A gene target for treating liver disease and a drug

By targeting the Ndufa7 gene, we have developed drugs to treat liver diseases, which have solved the problem of liver disease caused by mitochondrial dysfunction and provided an effective solution for the prevention and treatment of liver diseases.

CN119776513BActive Publication Date: 2025-12-16GUANGDONG UNIV OF TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411840471.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2023-12-13
Filing Date
2024-12-13
Publication Date
2025-12-16
Estimated Expiration
2044-12-13

AI Technical Summary

Technical Problem

Current technologies are insufficient to effectively treat liver diseases caused by mitochondrial dysfunction, especially non-alcoholic fatty liver disease, and there is a lack of effective mitochondrial-targeting drugs.

Method used

Using the Ndufa7 gene as a target, we will develop drugs for treating liver diseases by knocking out or overexpressing the Ndufa7 gene, construct animal models of liver diseases, and screen and evaluate the efficacy of the drugs.

Benefits of technology

Knockout of the Ndufa7 gene leads to abnormal liver function, inhibiting its expression can induce non-alcoholic fatty liver disease, and overexpression of the Ndufa7 gene can improve cell survival rate under oleic acid stimulation, providing an effective treatment for liver disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119776513B_ABST
    Figure CN119776513B_ABST
Patent Text Reader

Abstract

The application discloses a kind of liver disease treatment gene target and drug.The liver function and liver tissue of Ndufa7 gene knockout mouse are detected and analyzed by the present application, and it is found that knockout Ndufa7 gene will cause abnormal liver function of mouse, liver tissue is damaged, and it is found that the expression of Ndufa7 gene can be induced by real-time quantitative fluorescence PCR to induce the occurrence of non-alcoholic fatty liver disease, and Ndufa7 gene can be used as liver disease treatment gene target to develop liver disease treatment drug.In addition, the present application finds that the survival rate of cell under the stimulation of oleic acid can be improved by overexpressing Ndufa7 gene in cell, and oleic acid is a common reagent for inducing non-alcoholic fatty liver cell model, i.e.overexpression Ndufa7 gene can prevent or improve liver disease, and can be used as liver disease treatment drug.The present application fully proves that Ndufa7 is involved in the occurrence of liver disease, and is beneficial to the development of drug for preventing, improving or treating liver disease.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a liver disease treatment gene target and a drug. BACKGROUND

[0002] The liver is the largest internal organ of the human body, is the largest digestive gland in the human digestive system, and is the hub of fat transport. Metabolic processes such as digestion, absorption, decomposition, synthesis and transport of lipids are all carried out in the liver. As an important organ of metabolism, the liver bears extremely important and complex functions. Liver diseases such as fatty liver (including non-alcoholic fatty liver, alcoholic fatty liver), cirrhosis, liver failure, liver cancer, etc. are common and harmful diseases. At the current level of medical treatment, there is no good treatment plan and drug, and the development of liver disease treatment plans is still a problem that people are trying to solve.

[0003] A large number of studies have shown that mitochondrial function is important for liver health. Mitochondria, as intracellular energy metabolism organelles, their dysfunction is associated with a series of liver diseases. For example, non-alcoholic fatty liver disease (NAFLD) is a clinical and pathological syndrome characterized by excessive deposition of fat in liver cells, which is not caused by alcohol and other clear liver damage factors, including simple fatty liver (NAFL), non-alcoholic steatohepatitis (NASH), NASH-related liver fibrosis, etc. NAFLD has become the most common chronic liver disease, with a total prevalence rate of 32.4% worldwide. Studies have shown that liver mitochondrial dysfunction plays an important role, including mitochondrial morphological changes, mitochondrial DNA damage, fatty acid metabolism disorders and energy metabolism abnormalities, oxidative stress, lipid peroxidation and mitochondrial autophagy abnormalities, etc. Therefore, research on liver mitochondria has become a new and important breakthrough in the prevention and treatment of NAFLD.

[0004] For example, Gao Xiaojun (Affiliated Hospital of Guizhou Medical University) reported in 2022 that mitochondrial dysfunction promotes the progression of hepatocellular carcinoma (HCC) and affects the prognosis of tumors. Studies have shown that regulating mitochondrial function is an effective treatment. However, there is currently no mitochondrial-targeted drug for the treatment of HCC.

