Construction method and application of circsamd4 gene knockout mouse model
The circSamd4 gene knockout mouse model constructed using CRISPR/Cas9 gene editing technology solves the problems of low success rate and poor consistency in existing glaucoma models, and provides a simple and reliable tool for glaucoma research, which can be used to study the pathogenesis and treatment strategies of glaucoma.
Patent Information
- Application Number
- CN202410949956.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-16
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2044-07-16
AI Technical Summary
Existing animal models for glaucoma suffer from low success rates, complex procedures, and poor consistency, failing to meet the needs of glaucoma research and lacking suitable animal models for diagnostic and treatment studies.
Using CRISPR/Cas9 gene editing technology, the mouse circSamd4 gene was knocked out using sgRNA to construct a circSamd4 gene knockout mouse model. By combining sgRNA1 and sgRNA2, the partial intron 3 and SINE elements of the circSamd4 gene were specifically knocked out, affecting the expression of circular RNA and achieving gene editing.
The constructed circSamd4 gene knockout mouse model exhibits obvious glaucoma phenotypes such as retinal thinning, loss of retinal ganglion cells, and visual impairment, providing a simple, reliable, and economical animal model for studying the pathogenesis of glaucoma and drug screening.
Smart Images
Figure CN119639811B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of disease animal model construction methods, and particularly relates to a circSamd4 gene knockout mouse model construction method and application. BACKGROUND
[0002] Glaucoma is the leading irreversible blinding eye disease in the world. According to the latest statistics of the World Health Organization (WHO), there are currently about 80 million glaucoma patients worldwide, and it is estimated that the number of glaucoma patients worldwide will exceed 111.8 million by 2040. Glaucoma not only brings great physical and mental suffering to individuals, but also has become a major global public health problem. The pathogenesis of glaucoma has not been fully elucidated, there is a lack of effective treatment methods in clinic, and the current research lacks a suitable animal model. Therefore, establishing an effective animal disease model is of great significance for the diagnosis and treatment of glaucoma.
[0003] Recent studies have also suggested that glaucoma is a neurodegenerative disease regulated by multiple factors. With the increasing number of glaucoma patients year by year, combined with limited treatment options, poor patient prognosis and other problems, glaucoma treatment has become a great challenge for clinical ophthalmologists. Therefore, a full understanding of the pathogenesis of glaucoma and the search for effective early diagnosis and treatment methods have always been the focus and difficulty of glaucoma research.
[0004] The gene knockout mice constructed in the present application all exhibit obvious glaucoma phenotypes such as thinning of retinal thickness, loss of retinal ganglion cells (GCL), and damage to visual function. The gene knockout mice can provide a simple, reliable and economical animal model for the study of the pathogenesis of glaucoma and the screening of drug and clinical treatment strategies.
[0005] The most commonly used open-angle glaucoma model is mainly divided into gene induction type and operation intervention type according to the construction method. The commonly used method of operation intervention type is to induce a high intraocular pressure model by operation, which has large differences in success rate, requires professional technical skills, and has low consistency of the constructed model. The existing various rodent glaucoma models have certain defects and cannot fully meet the current needs of glaucoma research, so it is very important to seek a new modeling method. SUMMARY
[0006] The present application aims to overcome the deficiencies of the prior art and provides a circSamd4 gene knockout mouse animal model and a construction method and application thereof.
[0007] To achieve the above-mentioned application purposes, the present application provides the following technical solutions:
[0008] A method for constructing a circSamd4 gene knockout mouse animal model, comprising the following steps: knocking out the gene of circSamd4 of a mouse by using sgRNA to obtain a circSamd4 gene knockout mouse.
[0009] In the present application, sgRNA refers to single guide RNA (sgRNA), which is a single-stranded RNA molecule with a length of about 100-200 nucleotides. sgRNA is an important component of the CRISPR / Cas9 gene editing system, which contains a target sequence (CrRNA) and a Cas9 nuclease recognition sequence (tracrRNA), and can guide Cas9 protein to recognize and cut specific DNA sequences, thereby realizing gene editing.
[0010] In some embodiments of the present application, the sgRNA comprises sgRNA1 and sgRNA2, the nucleotide sequence of the sgRNA1 is shown in SEQ ID No. 1, and the nucleotide sequence of the sgRNA2 is shown in SEQ ID No. 2.
