A nicotinamide mononucleotide adenyltransferase mutant and use thereof
By site-directed mutagenesis of nicotinamide mononucleotide adenosine transferase and the construction of recombinant genetically engineered bacteria, the problem of insufficient enzyme activity in the enzymatic synthesis of NAD+ was solved, realizing efficient and low-cost biocatalytic synthesis of NAD+, which is suitable for industrial production.
Patent Information
- Application Number
- CN202411903689.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-23
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2044-12-23
AI Technical Summary
Existing enzymatic methods for synthesizing NAD+ have low enzyme activity, low production efficiency, and high cost, making it difficult to meet industrial needs.
By performing site-directed mutagenesis on nicotinamide mononucleotide adenosine transferase, particularly the mutations at amino acids 6, 10, and 11, a recombinant genetically engineered bacterium was constructed. This enzyme was then expressed in Escherichia coli, and under suitable reaction conditions, it catalyzed the synthesis of NAD+ using NMN as a substrate.
This method improves the catalytic efficiency of enzymes and the yield of NAD+, simplifies the synthesis process, reduces costs, and enables efficient and low-cost biocatalytic synthesis of NAD+, making it suitable for industrial production.
Smart Images

Figure CN119639715B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biopharmaceuticals and biotransformation, and particularly relates to a nicotinamide mononucleotide adenylyltransferase mutant, a mutant coding gene, a recombinant vector containing the mutant coding gene, a recombinant genetically engineered bacterium containing the mutant coding gene, and application of the nicotinamide mononucleotide adenylyltransferase mutant in biocatalytic synthesis of nicotinamide adenine dinucleotide. BACKGROUND
[0002] NAD + (Nicotinamide Adenine Dinucleotide, nicotinamide adenine dinucleotide) is an important coenzyme in cells, which is essential for regulating cell aging and maintaining normal body functions. In addition, NAD + and its metabolism directly or indirectly affect many aging-related diseases such as neurodegeneration, cancer, etc., and have wide application value. In industrial production, NAD + is used for industrial NAD + dependent enzyme catalysis, and NAD + dependent enzymes have wide applications in industry, which are used to synthesize various important chemicals, drugs and food additives, etc. For example, NAD + dependent amino acid dehydrogenase can catalyze the synthesis of chiral amino acids, and NAD + can also be used for the synthesis of some high-value chemicals, such as chiral drugs, vitamins, natural products, etc. In these applications, NAD + significantly improves the selectivity and yield of the reaction through efficient catalysis, and reduces environmental pollution, which meets the principles of green chemistry. However, due to the high consumption of NAD + in catalytic reactions, especially in large-scale production, its high cost limits its wide application. Therefore, how to effectively produce NAD + on a large scale has become a focus of current research.
[0003] At present, various chemical synthesis methods of NAD + have been reported, but the chemical synthesis of NAD + has the disadvantages of long reaction time, low yield, complex separation and purification steps, and large pollution of chemical reagents used in the synthesis process. In contrast, the synthesis of NAD + by biological method using NMN (nicotinamide mononucleotide) as substrate can overcome the limitations of the above chemical method, and is an efficient, low-cost and environmentally friendly production method.
[0004] The synthesis of NAD + by biological method using NMN as substrate has many advantages:
[0005] 1、NMN is a direct precursor of NAD + , which can more efficiently synthesize NAD + by providing the nucleotide component required for NAD + . This advantage makes the biological synthesis of NAD + more advantageous than chemical synthesis method, which can significantly improve the synthesis efficiency and simplify the reaction process. Using NMN as a substrate to synthesize NAD + , the multi-step synthesis and complex separation and purification steps required in chemical method can be reduced, and high consumption of chemical reagents can be avoided;
[0006] 2、In recent years, the chemical synthesis technology of NMN has made important breakthroughs, and the production efficiency has been greatly improved, and the cost has been significantly reduced. This progress has greatly reduced the price of NMN, further promoting its application in industrial production. With the decline of NMN synthesis cost, the economic benefits of NAD + synthesis by NMN have been greatly improved, providing a good foundation for large-scale production;
[0007] 3、The enzyme method for synthesizing NAD + has simple reaction and less by-products;
[0008] 4、Biological enzyme catalytic reaction has the advantages of high efficiency, fast reaction rate and high conversion rate. Biological enzymes show high specificity and reaction speed in catalytic process, which can complete the synthesis of NAD + in a short time.
[0009] When using enzyme method to synthesize NAD + , although this method shows potential in production, it still faces some challenges. One of them is that the activity of the enzyme has not reached the level required for industrialization, which limits its efficiency in large-scale production, and the economic benefits are limited, therefore, the activity of the enzyme needs to be further improved to ensure that it can meet the demand of industrialization level and achieve higher economic benefits. SUMMARY
[0010] The present application is to overcome the defects of low enzyme activity, low production efficiency and high cost in the prior art of enzyme synthesis of NAD + , and provides a nicotinamide mononucleotide adenosine transferase mutant, a mutant coding gene, a recombinant vector containing the mutant coding gene, a recombinant genetically engineered bacteria containing the mutant coding gene, and applies the nicotinamide mononucleotide adenosine transferase mutant to the process of biocatalytic synthesis of nicotinamide adenine dinucleotide.