[0005] Therefore, from the perspective of mitochondrial function, the research on liver disease treatment plans and drugs is an important direction for the development of liver health and treatment of various liver diseases. SUMMARY

[0006] The main purpose of the present application is to develop liver disease prevention and treatment drugs with universal positive significance for liver health and treatment of various liver diseases from the perspective of mitochondrial function research.

[0007] The first object of the present application is to provide the use of Ndufa7 gene as a target in the preparation of drugs for preventing, improving and / or treating liver diseases.

[0008] A second object of the present application is to provide the use of Ndufa7 gene in the preparation of a medicament for preventing, ameliorating and / or treating liver disease.

[0009] A third object of the present application is to provide the use of an expression promoter of Ndufa7 gene in the preparation of a medicament for preventing, ameliorating and / or treating liver disease.

[0010] A fourth object of the present application is to provide the use of an animal model with knocked-out Ndufa7 gene in the screening or evaluation of a medicament for treating liver disease.

[0011] A fifth object of the present application is to provide a medicament containing an expression promoter of Ndufa7 gene.

[0012] A sixth object of the present application is to provide a method for constructing an animal model of liver disease.

[0013] The above objects of the present application are achieved by the following technical solutions.

[0014] The present application finds that inhibition of the expression of Ndufa7 gene will lead to abnormal liver function and damaged liver tissue in mice by detecting the liver function of Ndufa7 knockout mice. The six-item detection of liver function finds that the content of amino acid transferase (ALT, AST) in the serum of Ndufa7 knockout mice is significantly increased. In addition, the present application finds that inhibition of the expression of Ndufa7 gene can induce the occurrence of non-alcoholic fatty liver disease by performing real-time fluorescence quantitative PCR analysis on the liver tissue of Ndufa7 knockout mice, which confirms that Ndufa7 is down-regulated in liver disease.

[0015] The present application further studies the related mechanism, and the results show that the deletion of Ndufa7 gene will lead to abnormal mitochondrial respiratory chain and ATP synthesis, increased oxidative stress, loss of mitochondrial structure integrity and other related mitochondrial function decline, thereby confirming that Ndufa7 gene is closely related to the mitochondrial dysfunction caused by mitochondrial energy metabolism in the pathogenesis of liver disease.

[0016] That is, the present application fully proves that Ndufa7 is involved in the pathogenesis of liver disease, and has important application value in the prevention, improvement or treatment of liver disease and drug development.

[0017] Therefore, in a first aspect, the present application claims the use of Ndufa7 gene as a target in the preparation of a medicament for preventing, ameliorating and / or treating liver disease.

[0018] In a second aspect, the present application claims the use of Ndufa7 gene in the preparation of a medicament for preventing, ameliorating and / or treating liver disease.

[0019] In addition, the present application finds that the survival rate of cells under oleic acid stimulation can be improved by overexpressing the Ndufa7 gene in the cells, and oleic acid is a common reagent for inducing cell models of non-alcoholic fatty liver and the like, that is, overexpression of the Ndufa7 gene can prevent or improve liver diseases, and can be used as a drug for treating liver diseases. Therefore, in a third aspect, the present application claims the use of an expression promoter of the Ndufa7 gene in the preparation of a drug for preventing, improving and / or treating liver diseases.

[0020] Optionally, the expression promoter of the Ndufa7 gene comprises an expression cassette of the Ndufa7 gene or an expression vector containing the Ndufa7 gene.

[0021] Specifically, the liver disease comprises at least one of fatty liver, liver cirrhosis, liver failure, and liver cancer.

[0022] Specifically, the liver disease is a liver disease caused by mitochondrial dysfunction.

[0023] Specifically, the fatty liver is non-alcoholic fatty liver or alcoholic fatty liver.

[0024] Specifically, the non-alcoholic fatty liver comprises non-alcoholic fatty liver caused by a high-fat diet.

[0025] The present application also claims the use of an animal model with a knocked-out Ndufa7 gene in screening or evaluating liver disease treatment drugs.

[0026] The present application also provides a drug containing an expression promoter of the Ndufa7 gene, which can be used as a preventive, improving and / or therapeutic drug for liver diseases.

