and GAGAAACAGACGGGCCTGATCTACACCC) (SEQ ID NO. 541)) was detected from a sample of cells expressing the B. mori R2 3'UTR. Samples expressing D. simulans R2 3'UTR RNA were probed for D. simulans 3'UTR sequences (D. simulans 3'UTR probes are CTATCTGAACCGAAGTTCCGCAACGCCTACGTAC (SEQ ID NO. 542), CACTGCGTGTGGTCAGTTTTCCTAGCATGCACG (SEQ ID NO. 543), and GATGTTATGCCAAGACAGCAAGCAAATGTTTTGAACCAAACG) (SEQ ID NO. 544). Samples expressing medaka (O. latipes) R2 3'UTR RNA were probed for medaka (O. latipes) 3'UTR sequences (Medaka (O. latipes) 3'UTR probes are TTGAGGCGAGTCACCACTCGCTTTCCGG (SEQ ID NO. 545) and GTGTCCGTCACGGGGACGACATCCGAGTG) (SEQ ID NO. 546).

[0814] like Figure 11BAs shown, the modified B. mori RT protein not only binds to its cognate 3'UTR, but also to the 3'UTR sequences of the D. simulans and O. latipes R2 elements, with the modified D. simulans and O. latipes proteins having higher selectivity. The B. mori RT, with the findings described here, shows relatively indiscriminate RNA interactions in human cells.

[0815] Example 12. In vitro TPRT characteristics of silkworm (B. mori), Drosophila simulans (D. simulans) and medaka (O. latipes) opposite sex

[0816] RT proteins from B. mori (SEQ ID NO. 36), D. simulans (SEQ ID NO. 33), and O. latipes (SEQ ID NO. 9) were prepared according to Example 3. GICs were prepared according to Example 1, comprising a GIC:RT recognition sequence derived from the 3'UTR of O. latipes (SEQ ID NO. 200) with or without a 3' appended 4 nt rRNA sequence (SEQ ID 280) "R4" and a GIC:RT recognition sequence derived from the 3'UTR of D. simulans (SEQ ID NO. 210) with or without a 3' appended 4 nt rRNA sequence (SEQ ID 280) "R4".

[0817] In vitro TPRT assays were performed as in Example 6 to test the ability of each RT to utilize each GIC.

[0818] The RT protein from D. simulans does not use the GIC containing the GIC:RT recognition sequence from the 3'UTR of O. latipes, and the RT protein from O. latipes RT does not use the GIC containing the GIC:RT recognition sequence from the 3'UTR of D. simulans for TPRT. However, the RT protein from B. mori can use both for TPRT (Figure 12).

[0819] In contrast to other modified R2 RT proteins, the B. mori RT protein has indiscriminate template replication during TPRT (i.e., it is not selective for its cognate GIC). For example, RTs derived from medaka (O. latipes) or Drosophila (D. simulans) are selective for their cognate GIC:RT recognition sequences and may therefore be preferred when designing more selective GISs.

[0820] Example 13. Phylogenetic Screening for RT Specificity

[0821] RT proteins and GICs derived from various species of retrotransposition factors were prepared according to Examples 3 and 1, respectively, and the GICs included GIC:RT recognition sequences derived from the 3'UTR of native retrotransposition factors of various species, as summarized in Table 4. For this in vitro TRPT comparison, all GIC:RT recognition sequences had an "R4" 4nt rRNA sequence (SEQ ID 280) appended to their 3' ends and, if necessary, guanosine(s) appended to their 5' ends for T7 RNAP transcription initiation.

[0822] The ability of each RT to recognize a given GIC:RT recognition sequence was tested by performing an in vitro TPRT assay as in Example 6. The opacity of the band at the expected product length on the denaturing PAGE gel allowed for a comparative estimate of the level of target-primed reverse transcription activity and sorted the candidate proteins as having high, medium, low, or no (undetectable by the assay) target-primed reverse transcription activity.

