Use of benzenesulfonamides for the preparation of medicaments for the treatment of peripheral neuropathy
By using drugs prepared with benzenesulfonamide to treat peripheral nerve adhesion diseases, the problem of the lack of drugs that directly target nerve injury and adhesion in the existing technology has been solved, realizing the recovery of nerve adhesion and improvement of motor function, increasing nerve conduction rate and reducing inflammatory response.
Patent Information
- Application Number
- CN202411570889.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-06
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2044-11-06
AI Technical Summary
Currently, there is a lack of effective drugs that can directly target the pathological mechanisms of nerve injury and adhesion, promote nerve regeneration, and reduce adhesion formation.
Benzenesulfonamide was used to prepare drugs for treating peripheral nerve adhesion diseases, including injection or oral dosage forms. The effects of these drugs on nerve adhesion in mice were verified through experiments, showing that they promote the recovery of adhered nerves and improve motor balance and nerve conduction rate.
Benzylsulfonamide significantly reduces the degree of nerve adhesion, promotes the recovery of motor balance, increases nerve conduction rate, and inhibits inflammation by regulating the immune microenvironment, thereby promoting the regeneration and repair of nerve myelin sheath.
Smart Images

Figure CN119632964B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to the application of benzenesulfonamide in the preparation of drugs for treating peripheral nerve adhesion diseases. Background Technology
[0002] Peripheral nerve injury and adhesions are a complex medical condition, usually stemming from various causes such as trauma, inflammation, long-term compression, or surgical complications. When nerves are damaged, if timely and effective intervention is not provided, the damaged nerve fibers may abnormally adhere to the surrounding connective tissue, leading to a series of serious health problems. These harms include, but are not limited to, a significant decline in motor function, where patients may face challenges such as limited limb movement and loss of fine motor skills; impaired sensory functions, such as weakened or lost sensations of touch and pain, severely impacting patients' daily lives and self-protection abilities; furthermore, long-term pain can bring a heavy psychological burden, leading to low self-esteem, depression, and other psychological problems, and in some cases, even permanent disability, greatly reducing the patient's quality of life.
[0003] Treatment options for this condition are multifaceted. On the one hand, general treatments, such as adjusting diet and maintaining moderate exercise, can aid in the recovery of nerve function. On the other hand, drug treatments, such as neurotrophic drugs and nonsteroidal anti-inflammatory drugs (NSAIDs), can promote nerve repair and reduce inflammation and adhesions to some extent. Physical therapy and rehabilitation therapy, through specific instruments and training methods, further promote the recovery of nerve function and enhance muscle strength. In extreme cases, surgery, such as nerve decompression and nerve suturing, is also a necessary treatment. However, despite the variety of treatment methods, current technology still lacks effective drugs that can directly target the pathological mechanisms of nerve damage and adhesions, efficiently promote nerve regeneration, and reduce adhesion formation. This is an important direction for future medical research and development. Summary of the Invention
[0004] The purpose of this invention is to solve the technical problem of the lack of effective therapeutic drugs in the prior art that can directly target the pathological mechanism of nerve injury and adhesion.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] Application of benzenesulfonamide in the preparation of drugs for treating peripheral nerve adhesion diseases.
[0007] Preferably, the peripheral nerve adhesion disease includes sciatic nerve adhesion.
[0008] Preferably, the drug is an injectable or oral dosage form.
[0009] Preferably, the medicine is used to improve the adhesion of peripheral nerves in vivo, and promote the motor balance ability and nerve conduction velocity, thereby promoting the recovery of the adhesion nerves.
[0010] The application also provides a medicine for treating peripheral nerve adhesion diseases, wherein the medicine comprises a benzene sulfonamide.
[0011] Preferably, the medicine further comprises a pharmaceutically acceptable excipient.