[0011] To achieve the above-mentioned application purposes, the present application realizes the following technical solutions:
[0012] A nicotinamide mononucleotide adenylyltransferase mutant is obtained by site-directed mutagenesis of the amino acid sequence shown in SEQ ID NO. 1 at one or more of the following positions: (1) position 6, (2) position 10, (3) position 11.
[0013] As a preferred embodiment, a nicotinamide mononucleotide adenylyltransferase mutant is obtained by site-directed mutagenesis of the amino acid sequence shown in SEQ ID NO. 1 at one or more of the following positions: (1) position 6, valine V is mutated to cysteine C, (2) position 10, glutamine Q is mutated to glutamic acid E, (3) position 11, proline P is mutated to threonine T.
[0014] The nicotinamide mononucleotide adenylyltransferase of the present application is derived from Methanothermobacter thermautotrophicus WP_048060754.1, the amino acid sequence of which is shown in SEQ ID NO. 1, and the coding gene sequence of which is shown in SEQ ID NO. 2.
[0015] A coding gene of the nicotinamide mononucleotide adenylyltransferase mutant as described above.
[0016] As a preferred embodiment, the coding gene nucleotide sequence is shown in SEQ ID NO. 4.
[0017] As a preferred embodiment, the amino acid sequence of the nicotinamide mononucleotide adenylyltransferase mutant is shown in SEQ ID NO. 3.
[0018] A recombinant vector comprising the coding gene as described above.
[0019] A recombinant genetically engineered bacterium comprising the recombinant vector as described above.
[0020] The recombinant genetically engineered bacterium of the present application is prepared as follows:
[0021] The nicotinamide mononucleotide adenylyltransferase gene (or mutant gene) is linked to the expression vector pET28a to construct a heterologous expression recombinant plasmid pET28a-NMNAT containing the nicotinamide mononucleotide adenylyltransferase gene; the heterologous expression recombinant plasmid pET28a-NMNAT is transformed into Escherichia coli BL21 (DE3) to obtain a recombinant Escherichia coli containing the recombinant plasmid pET28a-NMNAT.
[0022] The nicotinamide mononucleotide adenylyltransferase mutant as described above is used in the biocatalytic synthesis of nicotinamide adenine dinucleotide.
[0023] As preferred, the application is: using the recombinant genetically engineered bacteria containing the gene encoding the nicotinamide mononucleotide adenylyltransferase mutant as catalyst, nicotinamide mononucleotide as substrate, ATP disodium salt as co-substrate, Mg 2+ in the presence of PB buffer with pH value of 6.5-8, at 30-50℃, after the reaction is completed, nicotinamide adenine dinucleotide is obtained.
[0024] As further preferred, the pH value of the PB buffer in the reaction system is 7.0.
[0025] As further preferred, the reaction temperature in the reaction system is 45℃.
[0026] As preferred, in the reaction system, when the catalyst is wet bacteria, the addition amount of the wet bacteria is 5-20 g / L; when the catalyst is pure enzyme, the addition amount of the pure enzyme is 0.01-1.0 g / L; the final concentration of the added nicotinamide mononucleotide is 33.4-167 g / L; the final concentration of the added ATP disodium salt is 55.3-276.5 g / L; and the final concentration of the added Mg 2+ is 14.25-71.25 g / L.
[0027] As further preferred, in the reaction system, when the catalyst is wet bacteria, the addition amount of the wet bacteria is 10 g / L; when the catalyst is pure enzyme, the addition amount of the pure enzyme is 0.1 g / L; the final concentration of the added nicotinamide mononucleotide is 100.2 g / L; the final concentration of the added ATP disodium salt is 165.9 g / L; and the final concentration of the added Mg 2+ is 42.75 g / L.
[0028] As preferred, in the reaction system, the molar ratio of the added nicotinamide mononucleotide to ATP disodium salt is 1:0.5-1.5; and the molar ratio of the nicotinamide mononucleotide to Mg 2+ is 1:0.5-2.
[0029] As further preferred, in the reaction system, the molar ratio of the added nicotinamide mononucleotide to ATP disodium salt is 1:1; and the molar ratio of the nicotinamide mononucleotide to Mg 2+ is 1:1.5.
[0030] Therefore, the present application has the following beneficial effects:
[0031] (1) The present application uses NMN as substrate, ATP disodium salt as co-substrate, and utilizes the catalysis of nicotinamide mononucleotide adenylyltransferase mutant under the action of magnesium ion to prepare NAD + , which helps to improve enzyme activity, produce less by-products and has fast reaction rate;
[0032] (2) The nicotinamide mononucleotide adenylyltransferase mutant of the application has better catalytic efficiency, and when NMN is used as a substrate for catalytic reaction, the conversion rate is higher than that of the original enzyme, NAD + The yield is also improved to a certain extent.
