Molecular marker related to pig internal farrowing litter weight standard deviation and application thereof

Abstract

The invention relates to a molecular marker which is located at the 47023718th basic group from the 5tail end on a No.16 chromosome of a pig reference genome Sscrofa11.1 and is related to a pig internal farrowing litter weight standard deviation. The invention describes a primer pair and a kit for detecting the molecular marker, and application of the primer pair and the kit in identifying the size of the standard deviation of the litter weight in the pig, screening pig varieties or genetic breeding of the pig. The pig internal litter weight standard deviation of the AA genotype individual is 2.79 kg, the pig internal litter weight standard deviation of the GG genotype individual is 4.38 kg, and the AA genotype individual is obviously smaller than the GG type individual, namely, the pig resilience of the AA genotype individual is higher than that of the GG individual. The AA type individuals are selected, and the pigs with small standard deviation of litter weight and high restoring force in the pigs can be obtained. According to the method, the problem of determining the pig resilience in actual production is effectively solved, the breeding cost is reduced, the pig internal litter weight standard deviation is effectively reduced, so that the pig resilience is improved, the method is high in accuracy and low in detection cost, automatic detection can be realized, and the method has very high practical application value in the aspect of pig breeding.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology for pig genetic marker screening, and in particular to a molecular marker related to the standard deviation of pig internal litter weight, a detection primer and an application thereof. Background Art

[0002] The standard deviation of pig litter weight refers to the degree of variation in the litter weight of piglets born from multiple parities of sows. The smaller the standard deviation, the less affected the sow is by the environment and the higher its resilience; the larger the standard deviation, the greater the impact of the environment on the sow and the lower its resilience.

[0003] The issue of animal disease resistance involves many aspects, including genetic factors, environmental factors, disease resilience, and the health of the immune system. In actual production, pig resilience, as a disease resistance trait, is difficult to accurately measure, which makes disease resistance breeding work slow. Resilience refers to the ability of an animal to be minimally affected by disturbances or quickly recover to its state before the disturbance, covering resistance, endurance, etc. In recent years, a large number of studies have reported on the definition and quantification of resilience, providing a basis for its inclusion in breeding goals.

[0004] The pig farming industry is greatly affected by epidemic diseases. If the standard deviation of pig litter weight is evaluated through biotechnology identification and the pig resilience is further evaluated based on the standard deviation, the key SNP sites that affect the standard deviation of pig litter weight can be obtained and added to molecular marker-assisted selection, it can accelerate the genetic improvement of the excellent traits of high resilience in pigs, improve individual stress resistance, and increase economic benefits. Summary of the invention

[0005] In order to overcome the shortcomings of the prior art, the primary purpose of the present invention is to provide a molecular marker related to the standard deviation of litter weight within pigs. The molecular marker is obtained through whole genome association analysis and can significantly affect the size of the standard deviation of litter weight within pigs, thereby further evaluating the level of pig resilience.

[0006] Another object of the present invention is to provide a primer pair for detecting the above-mentioned SNP molecular marker.

[0007] Another object of the present invention is to provide a kit for detecting the above-mentioned SNP molecular markers, wherein the kit comprises the above-mentioned primer pair.

[0008] The fourth object of the present invention is to provide applications of the above-mentioned SNP molecular markers, primer pairs and kits.

[0009] A fifth object of the present invention is to provide a method for screening pig breeds with a small internal litter weight standard deviation.

[0010] The sixth object of the present invention is to provide a method for genetic improvement of pigs.

[0011] The present invention is achieved in that:

[0012] A molecular marker located on chromosome 16 of the pig reference genome Sscrofa11.1 and associated with the standard deviation of pig litter weight, wherein the SNP site of the molecular marker corresponds to the G>A mutation at the 47023718th base from the 5′ end on chromosome 16 of the pig reference genome Sscrofa11.1 in the GenBank database, and the polymorphism of the bases at this site leads to different sizes of the standard deviation of pig litter weight, thereby leading to different levels of pig resilience, wherein when the single nucleotide at the SNP site is A, the standard deviation of pig litter weight is small and the pig resilience is high; when the single nucleotide at the SNP site is G, the standard deviation of pig litter weight is large and the pig resilience is low.