[0027] Optionally, the expression promoter of the Ndufa7 gene comprises an expression cassette of the Ndufa7 gene or an expression vector containing the Ndufa7 gene.

[0028] Specifically, the liver disease comprises at least one of fatty liver, liver cirrhosis, liver failure, and liver cancer.

[0029] Specifically, the liver disease is a liver disease caused by mitochondrial dysfunction.

[0030] Specifically, the fatty liver is non-alcoholic fatty liver or alcoholic fatty liver.

[0031] Specifically, the non-alcoholic fatty liver comprises non-alcoholic fatty liver caused by a high-fat diet.

[0032] The present application also provides a method for constructing a liver disease animal model, which comprises knocking out or inhibiting the expression of the Ndufa7 gene of an animal used for constructing the model to obtain a liver disease animal model.

[0033] Optionally, the animal is a mouse.

[0034] In a specific embodiment of the present application, the ID of the Ndufa7 gene in the NCBI database is 66416.

[0035] Compared with the prior art, the present application has the following beneficial effects:

[0036] The present application finds, through detection and analysis of the liver function and liver tissue of the Ndufa7 gene knockout mouse, that knocking out the Ndufa7 gene will cause abnormal liver function and liver tissue damage in the mouse, and finds, through real-time quantitative fluorescent PCR, that inhibiting the expression of the Ndufa7 gene can induce the occurrence of non-alcoholic fatty liver disease, and can develop the Ndufa7 gene as a liver disease treatment gene target to develop liver disease treatment drugs. In addition, the present application finds, through overexpression of the Ndufa7 gene in cells, that the survival rate of the cells under oleic acid stimulation can be improved, and oleic acid is a common reagent for inducing non-alcoholic fatty liver cell models, i.e., overexpression of the Ndufa7 gene can prevent or improve liver disease and can be used as a liver disease treatment drug.

[0037] The present application fully proves that Ndufa7 is involved in the occurrence of liver disease, which is beneficial to the development of drugs for preventing, improving or treating liver disease. BRIEF DESCRIPTION OF DRAWINGS

[0038] Figure 1 The table is the mRNA expression level detection result of Mfn1, PPARα, CHOP, NF-κB, Trx1 and Prdx2.

[0039] Figure 2 The table is the calculation result of the liver weight ratio and liver tibia ratio of each model mouse.

[0040] Figure 3 The table is the liver function detection result of each model mouse.

[0041] Figure 4 The table is the liver staining (hematoxylin-eosin (HE) staining, Masson staining, Sirus red staining result and oil red O staining) result and transmission electron microscopy (TEM) graph (0.5K) of each model mouse.

[0042] Figure 5 The table is the statistical result of the degree of liver fibrosis and lipid droplet distribution of the mouse.

[0043] Figure 6 The table is the electron microscopy observation result (7.5K) of the liver mitochondria of each model mouse.

[0044] Figure 7 The table is the effect of overexpression of the Ndufa7 gene on the survival rate of cells stimulated by oleic acid.

[0045] *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. DETAILED DESCRIPTION

[0046] In order to make the objects, technical solutions and effects of the present application clearer and more explicit, the present application is further described below in combination with the drawings and specific examples in the specification, but it should be understood that the specific examples described herein are only used to explain the present application and do not limit the present application.

[0047] The experimental mice used in the embodiments of the present application are 5-month-old C57BL / 6 wild-type mice (WT mice) and 5-month-old Ndufa7 gene knockout mice (KO mice) constructed by CRISPR / Cas9 gene editing technology; the ID of the Ndufa7 gene in the NCBI database (https: / / www.ncbi.nlm.nih.gov) is 66416.

[0048] Example 1: Effect of knocking out Ndufa7 gene and high-fat diet on liver function of mice

[0049] 1. Construction of different diet mouse models

[0050] The present application uses normal diet (ND) and high-fat diet (HFD) to feed WT mice and KO mice respectively, and four kinds of model mice are constructed, which are normal diet model (ND-WT) mice, normal diet model (ND-KO) mice, high-fat diet model (HFD-WT) mice and high-fat diet model (HFD-KO) mice in turn. The nutritional component compositions of the normal diet and the high-fat diet are shown in Table 1 and Table 2 respectively.