[0012] Compared with the prior art, the application provides the use of a benzene sulfonamide in the preparation of a medicine for treating peripheral nerve adhesion diseases, and is proved by specific verification experiments. Specifically, the application systematically evaluates the influence of the benzene sulfonamide on the nerve adhesion of mice through various technical means such as direct observation of nerve adhesion and muscle atrophy, electrophysiological recording and behavior test, and successfully proves the positive effect of the benzene sulfonamide on promoting the recovery of adhesion nerves, improving the motor balance ability and improving the nerve conduction velocity. These research results not only provide a solid scientific basis for the benzene sulfonamide as a potential therapeutic drug, but also open up a new research direction for the treatment of peripheral nerve adhesion diseases. BRIEF DESCRIPTION OF DRAWINGS
[0013] Figure 1 A comparison chart for proving that the benzene sulfonamide can effectively reduce the degree of nerve adhesion in an embodiment of the application;
[0014] Figure 2 A comparison chart for proving that the benzene sulfonamide can effectively promote the motor ability of mice in an embodiment of the application;
[0015] Figure 3 A comparison chart for proving that the benzene sulfonamide can effectively improve the sciatic nerve conduction velocity of mice in an embodiment of the application;
[0016] Figure 4 A comparison chart for proving that the benzene sulfonamide can effectively promote the motor balance ability of mice in an embodiment of the application;
[0017] Figure 5 A comparison chart for proving that the benzene sulfonamide can promote the regeneration of nerve myelin sheath and has a significant nerve protection effect in an embodiment of the application;
[0018] Figure 6 A comparison chart for proving that the benzene sulfonamide is beneficial to the development and repair of sciatic nerve myelin sheath of mice in an embodiment of the application;
[0019] Figure 7 A comparison chart for proving that the benzene sulfonamide can inhibit the expression of inflammatory factors and has a significant anti-inflammatory effect in an embodiment of the application. DETAILED DESCRIPTION
[0020] The application will be further described in detail below in connection with specific embodiments.
[0021] Since the sciatic nerve is the most important and intuitive material for studying peripheral nerve adhesion, the sciatic nerve is used in the present application for subsequent experiments.
[0022] Experimental materials:
[0023] Benzene sulfonamide (CAS: 98-10-2), bovine serum albumin, glutaraldehyde, DMSO were purchased from Sigma company, real-time quantitative PCR dye was purchased from Roche biological company, and primers were from Shanghai Shenguo biological company.
[0024] Experiment 1: construction of sciatic nerve adhesion model
[0025] 8-week-old ICR mice were purchased from the Experimental Animal Center of Nanjing University. The sciatic nerve adhesion model was established as follows: subcutaneous injection of 3% sodium pentobarbital (1 ml / kg) for anesthesia. The skin below the hip was incised, and the muscle was bluntly dissected with a fine surgical scissors and forceps to expose the right sciatic nerve in the middle of the thigh. 20 mL of adhesion agent (45% bovine serum albumin + 12% glutaraldehyde) was dropped between the sciatic nerve and the muscle to construct the sciatic nerve adhesion model. Drug experimental group: continuous intraperitoneal injection of 50 µg / g benzene sulfonamide for 7 days; control group: continuous intraperitoneal injection of 30 µL DMSO for 7 days. All animal experimental protocols were approved by the Animal Protection and Utilization Committee of Nantong University and the Jiangsu Province Animal Protection Ethics Committee. The establishment of the sciatic nerve adhesion model in mice was carried out in accordance with the approved guidelines.
[0026] Experiment 2: observation of nerve adhesion and muscle atrophy in mice
[0027] After the model was constructed for 6 weeks, the sciatic nerve adhesion and muscle atrophy of mice in different groups were compared to determine the effect of benzene sulfonamide on nerve adhesion in mice. Subcutaneous injection of 3% sodium pentobarbital (1 ml / kg) for anesthesia. The skin and muscle tissue were separated, and the phenotype difference between the two groups of mice was directly observed.
[0028] Experiment 3: animal behavior detection
[0029] In order to determine the effect of benzene sulfonamide on the recovery of sciatic nerve adhesion in mice, the present application used the rotarod test, electrophysiological test and gait test for detection.