[0013] Preferably, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, wherein M in the sequence is G or A.

[0014] A primer pair for detecting the aforementioned molecular marker comprises an upstream primer U and a downstream primer D, and the nucleic acid sequence thereof is as follows:

[0015] U (upstream primer): 5'-TCCAAAGCCCTCATAAATGG-3' (SEQ ID No. 2); D (downstream primer): 5'-TCCATCCTCACCCTCTTCTG-3' (SEQ ID No. 3).

[0016] A kit for detecting the aforementioned molecular markers, the kit comprising the aforementioned primer pair.

[0017] The aforementioned molecular markers, primer pairs or kits are used in identifying the standard deviation of litter weight within pigs, screening pig breeds with small standard deviation of litter weight within pigs or pig genetic breeding, and the pigs include Landrace pigs and their synthetic strains.

[0018] A method for identifying the standard deviation of pig litter weight, comprising the following steps: detecting the SNP site of the molecular marker described in claim 1 or 2 on pig chromosome 16, and judging the standard deviation of pig litter weight according to the genotype of the SNP site, when the SNP site is the AA genotype, the standard deviation of pig litter weight is smaller than that of the AG genotype; when the SNP site is the AG genotype, the standard deviation of pig litter weight is smaller than that of the GG genotype; the pig with the AA genotype is the pig reference genome Sscrofa11.1. The pig has A at the 47023718th base from the 5′ end on chromosome 16; the pig with the AG genotype is a pig with A and G at the 47023718th base from the 5′ end on chromosome 16 of the pig reference genome Sscrofa11.1; the pig with the GG genotype is a pig with G at the 47023718th base from the 5′ end on chromosome 16 of the pig reference genome Sscrofa11.1; the pig reference genome Sscrofa11.1 is the pig reference genome sequence in the GenBank database.

[0019] A method for screening pig breeds with small internal litter weight standard deviation, comprising the following steps: detecting the SNP site of the aforementioned molecular marker on pig chromosome 16, eliminating individuals whose single nucleotide at the SNP site is G, and retaining individuals whose single nucleotide at the SNP site is A as breeding pigs; the pigs include Landrace pigs and their synthetic lines.

[0020] Preferably, the detection method comprises the following steps: (1) extracting genomic DNA of the pig to be tested; (2) using the aforementioned primer pair or the primer pair in the aforementioned kit as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, performing PCR amplification to obtain a PCR amplification product; (3) sequencing the PCR amplification product to obtain a sequencing result; (4) determining the genotype based on the sequencing result.

[0021] A method for genetic improvement of pigs, comprising the following steps: determining the aforementioned molecular markers of the breeding pigs in a breeding pig core group, and making corresponding selections based on the molecular markers: selecting the breeding pigs of the succession breeding pigs with AA or AG genotype at the 47023718th base from the 5′ end on chromosome 16 of the pig reference genome Sscrofa11.1, and eliminating the breeding pigs with the GG genotype at this point, so as to increase the frequency of the allele A at this site generation by generation, thereby reducing the standard deviation of litter weight within the offspring pigs and improving the resilience of the offspring pigs; the pigs include Landrace pigs and their synthetic lines.

[0022] Application of the aforementioned molecular markers, the aforementioned primer pairs and / or any of the aforementioned methods in pig breeding.