[0823] The results of the TPRT assays are summarized in Table 4 below. Each data row is labeled with the RT protein used, including the source organism from which the RT sequence is derived. Each data column is labeled with the GIC used, including the source organism from which the GIC:RT recognition sequence is derived. Cells with a minus sign (-) indicate that no product of the expected length was observed for a given combination of RT and GIC. Cells with plus and minus signs (+ / -) indicate that the amount of product of the expected length observed in at least some of the assays was almost undetectable. A cell with a single plus sign (+) indicates that a small amount of product of the expected length was observed, two plus signs (++) indicate that a moderate amount of product of the expected length was observed, and three plus signs (+++) indicate that a large amount of product of the expected length was observed.

[0824] Compared with the RT proteins from silkworm (Bombyx mori), the RT proteins from chestnut-eared grass finch (Taeniopygiaguttata), medaka (Oryzias latipes), white-throated bunting (Z.albicollis), white-throated RT proteins from Tinamus guttatus, Tribolium castaneum (R2 lineage B), and Drosophila simulans are more selective for GICs containing their cognate GIC:RT recognition sequences. Thus, compared with RT proteins from B. mori, RT proteins from T. guttata, O. latipes, Z. albicollis, and Z. albicollis are more selective for GICs containing their cognate GIC:RT recognition sequences. The RT proteins of T. guttatus, T. castaneum and / or D. simulans may be more preferably included in the GIS of the present invention to minimize or prevent the insertion of unintended template sequences into the genome of the subject.

[0825] In addition, from white-throated bunting (Z.albicollis), chestnut-eared grass finch (T.guttata) and / or white-throated The RT protein of T. guttatus is highly specific for the GIC:RT recognition sequence of avian species. Therefore, the RT prote...

Claims

1. A system for genome editing, comprising: (i) at least one reverse transcriptase construct (RTC), the RTC comprising at least one reverse transcriptase module (RTC: RT module), at least one reverse transcriptase construct 5' module (RTC: 5' module) and / or at least one reverse transcriptase construct 3' module (RTC: 3' module), the at least one reverse transcriptase module (RTC: RT module) comprising mRNA encoding reverse transcriptase (RT), and (ii) at least one gene insertion construct (GIC), said GIC comprising at least one RNA template suitable for reverse transcription of a polypeptide encoded by said at least one RTC, wherein said at least one gene insertion construct comprises at least one optional GIC:5' module, at least one GIC:payload module and at least one GIC:3' module.

2. The system of claim 1, wherein: i) the RTC 5' module comprises a 5' untranslated region (5'-UTR), a Kozak sequence or an internal ribosome entry site, a non-natural translation start codon and / or a 5' cap; ii) the RT module comprises a coding sequence from a member selected from the group consisting of white-throated sparrow (Zonotrichia albicollis, ZoAl), chestnut-eared grass finch (Taeniopygia guttata, TaGu), white-throated mRNAs of RT from organisms such as Tinamus guttatus (TiGu), Oryzias latipes (OrLa), and Tribolium castaneum (lineage B), TriCasB; iii) the RTC 3' module comprises a reverse transcriptase translation stop codon, a 3' untranslated region (3'UTR) and a poly-A tail; iv) the GIC: 5' module comprises a sequence derived from the 5' region of a natural reverse transcription factor, an rRNA sequence, a ribozyme sequence, a folding motif sequence and / or an RNA polymerase terminator sequence; (v) the GIC: the payload module comprises at least one transgene ORF or non-coding RNA (ncRNA) sequence, a transgene promoter sequence, a transgene 5' untranslated sequence, a transgene 3' untranslated sequence, a transgene polyadenylation signal sequence and / or a transgene ncRNA processing sequence; and (iv) The GIC: 3' module comprises a reverse transcriptase recognition sequence, an rRNA sequence and / or an A-region sequence.

3. The system of any one of claims 1 or 2, wherein the at least one reverse transcriptase is derived from a non-long terminal repeat (non-LTR) reverse transcription factor or a modified variant thereof.

4. The system of any one of claims 1-3, wherein the at least one reverse transcriptase comprises at least one DNA binding domain, at least one RNA binding domain, at least one cDNA synthesis domain, at least one endonuclease domain, and any combination thereof.