[0051] Table 1 Nutritional component composition of normal diet

[0052]

[0053]

[0054] Table 2 Nutritional component composition of high-fat diet

[0055] Component (unit) gm (%) Kcal (%) Protein 26.2 20 Fat 26.3 20 Carbohydrate 34.9 20 Total 60 Total energy (kcal / gm) 5.24

[0056] High-fat modeling for 13 weeks, the mice were weighed at a fixed time every week and the weight change of each group of mice was recorded to evaluate the establishment of the high-fat model.

[0057] 2. Detection of mRNA expression levels of mitochondrial fusion protein Mfn1, ligand-activated transcription factor PPARa, CHOP protein, chronic inflammation molecule NF-kB, Trx1 and Prdx2

[0058] (1) Extraction of mouse liver tissue RNA

[0059] ① Take 10-20 mg of liver tissue sample into a 1.5 mL grinding special Ep tube, add one large and one small grinding magnetic bead, and add 350 μL Buffer RL. Grind in a ball mill, frequency 50 Hz, time 50 s;

[0060] ② Place the lysed sample into a benchtop 4°C centrifuge and centrifuge at 3000 rpm for 30 s, and filter the liquid;

[0061] ③ Transfer the lysate to a new collection tube and centrifuge at 12000 rpm for 10 min in a benchtop 4°C centrifuge;

[0062] ④ Transfer the filtrate to a new collection tube, add 1-fold volume of 50% anhydrous ethanol, and mix well (50% anhydrous ethanol is freshly prepared);

[0063] ⑤ Transfer the filtrate to a new collection tube and centrifuge at 6000 rpm for 45 s in a benchtop 4°C centrifuge, and discard the filtrate;

[0064] ⑥ Add 700 μL Buffer RW1 to the collection tube and centrifuge at 12000 rpm for 30 s, and discard the filtrate;

[0065] ⑦ Add 700 μL Buffer RW2 to the collection tube and centrifuge at 12000 rpm for 30 s, and discard the filtrate;

[0066] ⑧ Add 500 μL Buffer RW2 to the collection tube and centrifuge at 12000 rpm for 2 min. Transfer the adsorption column in the collection tube to a 1.5 mL RNase-free centrifuge tube, and add 80 μL of preheated RNase-free ddH2O dropwise to the adsorption column. After standing at room temperature for 1 min, centrifuge at 12000 rpm for 5 min to elute the RNA.

[0067] (2) Determination of the concentration of the extracted mouse liver tissue RNA

[0068] (3) Reverse transcription

[0069] The extracted mouse liver tissue RNA was reversely transcribed into cDNA, and the specific method was as follows: a reaction solution for removing genomic DNA in the extracted total RNA (not adding 5x HiScript III qRT Super Mix yet) was prepared according to Table 3, and was placed in a PCR instrument for 2 min at 42℃. After the reaction was completed, 4 μL of 5x HiScript III qRT Super Mix was added into the mixed solution, and was mixed and centrifuged briefly, and then was placed in a PCR instrument for reverse transcription, and the reaction condition was 37℃ for 15 min, 85℃ for 5 s. After the reverse transcription was completed, the product could be directly used for RT-PCR.

[0070] Table 3

[0071] Content Volume RNase-free ddH2O To 16 μL 4 x gDNA wiper Mix 4 μL Template RNA Total RNA 2 μg 5 x HiScript III qRT Super Mix 4 μL

[0072] (4) RT-PCR detection

[0073] The sequence of the primer used for RT-PCR detection is shown in Table 4. The RT-PCR result takes GAPDH as an internal reference, and 2 -ΔΔCt The analysis method was used for analyzing the relative expression level of mRNA.