[0033] (3) The process method of the application overcomes the shortcomings of the chemical synthesis of NAD + , such as too many process steps, harsh reaction conditions, and difficult separation and purification, and is a high-efficiency, low-cost and environmentally friendly production method. BRIEF DESCRIPTION OF DRAWINGS
[0034] Figure 1 The reaction formula of the application for producing NAD + using enzyme method with NMN as substrate. DETAILED DESCRIPTION
[0035] The application will be further described below in combination with the drawings and specific examples. Those skilled in the art will be able to implement the application based on these descriptions. In addition, the examples of the application involved in the following description are generally only a part of the examples of the application, not all examples. Therefore, based on the examples in the application, all other examples obtained by those skilled in the art without creative labor shall fall within the scope of protection of the application.
[0036] Reagents for upstream genetic engineering: Phanta Super-Fidelity DNA Polymerase was purchased from Nanjing Novozyme Bio-Pharm Limited Company; Dpn I was purchased from Thermo Scientific Company. Plasmid extraction kit Plasmid Miniprep Kit, PCR clean-up kit PCR Clean-up Kit were purchased from AxyPrep Company; one-step cloning kit ClonExpressII One Step Cloning Kit was purchased from Nanjing Novozyme Bio-Pharm Company Limited. E. coli BL21 (DE3) was purchased from Shanghai Xuguan Biological Technology Development Co., Ltd.; DNA marker, low molecular weight standard protein, protein gel, etc. were purchased from Beijing GenStar Co., Ltd.; recombinant plasmid construction, primer synthesis, and sequence sequencing were completed by Hangzhou Qikexi Biological Technology Co., Ltd. Other commonly used reagents were purchased from National Pharmaceutical Group Chemical Reagent Co., Ltd.
[0037] Example 1: Construction of nicotinamide mononucleotide adenylyltransferase genetically engineered bacteria
[0038] The gene sequence of nicotinamide mononucleotide adenylyltransferase (Gen Bank No: NC_000916.1) derived from the thermophilic autotrophic Methanotthermus ferrireducens was codon-optimized and sent to Shengong Bioengineering (Shanghai) Co., Ltd. for full gene synthesis, and was cloned into recombinant expression plasmid pET-28a (+). The codon-optimized nicotinamide mononucleotide adenylyltransferase gene sequence is shown as SEQ ID NO. 2.
[0039] Example 2: Induced expression of nicotinamide mononucleotide adenylyltransferase (NMNAT)
[0040] The recombinant E. coli BL21 (DE3) / pET28a-NMNAT obtained in Example 1 was inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance, and cultured at 37°C, 200 rpm for 12 h, then inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin resistance at a 1% (v / v) inoculation amount, and cultured at 37°C, 150 rpm until the OD 600 of the bacterial cells reached 0.6-0.8. Then, 0.1 mM IPTG was added, and the culture was induced at 28°C for 12 h. After centrifugation at 4°C, 8000 rpm for 10 min, the supernatant was discarded, and the precipitate was collected, thereby obtaining wet bacterial cells containing the recombinant plasmid-expressed E. coli BL21 / pET28a-NMNAT. The wet bacterial cells can be directly used as a biocatalyst or for protein purification.
[0041] Example 3: Isolation and purification of nicotinamide mononucleotide adenylyltransferase (NMNAT)
[0042] The wet bacteria obtained in Example 2 were resuspended with binding buffer (50 mM sodium phosphate buffer, pH = 8.0, containing 300 mM NaCl, 10 mM imidazole), then ultrasonically broken (ice bath, 240 W for 10 min, working for 2 s, pausing for 2 s), centrifuged at 12,000 rpm for 40 min, and the supernatant was incubated with Ni affinity chromatography resin equilibrated with the above binding buffer. After washing with a washing buffer (50 mM sodium phosphate buffer, pH = 8.0, containing 300 mM NaCl, 50 mM imidazole) until the impurities were substantially removed, the target protein was eluted with an elution buffer (50 mM sodium phosphate buffer, pH = 8.0, containing 300 mM NaCl, 300 mM imidazole) and collected. After electrophoretic identification of the purity, the target protein was combined and dialyzed against a dialysis buffer (50 mM sodium phosphate buffer, pH = 8.0) for 48 h (the molecular weight cut-off of the dialysis bag was 14 KD), and the cut-off liquid was obtained, which was nicotinamide mononucleotide adenosine transferase enzyme liquid. The protein content was determined by Coomassie brilliant blue method to be 3.8 mg / mL. The enzyme liquid (specific enzyme activity was about 30 U / mg) was diluted to a final concentration of 0.5 mg / mL with 50 mM, pH = 8.0 sodium phosphate buffer, aliquoted, and stored at -80°C. The nicotinamide mononucleotide adenosine transferase (NMNAT) catalyzes the generation of 1 μmol of product NAD per minute + The required amount of enzyme is 1 enzyme activity unit, which is represented by U.