[0011] In some embodiments of the present application, the mass ratio of the sgRNA1 and the sgRNA2 is 1:1.
[0012] In some embodiments of the present application, according to the circSamd4 gene sequence, the Partial intron 3 of the chromosome 14 of the circSamd4 gene is knocked out, and the SINE element downstream of the circular RNA is knocked out, which is predicted to affect the expression of the circular RNA without affecting the expression of the linear gene.
[0013] In some embodiments of the present application, the Cas9 mRNA and the constructed sgRNA1 and sgRNA2 are co-injected into the nucleus of a mouse zygote to produce a targeted knockout mouse, i.e., an F0 generation mouse.
[0014] In some embodiments of the present application, the nucleotide sequence of the Cas9 mRNA is shown in SEQ ID No. 3.
[0015] In the present application, the role of the Cas9 mRNA is to translate the Cas9 protein in the zygote, and then the Cas9 protein cuts the genomic DNA molecule under the guidance of the sgRNA.
[0016] In some embodiments of the present application, the concentration of the sgRNA is 100 pmol / μL.
[0017] In some embodiments of the present application, the concentration of the Cas9 protein after translation of the Cas9 mRNA is 250 ng / μL.
[0018] In some embodiments of the present application, the mass ratio of the Cas9 mRNA to the sgRNA1 is (1-2):1.
[0019] In some embodiments of the present application, the mass ratio of the Cas9 mRNA to the sgRNA2 is (1-2):1.
[0020] The present application does not have special limitations on the source of the mouse, for example, C57BL / 6J used in conventional gene knockout can be used.
[0021] In a preferred embodiment of the present application, the method for constructing the circSamd4 gene knockout mouse animal model comprises the following steps: the method for constructing the mouse animal model comprises the following steps:
[0022] (1) Constructing sgRNA for the circSamd4 gene; the nucleotide sequence of the sgRNA1 is shown in SEQ ID No. 1, and the nucleotide sequence of the sgRNA2 is shown in SEQ ID No. 2;
[0023] (2) Introducing the Cas9 mRNA and the sgRNA1 and the sgRNA2 into the nucleus of the mouse zygote cell to obtain the circSamd4 gene knockout mouse, which is the F0 generation mouse. The nucleotide sequence of the Cas9 mRNA is shown in SEQ ID No. 3. The present application does not have special limitations on the source of the mouse, and C57BL / 6J used in conventional gene knockout can be used;
[0024] (3) Extracting the tail DNA of the F0 generation mouse, and performing PCR amplification and sequence analysis to identify whether it is a chimera;
[0025] (4) Mating the F0 generation mouse with a WT mouse to obtain an F1 generation mouse, and identifying the homozygote by PCR to obtain the mouse animal model.
[0026] SEQ ID NO. 1: CTTCCTTCAGTCTTCGTTCACGG
[0027] SEQ ID NO. 2: TGTAGGACCTAGGTTGCTCCAGG SEQ ID NO. 3:
[0028]
[0029]
[0030]
[0031] The application further provides sgRNA for constructing a circSamd4 gene knockout mouse model based on a CRISPR / Cas9 gene knockout technology, including sgRNA1 and sgRNA2, wherein the sgRNA1 is shown as SEQ ID NO:1, and the sgRNA2 is shown as SEQ ID NO:2.
[0032] The application further provides a circSamd4 gene targeting vector, which is an sgRNA expression vector based on a CRISPR / Cas9 system, and sequences of action sites of the sgRNA are shown as SEQ ID NO:1 and SEQ ID NO:2.
[0033] The application further provides use of the aforementioned sgRNA in constructing a glaucoma-related gene knockout mouse animal model.
[0034] The application further provides application of a circSamd4 gene knockout mouse animal model constructed by the aforementioned construction method in researching glaucoma disease mechanisms.
[0035] The application further provides application of a circSamd4 gene knockout mouse animal model constructed by the aforementioned construction method in screening drugs for targeted treatment of glaucoma.
[0036] The reagents and raw materials used in the application are commercially available.