[0074] Table 4 Primer used for RT-PCR detection

[0075] Primer name Sequence (5'-3') GAPDH-Forward ACAGCAACAGGGTGGTGGAC GAPDH-Reverse TTTGAGGGTGCAGCGAACTT Mfn1-Forward ATGTGGACCCCTCCTGATAGT Mfn1-Reverse GCCCAGTGATTTCAGCAAAGG PPARa-Forward CATACTCGCGGGAAAGACCA PPARa-Reverse CGTCTTCTCGGCCATACACA CHOP-Forward TATCTCATCCCCAGGAAACG CHOP-Forward GGGCACTGACCACTCTGTTT NF-κB-Forward ATGGCAGACGATGATCCCTAC NF-κB-Reverse TGTTGACAGTGGTATTTCTGGTG Trx1-Forward CAAGCCCTTCTTCCATTCC Trx1-Reverse GCAACATCCTGGCAGTCAT Prdx2-Forward CACCTGGCGTGGATCAATACC Prdx2-Reverse GACCCCTGTAAGCAATGCCC

[0076] The mRNA expression level detection result of Mfn1, PPARa, CHOP, NF-κB, Trx1 and Prdx2 is shown in Table 5. Figure 1 Figure 1 ​It can be seen that the mRNA level of mitochondrial fusion protein Mfn1 is significantly reduced in ND-KO mice, indicating that mitochondrial fusion is abnormal and the function is out of control in mitochondrial dynamics; PPARa, mainly expressed in fatty acid oxidation organs, is the main regulator of liver beta oxidation, and is used to regulate the metabolic level of lipids. Compared with ND-WT mice, the mRNA expression level of PPARa in ND-KO mice with Ndufa7 gene deletion is significantly reduced, and high-fat diet causes a significant decrease in the liver PPARa level of WT mice, which indicates that Ndufa7 gene deletion and high-fat diet can affect the lipid metabolism level of mouse liver; CHOP is a cell protein mainly involved in regulating cell proliferation and differentiation and energy metabolism, and its mRNA level is also reduced under the induction of Ndufa7 gene deletion or high-fat diet, resulting in reduced cell proliferation and differentiation ability and energy metabolism ability; under the double action of Ndufa7 gene deletion and HFD induction, the mRNA content of chronic inflammatory molecule NF-κB increases, indicating that pro-inflammatory factors are generated; Trx1 is an important regulator of cellular redox homeostasis, which is released by cells under various stress conditions such as oxidative damage, infection or inflammation, and metabolic dysfunction. The mRNA expression level of Trx1 decreases significantly after HFD induction; Prdx2 is abundant in the liver and has the effect of antioxidant and ROS clearance. It has a protective effect on hepatocytes as an intracellular oxidative stress protein. RT-PCR results show that the mRNA expression level of antioxidant protein Prdx2 in the liver of KO mice is significantly reduced.

[0077] 3. Biochemical analysis

[0078] To observe the effect of Ndufa7 gene knockout and high-fat diet on the liver function of mice, the liver and tibia of mice were taken and weighed, and the liver weight ratio and liver tibia ratio of mice were measured and calculated, and serum was taken for liver function test.

[0079] The calculation results of the liver weight ratio and liver tibia ratio of each model mouse are shown in Table 2. Figure 2 As can be seen from Table 2, compared with normal mice, HFD significantly increased the liver tissue weight of mice (P<0.01). Figure 2

[0080] Alanine aminotransferase (ALT), aspartate aminotransferase (AST) and lactate dehydrogenase (LDH) are important markers reflecting whether liver function is damaged, and the degree of liver function damage is positively correlated with the increase of their content; in addition, liver is the site of albumin synthesis, and the increase or decrease of albumin content reflects the health status of liver. The liver function test results of each model mouse are shown in Table 3. Figure 3 Figure 3 ​​As shown in the results, the AST and ALT contents of the ND-KO mice were significantly higher than those of the ND-WT mice (P < 0.01), indicating that the knockout of the Ndufa7 gene would cause a certain degree of damage to the liver function of the mice; under the induction of a high-fat diet, the WT and KO mice showed significant differences in the contents of ALT, AST and LDH (P < 0.01), and the Albumin content of the KO mice was lower than that of the WT mice (P < 0.05).

[0081] In summary, the knockout of the Ndufa7 gene would cause damage to the liver function of the mice, and under the induction of a high-fat diet, the damage might be more serious.