[0043] Example 4: Construction of a nicotinamide mononucleotide adenosine transferase mutant library
[0044] In the first round, the recombinant E. coli BL21 (DE3) / pET28a-NMNAT obtained in Example 1 was cultured in a test tube, and the plasmid was extracted as a template for site-directed mutagenesis PCR of nicotinamide mononucleotide adenosine transferase mutants. The V6C-Pf and V6C-Pr in Table 1 below were used as mutation primers for site-directed mutagenesis PCR. The PCR product was transformed, plated, and screened to obtain the V6C mutant, which was named V6C.
[0045] In the second round, V6C was used as a template, and Q10E-Pf and Q10E-Pr in Table 1 below were used as primers for site-directed mutagenesis PCR. The PCR product was transformed, plated, and screened to obtain the mutant with V6C mutation and Q10E mutation, which was named V6C-Q10E.
[0046] In the third round, V6C-Q10E was used as a template, and P11T-Pf and P11T-Pr in Table 1 below were used as primers for site-directed mutagenesis PCR. The PCR product was transformed, plated, and screened to obtain the mutant with V6C mutation and Q10E and P11T mutations, which was named V6C-Q10E-P11T.
[0047] The PCR reaction system is as follows: 2x Phanta Max buffer solution: 25 μL; dNTPs: 1 μL; upstream primer: 2 μL; downstream primer: 2 μL; template: 1 μL; Phanta Super-Fidelity DNA polymerase: 1 μL; ddH2O: 18 μL.
[0048] The PCR reaction condition is as follows: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 15 s, annealing at 59 °C for 30 s, extension at 72 °C for 5 min, a total of 30 cycles; post-extension at 72 °C for 10 min; storage at 4 °C.
[0049] The PCR result is subjected to DNA agarose gel electrophoresis positive verification, and the result shows that the amplification product is a single band, and the size is about 6300 bp. The PCR product is subjected to DpnI enzyme digestion template.
[0050] Table 1: primer sequence
[0051] V6C-Pf CGTGGTTTGCTGTGCGGTCGCATGCAGCC V6C-Pr CAGCAAACCACGCATGGTATATCTC Q10E-Pf GTGCGGTCGCATGGAACCGTTCCATC Q10E-Pr CATGCGACCGCACAGCAAA P11T-Pf CGGTCGCATGGAAACATTCCATCGTGG P11T-Pr TTCCATGCGACCGCACAG
[0052] Example 5: Large-scale preparation of bacterial cells
[0053] In the process of converting NMN to produce NAD + , a large amount of biological catalyst is needed, so it is necessary to prepare the bacterial cells on a large scale. The glycerol tube of the preserved nicotinamide mononucleotide transferase expression engineering bacteria was activated by plate streaking, and a single colony was inoculated into 10 mL of LB liquid medium containing 50 μg / mL of kanamycin, and was cultured at 37 °C for 12 h. The inoculation amount was 2%, and the bacterial cells were transferred to 50 mL of TB liquid medium containing 50 μg / mL of kanamycin, and were cultured at 37 °C until the OD600 reached about 0.8. Then, 0.1 mM of IPTG was added, and the bacterial cells were cultured at 28 °C for 12 h. After the culture, the culture solution was centrifuged at 8000 rpm for 10 min, the supernatant was discarded, the bacterial cells were collected, and were stored in a refrigerator at -20 °C for use.
[0054] Example 6: Nicotinamide mononucleotide adenosine transferase expression engineering bacteria catalyze the reaction of NMN to generate NAD + process
[0055] The nicotinamide mononucleotide adenosine transferase gene expression pure enzyme prepared according to the method in Example 4 was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a substrate, and the metal ion Mg 2+, respectively, using pH=7 phosphate buffer as the reaction medium to form a 1mL reaction system. The catalyst dosage is 0.1g / L pure enzyme, the final concentration of NMN is 200mM, the final concentration of ATP disodium salt is 200mM, and the final concentration of MgCl2 is 300mM. At 35°C and 600rpm / min, 200μL of the reaction solution is added to a 1.5mL EP tube containing 10μL 6M hydrochloric acid to terminate the reaction. Centrifuge at 12000rpm for 1min, take 100μL of the supernatant to a new 2mL EP tube, add 900μL ultrapure water, and shake to mix for NAD + HPLC detection of NAD + Concentration detection: Unitary C18 column (5μm, 100A, 4.6mm×250mm), mobile phase: 50mM sodium dihydrogen phosphate solution: methanol = 94:6 (sodium dihydrogen phosphate solution: weigh 6g sodium dihydrogen phosphate and dissolve in 800mL ultrapure water, dilute to 1L), flow rate 1mL / min, column oven 40°C, detection wavelength 260nm. Nicotinamide mononucleotide adenylyltransferase (NMNAT) catalyzes the substrate NMN to produce 1μmol of product NAD per minute. + The amount of enzyme required is 1 enzyme activity unit, expressed as U. After 5 minutes of reaction, 4.33mM of NMN was converted and the enzyme activity was 866U. + The reaction diagram is as follows Figure 1 shown.