[0037] The application has the following beneficial effects:
[0038] The application uses a Crispr-cas9 gene knockout technology to knockout a mouse circRNA gene circSamd4. The obtained mice all show obvious glaucoma phenotypes such as thinning of retinal thickness, loss of retinal ganglion cells (GCL), and damage of visual function. The application can provide a simple, reliable, and economical animal model for research on glaucoma pathogenesis, screening of drugs and clinical treatment strategies.
[0039] The application obtains a gene knockout mouse that naturally shows glaucoma-related phenotypes soon after birth (within 6-8 weeks), and the modeling time is short, without the need for special reagents, surgery, and physical methods, and the method is simple and easy to implement. The mice can be freely mated to produce viable homozygous offspring, and the price is low. BRIEF DESCRIPTION OF DRAWINGS
[0040] Figure 1 FIG. 1 is a schematic diagram of gene knockout of a circSamd4 gene knockout mouse;
[0041] Figure 2 FIG. 4 is a genotyping result of F1 generation mice;
[0042] Figure 3 Sequencing results of PCR products of F1 generation mice;
[0043] Figure 4 HE staining showed that the retinal thickness of circSamd4 gene knockout mice was thin;
[0044] Figure 5 RBPMS immunofluorescence of retinal flat mount showed that the retinal ganglion cells of circSamd4 gene knockout mice were reduced;
[0045] Figure 6 RBPMS immunofluorescence of retinal flat mount showed that the retinal ganglion cells of circSamd4 gene knockout mice were reduced;
[0046] Figure 7 Visual evoked potential (VEP) experiment showed that the amplitude of visual evoked potential of circSamd4 gene knockout mice was reduced. DETAILED DESCRIPTION
[0047] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.
[0048] The present application provides a construction method of circSamd4 gene knockout mouse, which uses sgRNA1 and sgRNA9 to knockout the circSamd4 gene of the mouse, and obtains the circSamd4 gene knockout mouse; the nucleotide sequence of the sgRNA1 is shown as SEQ ID No. 1, and the nucleotide sequence of the sgRNA2 is shown as SEQ ID No. 2; in the present application, the mass ratio of the sgRNA1 and the sgRNA is preferably 1:1.
[0049] According to the circSamd4 gene sequence, the present application knocks out Partialintron3 of the circSamd4 gene on chromosome 14, knocks out the SINE element downstream of the circular RNA, and predicts that it can affect the expression of circular RNA without affecting the expression of linear genes.
[0050] In the present application, the Cas9 mRNA functions to translate Cas9 protein in the fertilized egg, and then the Cas9 protein cleaves the genomic DNA molecule under the guidance of sgRNA. The nucleotide sequence of the Cas9 mRNA is shown in SEQ ID No. 3. The mass ratio of the Cas9 mRNA to each sgRNA is preferably (1-2):1, preferably, the mass ratio of Cas9 mRNA to sgRNA1 is 2:1, and the mass ratio of Cas9 mRNA to sgRNA2 is 2:1.
[0051] Example 1: Genotype identification of mice
[0052] I. Construction scheme of circSamd4 gene knockout mice, the schematic diagram is shown in Figure 1
[0053] (1) Construct specific target sgRNA1 and sgRNA2 for circSamd4 gene
[0054] Construct sgRNA for circSamd4 gene, use sgRNA1 and sgRNA2 to knockout the gene of circSamd4 of mice, and obtain circSamd4 gene knockout mice; the nucleotide sequence of sgRNA1 is shown in SEQ ID No. 1, and the nucleotide sequence of sgRNA2 is shown in SEQ ID No. 2; the mass ratio of sgRNA1 to sgRNA is 1:1.
[0055] (2) Transcribe the purified sgRNA1 and sgRNA2 in step (1) and Cas9 nuclease mRNA in vitro, microinject into fertilized eggs, and transplant the survived fertilized eggs after injection into the uterus of surrogate mother mice, and the mice born after gestation are F0 generation mice. The nucleotide sequence of the Cas9 mRNA is shown in SEQ ID No. 3. The source of mice in the present application is not particularly limited, and C57BL / 6J commonly used for gene knockout can be used.
[0056] (3) Tail clipping of F0 generation mice to extract DNA for PCR amplification and Sanger sequencing to identify positive F0 generation mice. The obtained F0 positive mouse circSamd4 gene deletes 963 bp bases as shown in Figure 2
[0057] SEQ ID NO. 7:
[0058]
[0059]
[0060] (4) The F0 generation positive mice obtained in step (3) above are mated with C57BL / 6j wild type mice to obtain F1 generation hybrid mice with genotype identified as positive.