[0082] Example 2 Effect of knockout of the Ndufa7 gene and high-fat diet on the liver tissue of the mice

[0083] 1. Pathological and electron microscopic analysis of the liver tissue of the model mice

[0084] The liver tissues of the model mice were taken for HE, oil red O, Masson and Sirus Red staining, respectively; in the HE dye, hematoxylin staining solution stains the chromatin and nucleus into purple blue, and the eosin staining solution stains the cytoplasm and extracellular matrix into red; oil red O is a very strong fat-soluble and fat-dyeing agent, which is easy to combine with triglycerides into small lipid droplets, and its specific combination with lipids makes the lipid-containing area show red under an optical microscope, realizing the visualization of lipids; after Masson staining, the muscle fibers are red, and the collagen fibers are green or blue; after Sirus red staining, the collagen fibers are dyed red, and the muscle fibers are dyed yellow. In addition, the distribution of lipid droplets in the liver of the mice can be observed and intuitively analyzed under a transmission electron microscope. The degree of liver fibrosis and the distribution of lipid droplets were statistically analyzed in combination with the staining results and the transmission electron microscopy results.

[0085] The liver staining results and transmission electron microscopy images of the model mice are shown in Figure 4 and the statistical results of the degree of liver fibrosis and the distribution of lipid droplets are shown in Figure 5 . Figure 4 The HE staining results in Table 1 show that the morphological structure of the hepatocytes of the ND-WT mice was round, and the nucleus was located in the center of the hepatocytes, while the intercellular space of the hepatocytes of the ND-KO mice was significantly increased. Under the pressure of a high-fat diet, the liver of the HFD-WT and HFD-KO mice showed different degrees of vacuolar degeneration, and the cytoplasm of some hepatocytes of the HFD-KO mice was completely squeezed out by lipid droplets, and the nucleus was also squeezed out. Masson and Sirus red staining can be used to evaluate the degree of liver fibrosis in the mice. Figure 4The results of the staining in the present application show that the KO mice under normal diet conditions have a significantly increased collagen fiber area compared with the WT mice, and the HFD-induced two groups of mice also have a high degree of fibrosis, and the mice of the same type also have a certain degree of difference, especially the Sirus red staining collagen fraction statistics between the two groups of KO mice, which shows that the induction of high-fat diet can aggravate the degree of liver fibrosis caused by Ndufa7 gene knockout. Based on the results of the six liver function tests, the mouse liver was stained with oil red O to observe the lipid accumulation in the mouse liver. From the pathological staining results and the statistical analysis results of the liver lipid droplet ratio, it can be seen that (P<0.05), the induction of high-fat diet makes the liver lipid accumulation of WT mice and KO mice increase significantly, especially the HFD-KO mice have large lipid droplet accumulation. Figure 5

[0086] Transmission electron microscopy (TEM) can observe the morphological structure and changes of organelles in tissues through different magnifications, and can observe the effects of Ndufa7 gene deletion and HFD induction on the liver. Analysis of the proportion of liver lipid droplet area in 4 mouse models found that Ndufa7 gene deletion can cause lipid droplet generation, which may be caused by abnormal energy metabolism caused by mitochondrial gene deletion. In addition, the induction of HFD significantly increased the lipid droplet area of the liver, and under the double pressure of Ndufa7 gene deletion and HFD induction, the proportion of liver lipid droplet area further increased (P<0.001).

[0087] In summary, Ndufa7 gene knockout can lead to liver fibrosis and liver lipid droplet accumulation in mice, and high-fat diet can aggravate this result.

[0088] 2. Liver mitochondrial morphology analysis

[0089] Mitochondria are the energy supply sites in cells, and their morphology is constantly changing, mostly round or oval, sometimes appearing as long lines, with a relatively consistent transverse diameter, but a large variation in length. Mitochondria are closed sac-like organelles surrounded by a double membrane, consisting of an outer membrane, an inner membrane, an outer cavity and an inner cavity. The outer chamber is between the inner and outer membranes of the mitochondria, and the inner membrane folds inward to form mitochondrial cristae, and the intercristae is the inner chamber, which is filled with matrix.