[0030] Rotarod test: An accelerating rotarod apparatus (LE8500 type, Panlab) was used. Before the test, the mice were habituated in the test room for 30 minutes. The mice were gently placed on the rotarod by gently swinging them and trained for 3 days in an accelerating mode (4-40 rpm) with 3 and 5 minute intervals on the rotarod. Training was repeated at a constant speed (16 rpm) until the mice were able to stay on the rod for at least 300 seconds. For the formal test, the mice were placed on the rotating drum and the rotarod was set to the accelerating mode, i.e. accelerated from 4 to 40 rpm in 5 minutes. The time spent moving on the rotarod was recorded before the fall was measured.
[0031] Gait test: Gait kinematics of quadrupedal animals were assessed by footprint analysis of mice with the Digigait imaging system. The hindlimb stride was assessed at a speed of 8 cm / s. The footprints were analyzed by four measurements: distance to the contralateral foot, footprint length, maximum toe spread between the first and fifth toe, and claw spread between the second and fourth toe center.
[0032] Electrophysiological test: In this study, mice were anesthetized with a compound anesthetic. Then, the conduction velocity (NCV) was measured using an electromyography device (Neuropack S1 MEB-9402, Nihon-Kohden, Tokyo, Japan). The needle electrode was inserted into the gastrocnemius muscle of the mouse, and the ground electrode was clamped on the exposed skin. The stimulation intensity was gradually increased from 0.1 mA to 3.0 mA, with a trigger waveform. The stimulation was performed at a frequency of 1 Hz for 1 ms. The corresponding data were recorded for further analysis. During the entire experiment, the body temperature of the mouse was maintained at 37°C ± 0.5°C using a heating lamp.
[0033] Experiment 4: Electron microscopic observation of sciatic nerve tissue
[0034] Three mice from each group (benzenesulfonamide treatment group and control group) with sciatic nerve adhesion for 6 weeks were randomly selected. Under deep anesthesia, the sciatic nerve tissue at the adhesion site was taken and cut into electron microscopy specimen size (1.2 mm x 1 mm x 1 mm), immersed in 4% glutaraldehyde solution for fixation, and then fixed with 1% osmium acid for the second time. Stained with uranyl acetate, dehydrated with gradient ethanol, embedded with epoxy resin, positioned with semi-thin section, and observed by transmission electron microscopy after ultrathin sectioning and lead citrate staining. The obtained photos were measured on the image analysis system of the instrument to measure the diameter of the myelinated nerve and the diameter of the axon. The value of the axon diameter / myelinated nerve diameter (g-ratio) was used to measure the thickness of the myelin sheath, so as to infer the protective effect of benzenesulfonamide on the damaged nerve.
[0035] Experiment 5: Detection of immune factor expression
[0036] Total RNA was extracted from sciatic nerve tissues using Trizol reagent from Invitrogen, and the first strand of cDNA was synthesized using the reverse transcription kit from Roche. The SYBR Green Supermix from Roche was used for gene expression analysis, and the iQ5 Multicolor Real-Time PCR Detection System from Bio-Rad was used for the instrument. The mRNA level was calculated using the 2-△△Ct method. The 18S housekeeping gene was used to calibrate the mRNA level. The primer sequences used are as follows:
[0037] 18S rRNA forward primer: AGCTCCAATAGCGTATATTAAAG
[0038] 18S rRNA reverse primer: CGGTCCTATTCCATTATTCCTA
[0039] IL1α forward primer: GTGTTGCTGAAGGAGTTG
[0040] IL1α reverse primer: ATCTGGAAGTCTGTCATAGAG
[0041] IL1β forward primer: GCAACCACTTACCTATTTATTTATG
[0042] IL1β reverse primer: TTCATACTCATCAAAGCAATGT
[0043] CD68 forward primer: TTGCTGCCTCTCATCATT
[0044] CD68 reverse primer: ACAGAGAAGGAAGGTAACTG
[0045] The results of the above experiments are as follows:
[0046] To study whether benzene sulfonamide can improve the degree of peripheral nerve adhesion in vivo, the sciatic nerve adhesion model of ICR mice was constructed in this application, and the differences in nerve adhesion degree and muscle atrophy between the drug experimental group and the control group were observed. The results showed that benzene sulfonamide can effectively reduce the degree of nerve adhesion ( Figure 1 ).