5. The system of any one of claims 1 to 4, wherein the reverse transcriptase is from an avian species.

6. The system of claim 5, wherein the reverse transcriptase is from ZoAl, TaGu or (TiGu).

7. The system of claim 6, wherein the reverse transcriptase comprises an amino acid sequence that is at least 90% identical to SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 27, SEQ ID NO: 29, or SEQ ID NO:

25.

8. The system of any one of claims 1-7, wherein the at least one reverse transcription module comprises or encodes at least one structure illustrated in Figures 2-5 or any combination thereof.

9. The system of any one of claims 1-8, wherein the at least one reverse transcriptase construct comprises, encodes or is encoded by at least one sequence selected from the group consisting of SEQ ID NOs 1-57 and any combination thereof.

10. The system of any one of claims 2 to 9, wherein the optional at least one GIC:5' module rRNA sequence comprises or encodes 1 to 30 nt of a subject rRNA.

11. The system of claim 10, wherein the rRNA sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 250-276, or a sequence having one, two, or three nucleotide changes relative to a sequence selected from the group consisting of SEQ ID NOs: 250-276.

12. The system of claim 11, wherein the GIC:5' module does not comprise rRNA sequences.

13. The system of any one of claims 2 to 12, wherein the GIC:5' module ribozyme sequence comprises at least one self-cleaving ribozyme, optionally wherein the self-cleaving ribozyme comprises a Hepatitis Delta Virus (HDV) ribozyme fold.

14. The system of claim 13, wherein the HDV ribozyme comprises a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 102-127 and 129-154.

15. The system of any one of claims 2 to 12, wherein the GIC:5' module ribozyme sequence comprises a ribozyme from the 5' region of at least one non-long terminal repeat retrotransposition element.

16. The system of claim 15, wherein the ribozyme comprises a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 64-65, 67, 75-76, 86, 89-101, and 128.

17. The system of any one of claims 2 to 16, wherein the GIC:5' module folding motif sequence comprises at least one autonomously folding RNA sequence motif, optionally wherein the autonomously folding RNA sequence motif comprises at least one hairpin motif, at least one stem-loop motif, at least one paired stem-4 motif, or any combination thereof.

18. The system of claim 17, wherein the folding motif sequence comprises SEQ ID NO 278 or 279, or a sequence having at least 90% identity to SEQ ID NO 278 or 279.

19. The system of any one of claims 2 to 18, wherein the GIC:5' module comprises a sequence that is at least 90% identical to a sequence selected from SEQ ID NOs 60-154.

20. The system of any one of claims 2 to 19, wherein the GIC:3' module reverse transcriptase recognition sequence comprises at least one sequence that interacts with at least one reverse transcriptase.

21. The system of claim 20, wherein the GIC:3' module reverse transcriptase recognition sequence is derived from the 3' region of a natural reverse transcription factor.

22. The system of any one of claims 20 or 21, wherein the at least one GIC:3' module reverse transcriptase recognition sequence comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs 200-224.

23. The system of any one of claims 2 to 22, wherein the GIC: 3' module rRNA sequence comprises 1 to 30 nt of rRNA.

24. The system of claim 23, wherein the rRNA sequence is selected from SEQ ID NOs 280-289, or a sequence thereof comprising one or two nucleotide substitutions.

25. The system of any one of claims 2 to 24, wherein the GIC: 3' module A-region sequence comprises 1 to 50 adenine bases.

26. The system of any one of claims 2 to 25, wherein the GIC: 3' module comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs 300-329, or any combination thereof.

27. The system of any one of claims 2 to 25, wherein the GIC:3' module comprises a 3'UTR sequence from ZoAl, TaGu, GeFo, or TiGu.

28. The system of claim 27, wherein the 3'UTR sequence comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs 202-205 or SEQ ID NOs 222-224.

29. The system of any one of claims 2 to 28, wherein the at least one transgenic sequence comprises or encodes at least one sequence of interest for insertion into the genome of a subject.

30. The system of claim 29, wherein the transgene sequence comprises or encodes at least one mRNA, microRNA, siRNA, rRNA, tRNA, long noncoding RNA, small cytoplasmic RNA, small nuclear RNA, small nucleolar RNA, small Cajal RNA, circular RNA, regulatory RNA, peptide, polypeptide, protein, inhibitory protein and / or sequence that controls expression of at least one transgene.