[0056] Example 7: Nicotinamide mononucleotide adenylyltransferase-expressing engineered bacterial mutant V6C catalyzes the NMN reaction to produce NAD + process
[0057] The pure enzyme expressed by the nicotinamide mononucleotide adenylyltransferase V6C gene prepared according to the method in Example 4 was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a cosubstrate, and the metal ion Mg in MgCl2 was used. 2+ , respectively, using pH=7 phosphate buffer as the reaction medium to form a 1mL reaction system. The catalyst dosage is 0.1g / L pure enzyme, the final concentration of NMN is 200mM, the final concentration of ATP disodium salt is 200mM, the final concentration of MgCl2 is 300mM, 35℃, 600rpm / min, take 200μL of reaction solution and add it to a 1.5mL EP tube containing 10μL 6M hydrochloric acid to terminate the reaction. Centrifuge at 12000rpm for 1min, take 100μL of supernatant to a new 2mL EP tube, add 900μL ultrapure water, and shake to mix for NAD + HPLC detection of NAD +HPLC detection of NAD+ : Unitary C18 column (5 μm, 100 A, 4.6 mm x 250 mm), mobile phase of 50 mM sodium dihydrogen phosphate solution: methanol = 94:6 (sodium dihydrogen phosphate solution: weigh 6 g of sodium dihydrogen phosphate and dissolve in 800 mL of ultrapure water, make up to 1 L. ), flow rate of 1 mL / min, column oven 40 °C, detection wavelength of 260 nm. Nicotinamide mononucleotide adenylyltransferase (NMNAT) catalyzes 1 μmol of product NAD+ per minute from substrate NMN + The amount of enzyme required is 1 enzyme activity unit, denoted by U. After 5 min of reaction, 7.84 mM of NMN is converted, and the enzyme activity is 1568 U.
[0058] Example 8: Mutant V6C-Q10E of the engineered bacteria expressing nicotinamide mononucleotide adenylyltransferase catalyzes the reaction of NMN to generate NAD + Process
[0059] The pure enzyme of the nicotinamide mononucleotide adenylyltransferase V6C-Q10E gene expressed by the method in Example 4 is used as a catalyst, NMN is used as a substrate, ATP disodium salt is used as a co-substrate, and the metal ion Mg 2+ in MgCl2 is used. A 1 mL reaction system is formed with phosphate buffer at pH = 7 as a reaction medium. The amount of catalyst is 0.1 g / L of pure enzyme, the final concentration of NMN is 200 mM, the final concentration of ATP disodium salt is 200 mM, the final concentration of MgCl2 is 300 mM, 35 °C, 600 rpm / min, 200 μL of reaction solution is taken and added to a 1.5 mL EP tube containing 10 μL of 6M hydrochloric acid to terminate the reaction. Centrifugation at 12000 rpm for 1 min, 100 μL of supernatant is taken and added to a new 2 mL EP tube, 900 μL of ultrapure water is added, and the mixture is shaken and mixed for HPLC detection of NAD + +. HPLC detection of NAD + HPLC detection of NAD+ : Unitary C18 column (5 μm, 100 A, 4.6 mm x 250 mm), mobile phase of 50 mM sodium dihydrogen phosphate solution: methanol = 94:6 (sodium dihydrogen phosphate solution: weigh 6 g of sodium dihydrogen phosphate and dissolve in 800 mL of ultrapure water, make up to 1 L. ), flow rate of 1 mL / min, column oven 40 °C, detection wavelength of 260 nm. Nicotinamide mononucleotide adenylyltransferase (NMNAT) catalyzes 1 μmol of product NAD+ per minute from substrate NMN + The amount of enzyme required is 1 enzyme activity unit, denoted by U. After 5 min of reaction, 7.84 mM of NMN is converted, and the enzyme activity is 1568 U.