[0061] (5) The F1 generation hybrid mice are mated to breed F2, from which pure and circSamd4 gene knockout mice are screened, and then the next step of functional research is carried out. All mice are bred under specific pathogen free (SPF level) conditions, and are bred in strict accordance with the standards of the animal welfare ethics committee.
[0062] II. PCR identification method and results of positive F1 generation mice:
[0063] (1) The extracted mouse DNA is genotyped by PCR amplification. By amplifying with F1R1 primer and F1R2 primer, only 417 bp single band is amplified for homozygotes, 417 bp, 464 bp and 1380 bp three bands are amplified for heterozygotes, and 464 bp and 1380 bp double bands are amplified for wild type.
[0064] Note: Two pairs of primers need to be PCR amplified respectively.
[0065] The specific primer sequences for PCR amplification identification are as follows:
[0066] Forward primer (F1): 5'-CGGGTTATGAATGTTTGGAATGGA-3' (SEQ ID No. 4)
[0067] Reverse primer (R1): 5'-CAAAATCTCAATGAGGCCTGCTC-3' (SEQ ID No. 5)
[0068] Forward primer (F1): 5'-CGGGTTATGAATGTTTGGAATGGA-3' (SEQ ID No. 4)
[0069] Reverse primer (R2): 5'-GGCTGTGTCAGGTTACTTTGTTATC-3' (SEQ ID No. 6)
[0070] (2) The PCR reaction system for genotype identification is shown in Table 1, and the PCR reaction program is shown in Table 2.
[0071] Table 1 PCR reaction system
[0072] Ingredients Amount ddH2O 9.0 μL Forward primer 1.0 μL Reverse primer 1.0 μL Premix Taq 12.5 μL DNA 1.5 μL Total 25 μL
[0073] Table 2 PCR reaction program
[0074]
[0075] (3) Electrophoretic verification of amplification products: 5 μL of amplification products were subjected to 2% agarose gel electrophoresis at 120V for 40 minutes. The gel was then imaged. The results are as follows: Figure 2
[0076] (4) F0 generation mouse identification report: PCR detection was performed on the F0 generation using primers F1+R1 and F1+R3, respectively. The results are shown in the electrophoresis diagram. Figure 2 ,Depend on Figure 2 It can be seen that heterozygous mice show bands at positions 417bp, 464bp, and 1380bp, wild-type mice show bands at positions 464bp and 1380bp, while homozygous mice show a band only at position 417bp. Therefore, mice 1, 2, 5, 6, 8, 11, and 12 are homozygous.
[0077] To determine the specific knockout fragment, sequencing was performed on F0 generation mice that tested positive, revealing a 963bp deletion. Figure 3 ).
[0078] The sequencing primer sequences for the PCR products are as follows:
[0079] Sequence primer(R1):5'-CAAAATCTCAATGAGGCCTGCTC-3'(SEQ ID No.5)
[0080] Example 2
[0081] To investigate whether circSamd4 knockout mice exhibit glaucoma-related phenotypes, under normal feeding conditions, WT mice and circSamd4 knockout mice underwent HE staining of paraffin sections of the eyeballs, immunofluorescence staining of frozen sections of the eyeballs, immunofluorescence staining of retinal smears, and examination of flash visual evoked potentials.
[0082] like Figure 4 As shown, total retinal thickness and retinal ganglion cell complex (GCC) thickness were measured in WT mice and circSamd4 knockout mice using retinal histology (HE) centered on the optic nerve head. The results showed that circSamd4 knockout mice had reduced total retinal thickness and GCC thickness compared to WT mice.
[0083] like Figure 5As shown in the WT mice and circSamd4 gene knockout mice by retinal spread and immunofluorescence staining, the relative number of retinal ganglion cells (GCL) in the peripheral retina was calculated. The results showed that circSamd4 compared with WT mice, the peripheral retina appeared obvious GCL cell loss.
[0084] As Figure 6 As shown in the WT mice and circSamd4 knockout mice by retinal spread and immunofluorescence staining, the relative number of retinal ganglion cells (GCL) in the peripheral retina was calculated. The results showed that circSamd4 compared with WT mice, the peripheral retina appeared obvious GCL cell loss.