31. The system of claim 30, wherein the transgene encodes a protein selected from the group consisting of hTERT, hPAH, hFactor VIII, a mutated hFactor VIII with a variable size B domain, or Factor IX.

32. The system of any one of claims 2 to 31, wherein the transgene promoter sequence comprises at least one sequence that promotes expression of a transgene in the genome of a subject.

33. The system of any one of claims 2 to 32, wherein the transgene 5' untranslated sequence comprises at least one transgene mRNA 5' untranslated region.

34. The system of any one of claims 2 to 33, wherein the transgene 3' untranslated sequence comprises at least one transgene mRNA 3' untranslated region.

35. The system of any one of claims 2 to 34, wherein the transgenic polyadenylation signal sequence comprises at least one transgenic polyadenylation signal.

36. The system of any one of claims 2 to 35, wherein the transgenic non-coding RNA (ncRNA) processing sequence comprises at least one termination signal, at least one 3' processing signal, and any combination thereof for at least one transgenic expressed ncRNA.

37. The system of any one of claims 2 to 36, wherein the at least one GIC:payload module comprises or encodes at least one sequence having at least 90% identity to a sequence selected from SEQ ID NOs 411-422 or SEQ ID NOs 499-536, or any combination thereof.

38. The system of any of claims 1-37, wherein at least one of the at least one GIC:5' module and at least one GIC:3' module comprises or encodes at least one sequence derived from a species other than a non-long terminal repeat retroelement from at least one of the other at least one GIC:5' module and at least one GIC:3' module.

39. The system of any one of claims 1-38, wherein the at least one gene insertion construct comprises or encodes at least one of the structures illustrated in Figures 6-9 and any combination thereof.

40. The system of any one of claims 1 to 39, comprising two different gene insertion constructs comprising a GIC:payload module comprising different transgene ORFs.

41. The system of claim 40, wherein the two different GICs are present on the same RNA template.

42. The system of claim 40, wherein the two different GICs are present on different RNA templates.

43. The system of any one of claims 1 to 42, wherein the system comprises: (i) at least one reverse transcriptase construct, wherein the at least one reverse transcriptase construct comprises or is encoded by at least one sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs 1-57; (ii) at least one gene insertion construct, wherein the at least one gene insertion construct comprises: GIC: a 5' module comprising a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 60-154; an rRNA sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 250-276, or a sequence having one, two or three nucleotide changes relative to a sequence selected from the group consisting of SEQ ID NOs: 250-276; or not comprising an rRNA sequence; GIC: Payload module, which contains at least one transgenic sequence; and GIC: a 3' module comprising a sequence having at least 90% identity to a sequence selected from SEQ ID NOs 300-329; GIC: 3' module reverse transcriptase recognition sequence comprising a sequence having at least 90% identity to a sequence selected from SEQ ID NOs 200-224; A GIC: 3' module rRNA sequence selected from SEQ ID NOs 280-289, or a sequence thereof comprising one or two nucleotide substitutions; GIC: 3' module A-region sequence containing 1 to 100 adenine bases.

44. The system of claim 43, wherein the GIC:payload module comprises at least one sequence having at least 90% identity to a sequence selected from SEQ ID NOs 411-422 or 499-536.

45. The system of any of claims 1-44, wherein at least one of the at least one reverse transcriptase construct and the at least one gene insertion construct comprises or encodes at least one sequence derived from a reverse transcription factor of a different species than at least one of the other at least one reverse transcriptase construct and the at least one gene insertion construct.

46. ​​The system of any one of claims 1-45, wherein the RTC and / or GIC RNA comprises at least one modified uracil, or the RTC and / or GIC RNA comprises 100% modified uracil.

47. The system of claim 46, wherein the modified uracil is selected from 5-methyluridine, 5-methoxyuridine, pseudouridine, N1-methylpseudouridine and / or 2-thiouridine.

48. A method for inserting at least one transgene into the genome of a subject, comprising administering to the subject an effective amount of at least one Gene Insertion System (GIS) according to any one of claims 1-47.