[0060] Example 9: Mutant V6C-Q10E-P11T of the engineered bacteria expressing nicotinamide mononucleotide adenylyltransferase catalyzes the reaction of NMN to generate NAD+ Process
[0061] The nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene expression pure enzyme prepared by the method in Example 4 was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a substrate, and metal ion Mg 2+ in MgCl2was used. A 1 mL reaction system was formed with phosphate buffer at pH = 7 as a reaction medium. The catalyst was used in an amount of 0.1 g / L pure enzyme, the final concentration of NMN was 200 mM, the final concentration of ATP disodium salt was 200 mM, the final concentration of MgCl2was 300 mM, the temperature was 35°C, the rotation speed was 600 rpm / min, 200 μL of the reaction solution was taken and added to a 1.5 mL EP tube containing 10 μL of 6M hydrochloric acid to terminate the reaction. Centrifugation was performed at 12000 rpm for 1 min, 100 μL of the supernatant was taken and added to a new 2 mL EP tube, 900 μL of ultrapure water was added, and shaking was performed for HPLC detection of NAD + . The concentration of NAD + was detected: a Unitary C18 chromatographic column (5 μm, 100A, 4.6 mm x 250 mm) was used, the mobile phase was 50 mM sodium dihydrogen phosphate solution:methanol = 94:6 (sodium dihydrogen phosphate solution: 6 g of sodium dihydrogen phosphate was weighed and dissolved in 800 mL of ultrapure water, and then diluted to 1 L), the flow rate was 1 mL / min, the column temperature was 40°C, and the detection wavelength was 260 nm. The amount of nicotinamide mononucleotide adenylyltransferase (NMNAT) required to catalyze 1 μmol of product NAD + per minute from the substrate NMN was 1 enzyme activity unit, which was represented by U. After 5 min of reaction, 13.3 mM of NMN was converted, and the enzyme activity was 2664 U.
[0062] Example 10: Nicotinamide mononucleotide adenylyltransferase gene expression engineering bacteria and mutants thereof catalyze the reaction of NMN to generate NAD + Changes in enzyme activity during the process
[0063] 0.1 g / L of nicotinamide mononucleotide adenylyltransferase or nicotinamide mononucleotide adenylyltransferase mutant engineering bacteria pure enzyme was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a substrate, and metal ion Mg 2+ in MgCl2was used. A 1 mL reaction system was formed with phosphate buffer at pH = 7 as a reaction medium. The reaction was sampled after 5 min for liquid chromatography analysis. It was found that, compared with nicotinamide mononucleotide adenylyltransferase, the V6C mutant enzyme activity was increased by 178.2%, the V6C-Q10E mutant yield was increased by 245.7%, and the V6C-Q10E-P11T mutant yield was increased by 307.7%.
[0064] Example 11: The engineered bacteria expressing nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene catalyze the reaction of NMN to generate NAD + Optimization of pH in the process
[0065] The pure enzyme of nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene expression prepared by the method in Example 4 was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a co-substrate, and the metal ion Mg 2+ in MgCl2was used. 1 mL reaction system was constructed with phosphate buffer with pH = 6.5, pH = 7, pH = 7.5, and pH = 8, respectively, as the reaction medium. The amount of catalyst was 0.1 g / L of pure enzyme, the final concentration of NMN was 200 mM, the final concentration of ATP disodium salt was 200 mM, and the final concentration of MgCl2was 300 mM. The reaction was terminated by taking 200 μL of the reaction solution into a 1.5 mL EP tube containing 10 μL of 6M hydrochloric acid at 35°C and 600 rpm / min. After centrifugation at 12000 rpm for 1 min, 100 μL of the supernatant was taken into a new 2 mL EP tube, 900 μL of ultrapure water was added, and the mixture was shaken and mixed for HPLC detection of NAD + . The concentration of NAD + was detected: Unitary C18 chromatographic column (5 μm, 100A, 4.6 mm x 250 mm), mobile phase was 50 mM sodium dihydrogen phosphate solution: methanol = 94:6 (sodium dihydrogen phosphate solution: weigh 6 g of sodium dihydrogen phosphate and dissolve in 800 mL of ultrapure water, then dilute to 1 L.), flow rate was 1 mL / min, column temperature was 40°C, and detection wavelength was 260 nm. The amount of enzyme required for nicotinamide mononucleotide adenylyltransferase (NMNAT) to catalyze the generation of 1 μmol of product NAD + from the substrate NMN per minute is 1 unit of enzyme activity, which is represented by U.
[0066] After 5 min of reaction, 17.6 mM of NAD + was generated in the pH = 6.5 system, and the enzyme activity was 3526.1 U; 18.6 mM of NAD + was generated in the pH = 7 system, and the enzyme activity was 3722.6 U; 16.7 mM of NAD + was generated in the pH = 7.5 system, and the enzyme activity was 3338.2 U; and 15.5 mM of NAD + was generated in the pH = 8 system, and the enzyme activity was 3104.2 U. The engineered bacteria expressing nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene catalyze the reaction of NMN to generate NAD + in the process, and the optimum pH is 7.0.