[0085] As Figure 7 As shown in the WT mice and circSamd4 gene knockout mice by retinal spread and immunofluorescence staining, the relative number of retinal ganglion cells (GCL) in the peripheral retina was calculated. The results showed that circSamd4 compared with WT mice, the peripheral retina appeared obvious GCL cell loss.
[0086] The above only describes the preferred embodiments of the present application and is not intended to limit the protection scope of the present application. Any modification, equivalent replacement, improvement, etc. within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. Application of a circSamd4 knockout mouse animal model constructed by a construction method of the circSamd4 knockout mouse animal model in studying the mechanism of glaucoma disease; The construction method comprises the following steps: The circSamd4 gene of the mouse is knocked out by using sgRNA to obtain a circSamd4 knockout mouse.
2. Use according to claim 1, characterized in that, The sgRNA comprises sgRNA1 and sgRNA2, the nucleotide sequence of the sgRNA1 is shown as SEQ ID No. 1, and the nucleotide sequence of the sgRNA2 is shown as SEQ ID No.
2.
3. Use according to claim 2, wherein the compound is ###0002### The mass ratio of the sgRNA1 and the sgRNA2 is 1:
1.
4. Use according to claim 1, characterized in that, The Partial intron 3 of the circSamd4 gene on chromosome 14 is knocked out, and the SINE element downstream of the circular RNA is knocked out.
5. Use according to claim 2, characterized in that, The Cas9 mRNA is co-injected into the nucleus of a mouse zygote cell together with the constructed sgRNA1 and sgRNA2 to produce a targeted knockout mouse, i.e., an F0 generation mouse. The nucleotide sequence of the Cas9 mRNA is shown as SEQ ID No.
3.
6. The use according to claim 5, wherein the compound is ###0002### The concentration of the sgRNA is 100 pmol / μL. And / or, the concentration of the Cas9 protein translated from the Cas9 mRNA is 250 ng / μL.
7. Use according to claim 5, characterized in that, The mass ratio of the Cas9 mRNA to the sgRNA1 is (1-2):1; and / or, the mass ratio of the Cas9 mRNA to the sgRNA2 is (1-2):
1.
8. Application of a circSamd4 knockout mouse animal model constructed by a construction method of the circSamd4 knockout mouse animal model in screening drugs for targeted treatment of glaucoma; The construction method comprises the following steps: The circSamd4 gene of the mouse is knocked out by using sgRNA to obtain a circSamd4 knockout mouse.
9. Use according to claim 8, characterized in that, The sgRNA comprises sgRNA1 and sgRNA2, the nucleotide sequence of the sgRNA1 is shown as SEQ ID No. 1, and the nucleotide sequence of the sgRNA2 is shown as SEQ ID No.
2.
10. Use according to claim 9, wherein The mass ratio of the sgRNA1 and the sgRNA2 is 1:
1.
11. Use according to claim 8, characterized in that, The Partial intron 3 of the circSamd4 gene on chromosome 14 is knocked out, and the SINE element downstream of the circular RNA is knocked out.
12. Use according to claim 9, characterized in that, The Cas9 mRNA is co-injected into the nucleus of a mouse zygote cell together with the constructed sgRNA1 and sgRNA2 to produce a targeted knockout mouse, i.e., an F0 generation mouse. The nucleotide sequence of the Cas9 mRNA is shown as SEQ ID No.
3.
13. The use according to claim 12, wherein the compound is ###00010### or a pharmaceutically acceptable salt thereof. The concentration of the sgRNA is 100 pmol / μL. And / or, the concentration of the Cas9 protein translated from the Cas9 mRNA is 250 ng / μL.
14. Use according to claim 12, characterized in that, The mass ratio of the Cas9 mRNA to the sgRNA1 is (1-2): 1; and / or, the mass ratio of the Cas9 mRNA to the sgRNA2 is (1-2):
1. The mass ratio of the Cas9 mRNA to the sgRNA1 is (1-2): 1; and / or, the mass ratio of the Cas9 mRNA to the sgRNA2 is
Citation Information
Patent Citations
CircSamd4 and application thereof in preparation of medicine for treating myocardial fibrosis
CN119162184A