[0090] One liver from each of the four groups of model mice was randomly selected, and the morphological changes of mitochondria were observed under a transmission electron microscope, and the electron micrograph at a magnification of 7.5K is shown in Figure 6 Figure 6 ​​It can be seen that under normal dietary conditions, compared with WT mice, part of the outer membrane of the mitochondria of KO mice is damaged, the mitochondrial cross-section is inconsistent, and the inner chamber is swollen to a certain extent; compared with WT mice, the structure of the liver mitochondria of HFD-WT mice is discontinuous, appears blurred, and the endoplasmic reticulum is expanded to a certain extent; the liver mitochondria of HFD-KO mice appear to be swollen in the inner chamber, resulting in an increase in mitochondrial volume and membrane coating, and in addition, the mitochondrial cristae are significantly reduced or even disappear.

[0091] In summary, the knockout of the Ndufa7 gene affects the morphology of the liver mitochondria of mice to a certain extent, thereby causing damage to the function of the mitochondria. In addition, HFD induction also has a certain degree of impact on the liver mitochondria.

[0092] Oleic acid (OA) can have a series of toxic effects on cells, and OA can be used to treat cells to induce lipid deposition in cells and establish various cell lipid toxicity models, such as treating HepG2 cells (liver) with OA to establish a non-alcoholic fatty liver (NAFLD) cell model. On the basis of the HepG2 cells overexpressing the Ndufa7 gene constructed in this embodiment, the survival rate of the cells overexpressing the Ndufa7 gene under oleic acid treatment was tested.

[0093] The specific process is as follows:

[0094] 1. Construction of recombinant overexpression vector

[0095] Based on the commercially available vector pEGFP-C1, the Ndufa7 gene (ID: 66416) was inserted between the Xho I and BamH I sites in the multiple cloning site, and the recombinant overexpression vector pEGFP-C1-Ndufa7 was constructed.

[0096] 2. Cell culture

[0097] HepG2 cells were cultured in DMEM medium containing 10% fetal bovine serum in a 37°C, 5% CO2 incubator. When the cell confluence reached 70%-80%, the cells were digested with 0.25% trypsin-EDTA, passaged at a ratio of 1:3, and the logarithmic growth phase cells were used for experiments.

[0098] 3. Oleic acid treatment

[0099] After the cells were plated for 18 h, the culture medium was replaced with DMEM medium containing 5% fetal bovine serum and 0.5% fat-free bovine serum albumin, and pEGFP-C1 empty vector and pEGFP-C1-Ndufa7 were transfected into the cells, respectively. The cell line was exposed to 500 μm oleic acid (OA) or BSA (as a control) for 24 h, and the cell survival rate was determined by CCK8, and the experiment was repeated 3 times.

[0100] 4. CCK8 assay for cell viability

[0101] Add 10 μL of CCK8 working solution (the volume ratio of CCK8 reagent stock solution to complete culture medium is 1:9) to each well of a 96-well plate, incubate at 37°C for 45 min, and measure the absorbance at 450 nm using an ELISA reader to calculate the cell viability.

[0102] Cell viability / % = [(Experimental group A - Blank group A) / (Control group A - Blank group A)] × 100%.

[0103] The effect of Ndufa7 gene overexpression on the survival rate of oleic acid-stimulated cells, such as Figure 7 As shown. By Figure 7 It was found that in the experimental group without Ndufa7 overexpression, the survival rate of HepG2 cells significantly decreased after OA stimulation compared to the control group, indicating that OA stimulation caused cytotoxicity. However, after Ndufa7 overexpression, the decrease in cell survival rate was significantly improved under the same OA stimulation. Under the same OA stimulation, the survival rate of Ndufa7-overexpressing cells was significantly higher than that of cells without Ndufa7 overexpression, indicating that Ndufa7 gene overexpression has a protective effect on cells and can alleviate OA-induced cytotoxicity.

[0104] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. Overexpression Ndufa7 The use of gene-based reagents in the preparation of drugs to improve and / or treat liver diseases, characterized in that, The liver disease described is non-alcoholic fatty liver disease.

2. The application according to claim 1, characterized in that, The overexpression Ndufa7 The reagent for gene generation is Ndufa7 Gene expression cassettes or containing Ndufa7 Gene expression vectors.

Citation Information

Patent Citations

  • Compositions and methods of diagnosis and treatment for neurological diseases

    WO2020018461A1

  • Therapy selection and treatment of neurodegenerative disorders

    WO2023097029A1