[0047] The motor behavior analysis was used to analyze the changes in the balance ability and nerve conduction rate of mice after benzene sulfonamide treatment. The results showed that the balance ability of mice after benzene sulfonamide treatment recovered better, and the nerve conduction rate was faster ( Figures 2-4 ).
[0048] To further clarify the protective effect of benzene sulfonamide on adhesion of sciatic nerve tissue, the present application observes the myelin sheath structure of sciatic nerve of mice in different groups by transmission electron microscopy, and the result analysis shows that the myelin sheath structure of adhesion nerve after drug treatment is more orderly, and the newly born nerve myelin sheath is thicker Figure 5 , 6).
[0049] The adhesion tissue immune homeostasis is unbalanced, and the overexpression of nerve inflammatory factors is an important factor affecting the recovery of nerve adhesion. The present application analyzes the influence of the drug on the expression of inflammatory factors, and the result shows that the drug effectively regulates the immune microenvironment, reduces the expression of pro-inflammatory factors, significantly inhibits the occurrence and development of inflammation, and is beneficial to the recovery of nerve Figure 7 ).
[0050] Based on the above specific verification experiments, the present application provides the application of benzene sulfonamide in the preparation of drugs for treating peripheral nerve adhesion diseases, including sciatic nerve adhesion. The chemical formula of the benzene sulfonamide is C6H7NO2S.
[0051] The drug is an injection or an oral dosage form. In an embodiment, the drug is used to improve the adhesion of peripheral nerve in vivo, and promote the motor balance ability and nerve conduction velocity, thereby promoting the recovery of adhesion nerve.
[0052] Based on the above content, the present application further provides a drug for treating peripheral nerve adhesion diseases, which comprises benzene sulfonamide.
[0053] In an embodiment, the drug further comprises a pharmaceutically acceptable excipient.
[0054] In summary, the present application systematically evaluates the influence of benzene sulfonamide on nerve adhesion in mice through various technical means such as direct observation of nerve adhesion and muscle atrophy, electrophysiological recording and behavior test, and successfully confirms its positive effect on promoting the recovery of adhesion nerve, improving the motor balance ability and enhancing the nerve conduction velocity. These research results not only provide a solid scientific basis for benzene sulfonamide as a potential therapeutic drug, but also open up a new research direction for the treatment of peripheral nerve adhesion diseases.
Claims
1. Use of benzenesulfonamides for the preparation of a medicament for the treatment of peripheral neuropathy-related diseases, characterized in that: The chemical formula of the benzene sulfonamide is C6H7NO2S, and the CAS is 98-10-2.
2. Use of a benzenesulfonamide according to claim 1 for the manufacture of a medicament for the treatment of peripheral neuropathy-related diseases, characterized in that: The peripheral nerve adhesion disease includes sciatic nerve adhesion.
3. Use of a benzenesulfonamide according to claim 2 for the manufacture of a medicament for the treatment of peripheral neuropathy-related diseases, characterized in that: The drug is in the form of injection or oral administration.
4. Use of a benzenesulfonamide according to claim 3 for the manufacture of a medicament for the treatment of peripheral neuropathy-related diseases, characterized in that: The drug is used for improving the peripheral nerve adhesion in vivo, promoting the motor balance ability and the nerve conduction rate, and thus promoting the recovery of the adhesion nerve.
Citation Information
Patent Citations
Injection medicine composition with synergistic action of vitamin C and benzsulfamide compounds
CN106822099A