[0067] Example 12: The engineered bacteria expressing nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene catalyze the reaction of NMN to generate NAD + Optimization of temperature in the process
[0068] The pure enzyme catalyzed by nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene expressed in the method prepared in Example 4 was used as the catalyst, NMN was used as the substrate, ATP disodium salt was used as the co-substrate, and the metal ion Mg 2+ in MgCl2was used to form a 1 mL reaction system with phosphate buffer at pH = 7.0. The catalyst was used in an amount of 0.1 g / L of pure enzyme, the final concentration of NMN was 200 mM, the final concentration of ATP disodium salt was 200 mM, the final concentration of MgCl2was 300 mM, and the reaction temperature was 30°C, 35°C, 40°C, 45°C, and 50°C, respectively, at a speed of 600 rpm / min for 5 min. 100 μL of the reaction solution was taken and added to a 1.5 mL EP tube containing 5 μL of 6M hydrochloric acid to terminate the reaction. Centrifugation was performed at 12000 rpm for 1 min, 100 μL of the supernatant was taken and added to a new 2 mL EP tube, 900 μL of ultrapure water was added, and the mixture was shaken and mixed for HPLC detection of NAD + . The concentration of NAD + was detected: Unitary C18 chromatographic column (5 μm, 100A, 4.6 mm x 250 mm), the mobile phase was 50 mM sodium dihydrogen phosphate solution:methanol = 94:6 (sodium dihydrogen phosphate solution: 6 g of sodium dihydrogen phosphate was weighed and dissolved in 800 mL of ultrapure water, and then diluted to 1 L.), the flow rate was 1 mL / min, the column temperature was 40°C, and the detection wavelength was 260 nm. Nicotinamide mononucleotide adenylyltransferase (NMNAT) catalyzes the generation of 1 μmol of product NAD + from 1 μmol of substrate NMN per minute. The amount of enzyme required is 1 unit of enzyme activity, which is represented by U.
[0069] After 5 min of reaction, NAD + was generated at a concentration of 9.99 mM in the reaction system at 30°C, and the enzyme activity was 1999.1 U; NAD + was generated at a concentration of 15.0 mM in the reaction system at 35°C, and the enzyme activity was 2997.9 U; NAD + was generated at a concentration of 19.0 mM in the reaction system at 40°C, and the enzyme activity was 3790.4 U; NAD + was generated at a concentration of 23.1 mM in the reaction system at 45°C, and the enzyme activity was 4620.1 U; NAD + was generated at a concentration of 19.7 mM in the reaction system at 50°C, and the enzyme activity was 3940.6 U. The engineered bacteria expressing nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene catalyze the reaction of NMN to generate NAD + in the process, and the optimal reaction temperature is 45°C.
[0070] Example 13: The engineered bacteria expressing nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene catalyze the reaction of NMN to generate NAD + Optimization of the addition amount of ATP disodium salt in the process
[0071] The pure enzyme of nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene expression prepared by the method in Example 4 was used as the catalyst, NMN was used as the substrate, ATP disodium salt was used as the co-substrate, and the metal ion Mg 2+ in MgCl2was used to form a 1 mL reaction system with phosphate buffer with pH = 7.0 as the reaction medium. The catalyst was used in an amount of 0.1 g / L of pure enzyme, the final concentration of NMN was 200 mM, the final concentration of ATP disodium salt was 100 mM, 150 mM, 200 mM, and 250 mM, respectively, the final concentration of MgCl2was 300 mM, the reaction temperature was 45°C, the reaction was carried out at 600 rpm / min for 2 h, 100 μL of the reaction solution was taken and added into a 1.5 mL EP tube containing 5 μL of 6M hydrochloric acid to terminate the reaction. Centrifugation was carried out at 12000 rpm for 1 min, 20 μL of the supernatant was taken and added into a new 2 mL EP tube, 980 μL of ultrapure water was added, and the mixture was shaken and mixed for HPLC detection of NAD + . The concentration of NAD + was detected: Unitary C18 chromatographic column (5 μm, 100A, 4.6 mm x 250 mm), the mobile phase was 50 mM sodium dihydrogen phosphate solution:methanol = 94:6 (sodium dihydrogen phosphate solution: 6 g of sodium dihydrogen phosphate was weighed and dissolved in 800 mL of ultrapure water, and then diluted to 1 L.), the flow rate was 1 mL / min, the column temperature was 40°C, and the detection wavelength was 260 nm.
[0072] After 1 h of reaction, in the reaction system with a final concentration of 100 mM of ATP disodium salt, 60.9 mM of NMN was converted, and the conversion rate was 30.5%; in the reaction system with a final concentration of 150 mM of ATP disodium salt, 71.02 mM of NMN was converted, and the conversion rate was 35.6%; in the reaction system with a final concentration of 200 mM of ATP disodium salt, 85.2 mM of NMN was converted, and the conversion rate was 42.6%; and in the reaction system with a final concentration of 250 mM of ATP disodium salt, 84.5 mM of NMN was converted, and the conversion rate was 42.2%. The engineered bacteria expressing nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene catalyze the reaction of NMN to generate NAD + in the process, and the optimal addition amount of ATP disodium salt was 200 mM.