49. The method of claim 48, wherein the transgene is inserted into one or more target sites in the genome of the subject, optionally wherein the one or more target sites include at least one safe harbor site.

50. The method of claim 49, wherein the optional at least one safe harbor site comprises at least one ribosomal DNA (rDNA) sequence, optionally wherein the at least one ribosomal DNA sequence comprises at least one 28S rDNA sequence.

51. The method of any one of claims 48-50, comprising administering at least one gene insertion system formulated with at least one delivery agent.

52. The method of claim 51, wherein the at least one delivery agent is at least one nanoparticle, optionally wherein the at least one nanoparticle comprises at least one lipid nanoparticle.

53. The method of any one of claims 48-52, wherein the transgene is inserted with greater than 90% target site specificity.

54. The method of claim 53, wherein the RTC RNA encodes a gene from a white-throated sparrow (ZoAl), a chestnut-eared grassfinch (TaGu), or a white-throated (TiGu), or comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 27, SEQ ID NO: 29 or SEQ ID NO:

25.

55. The method of any one of claims 48-54, wherein the transgene is expressed at the target site for 3 months or longer.

56. A pharmaceutical composition comprising at least one gene insertion system according to claims 1-47, and optionally at least one of at least one excipient, at least one delivery agent, at least one adjuvant, and any combination thereof.

57. A method of treating a therapeutic indication in a subject in need thereof, comprising administering an effective amount of at least one gene insertion system of claims 1-47 or a pharmaceutical composition of claim 56, optionally comprising at least one method of claims 48-52.

58. The method of claim 57, wherein the indication for treatment is due to loss of telomerase activity.

59. The method of any one of claims 57 or 58, wherein the at least one gene insertion system comprises at least one TERT transgene.

60. A kit for manufacturing a gene insertion system, comprising the gene insertion system of claims 1-47, optionally the pharmaceutical composition of claim 56, and optionally further comprising a buffer, a DNA plasmid, or a protocol for manufacturing the gene insertion system or pharmaceutical composition.

61. A method comprising de novo design of a 5' module that recruits host machinery for second strand nicking, and thereby second strand synthesis.

62. The method of claim 61, which provides insertion gain efficiency by de novo designing a 5' module to (a) comprise an rRNA of predetermined length and position, (b) have an enhanced RZ fold, and / or (c) recruit host cell machinery.

63. A method for inserting at least one transgene into the genome of a cell, comprising contacting the cell with at least one Gene Insertion System (GIS) of any one of claims 1-47.

64. The method of claim 63, wherein the transgene is inserted into one or more target sites in the genome of the subject, optionally wherein the one or more target sites include at least one safe harbor site.

65. The method of claim 64, wherein the optional at least one safe harbor site comprises at least one ribosomal DNA (rDNA) sequence, optionally wherein the at least one ribosomal DNA sequence comprises at least one 28S rDNA sequence.

66. The method of any one of claims 63-65, comprising administering at least one gene insertion system formulated with at least one delivery agent.

67. The method of claim 66, wherein the at least one delivery agent is at least one nanoparticle, optionally wherein the at least one nanoparticle comprises at least one lipid nanoparticle.

68. The method of any one of claims 63-67, wherein the transgene is inserted with greater than 90% target site specificity.

69. The method of claim 68, wherein the RTC RNA encodes a gene from the white-throated sparrow (ZoAl), chestnut-eared grass finch (TaGu), or white-throated (TiGu), or comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 27, SEQ ID NO: 29 or SEQ ID NO:

25. E 70. The method of any one of E 63-69, wherein the transgene is expressed at the target site for 3 months or longer.

71. The method of any one of claims 63-70, wherein the molar ratio of RTC to GIC is about 10:1 to 1:

20.

72. The method of any one of claims 63-71, wherein the method is an in vitro method, an ex vivo method, or an in vivo method.

73. The method of any one of claims 63-72, wherein the cell is selected from the group consisting of a primary cell, a transformed cell, an epithelial cell, a fibroblast, a human cell, a monkey cell, and a mouse cell.

74. The method of any one of claims 63-73, wherein the cell is an allogeneic cell or an autologous cell.

75. The method of claim 74, wherein the autologous cells are HLA-matched cells.

Images