[0073] Example 14: The engineered bacteria expressing nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene catalyze the reaction of NMN to generate NAD+ Optimization of MgCl2 addition amount in the process
[0074] The pure enzyme expressed by the nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene prepared in the method of Example 4 was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a co-substrate, and the metal ion Mg in MgCl2 was used to catalyze the reaction. 2+ A 10 mL reaction system was formed with phosphate buffer with pH = 7.0 as a reaction medium. The catalyst was used in an amount of 0.1 g / L of pure enzyme, the final concentration of NMN was 200 mM, the final concentration of ATP disodium salt was 200 mM, the final concentration of MgCl2 was 100 mM, 200 mM, 300 mM, and 400 mM, respectively, the reaction temperature was 45°C, the reaction was carried out at 600 rpm / min for 2 h, 100 μL of the reaction solution was taken and added into a 1.5 mL EP tube containing 5 μL of 6M hydrochloric acid to terminate the reaction. Centrifugation was carried out at 12000 rpm for 1 min, 20 μL of the supernatant was taken and added into a new 2 mL EP tube, 980 μL of ultrapure water was added, and shaking was carried out for mixing for NAD + HPLC detection. The concentration of NAD + was detected. A Unitary C18 chromatographic column (5 μm, 100A, 4.6 mm x 250 mm) was used, the mobile phase was 50 mM sodium dihydrogen phosphate solution:methanol = 94:6 (sodium dihydrogen phosphate solution: 6 g of sodium dihydrogen phosphate was weighed and dissolved in 800 mL of ultrapure water, and then diluted to 1 L. ), the flow rate was 1 mL / min, the column temperature was 40°C, and the detection wavelength was 260 nm.
[0075] After 1 h of reaction, in the reaction system with a final concentration of 100 mM of MgCl2, 78.3 mM of NMN was converted, and the conversion rate was 39.1%; in the reaction system with a final concentration of 200 mM of MgCl2, 90.7 mM of NMN was converted, and the conversion rate was 45.3%; in the reaction system with a final concentration of 300 mM of MgCl2, 92.2 mM of NMN was converted, and the conversion rate was 46.1%; in the reaction system with a final concentration of 400 mM of MgCl2, 62.8 mM of NMN was converted, and the conversion rate was 31.4%. The engineered bacteria body expressing the nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene catalyzed the reaction of NMN to generate NAD + The optimal addition amount of MgCl2 in the process was 300 mM.
[0076] The above only describes the preferred embodiments and principles of the present application in detail. For ordinary skilled persons in the art, the specific implementation manner can be changed according to the idea provided by the present application, and these changes should also be considered as the protection scope of the present application.
Claims
1. A nicotinamide mononucleotide adenylyltransferase mutant, characterized in that, The amino acid sequence shown in SEQ ID NO. 1 is subjected to site-directed mutation, and the mutation site is selected from one of the following: (1) the 6th valine V is mutated to cysteine C; (2) the 6th valine V is mutated to cysteine C, and the 10th glutamine Q is mutated to glutamic acid E; (3) the 6th valine V is mutated to cysteine C, the 10th glutamine Q is mutated to glutamic acid E, and the 11th proline P is mutated to threonine T.
2. A coding gene of the nicotinamide mononucleotide adenosine transferase mutant according to claim 1.
3. The genetic code according to claim 2, wherein, When the mutation sites of the mutant are the 6th, 10th and 11th positions, the nucleotide sequence of the coding gene is shown in SEQ ID NO. 4, and the amino acid sequence of the nicotinamide mononucleotide adenosine transferase mutant is shown in SEQ ID NO.
3.
4. A recombinant vector comprising the coding gene according to claim 2 or 3.
5. A recombinant genetically engineered bacterium comprising the recombinant vector according to claim 4.
6. Use of the nicotinamide mononucleotide adenosine transferase mutant according to claim 1 in the biological catalytic synthesis of nicotinamide adenine dinucleotide.
7. Use according to claim 6, characterized in that, The application is: wet bacteria or pure enzyme obtained by ultrasonic crushing of wet bacteria, which are obtained by fermentation culture of recombinant genetically engineered bacteria containing nicotinamide mononucleotide adenylyltransferase mutant encoding gene, as a catalyst, nicotinamide mononucleotide as a substrate, ATP disodium salt as a co-substrate, in the presence of Mg 2+ buffer solution with a pH value of 6.5-8, at 30-50 DEG C, and after the reaction is completed, nicotinamide adenine dinucleotide is obtained.
8. Use according to claim 7, characterized in that, In the reaction system, when the catalyst is wet bacteria, the addition amount of the wet bacteria is 5-20 g / L; when the catalyst is pure enzyme, the addition amount of the pure enzyme is 0.01-1.0 g / L; the final concentration of the added nicotinamide mononucleotide is 33.4-167 g / L; the final concentration of the added ATP disodium salt is 55.3-276.5 g / L; the final concentration of the added Mg 2+ is 14.25-71.25 g / L.
9. Use according to claim 7, characterized in that, The molar ratio of nicotinamide mononucleotide to ATP disodium salt in the reaction system is 1:0.5-1.5; the molar ratio of nicotinamide mononucleotide to Mg 2+ is 1:0.5-2.
Citation Information
Patent Citations
Nicotinamide mononucleotide adenylyltransferase (Nmnat) mutant as well as coding gene and application thereof
CN103710321A
Nicotinamide mononucleotide adenosine transferase mutant
CN115873820A