[0023] Compared with the prior art, the present invention has the following advantages and effects:

[0024] The method used in the present invention is to detect the bases of the g.47023718G>A polymorphic site on chromosome 16 of the pig reference genome Sscrofa11.1, to determine the genotype of individual pigs, to select the internal litter weight standard deviation, and to obtain pigs with a smaller internal litter weight standard deviation and higher resilience. The method provided by the present invention can be used for early screening of pigs to be selected, reduce breeding costs, and effectively reduce the pig internal litter weight standard deviation. The method has high accuracy, low detection costs, and can realize automated detection, and has high application value in pig breeding.

[0025] (1) The present invention detected a significant molecular marker on the nucleotide sequence of chromosome 16 of the pig that was associated with the standard deviation of litter weight within the pig through genome-wide association study (GWAS). The present invention established the molecular marker-assisted selection breeding technology, improved the breeding process of Landrace pigs and their synthetic lines with small standard deviation of litter weight within the pig, adapted to market demand, and contributed to increasing sales profits and improving core competitiveness of enterprises.

[0026] (2) The present invention provides a primer pair and a kit for detecting a SNP molecular marker located on chromosome 16 of pigs and related to the standard deviation of litter weight within pigs. Through the primer pair and the kit, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select traits, and the technology can be applied to the genetic improvement of related traits of breeding pigs, thereby improving the excellent qualities of pigs, accelerating the breeding process, and thereby increasing corporate profits and core competitiveness.

[0027] (3) The present invention provides a method for pig breeding by optimizing the dominant allele of the molecular marker, which can accelerate the genetic progress of the pig herd and shorten the time for improving the Landrace pig, thereby effectively improving the economic benefits of breeding. The present invention can ultimately improve the resilience of commercial pigs and increase economic benefits by optimizing the dominant allele A with a small standard deviation of internal litter weight from the SNP molecular marker individuals. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a genome-wide association study (GWAS) analysis of the standard deviation of litter weight in Landrace pigs on chromosome 16;

[0029] Figure 2 This is the standard deviation analysis of litter weight within individual pigs of AA, AG and GG genotypes;

[0030] Figure 3These are the sequencing results of the sequence near the SSC16g.47023718G>A polymorphic site on chromosome 16 of individual pigs with AA, AG and GG genotypes. DETAILED DESCRIPTION

[0031] The present invention is further described in detail below in conjunction with specific embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0032] The pig reference genome sequences in the following embodiments all refer to Sscrofa11.1.

[0033] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0034] Example 1: Evaluating pig resilience by identifying the standard deviation of litter weight within pigs

[0035] 1. Experimental animals and phenotypic records

[0036] The experimental pigs used in the present invention are all from the breeding pig group of Chifeng Jiayu Breeding Technology Co., Ltd.

[0037] A total of 1,807 sows from this group were selected for this experiment. The parity of the pigs in the group was recorded as 1-10, and the litter weight of the piglets at birth for each parity was recorded for all pigs. The standard deviation phenotype of litter weight within the pigs was further calculated by formula 1 to evaluate pig resilience. All phenotypic data were collected in accordance with the data format requirements of the National Swine Genetic Evaluation Center.

[0038] Formula 1: Where n is the total number of pig parity records, x i is the litter weight of pigs at parity i, It is the average litter weight of pigs.

[0039] 2. Chip SNP typing

[0040] Ear samples were taken from 1,807 pigs in the above group, ground with liquid nitrogen, and the whole genome DNA was extracted using the standard phenol-chloroform method. The DNA quality of each sample was accurately measured using the Nanodrop2000 / 2000C nucleic acid protein detector. The qualified DNA samples were sent to Beijing Compson Biotechnology Co., Ltd. for pig whole genome DNA analysis according to the company's standard process. Zhongxin-1Porcine Breeding Chip_V2 (176 heads), Zhongxin-1Porcine BreedingChip_plus (1017 pigs) and CAU50K (614 pigs) chip genotype determination. PLINK software was used to merge and quality control the chip data of all samples, and finally 46358 SNP valid genotype data were obtained. These genotype data can be used for genome-wide association analysis of standard deviation of litter weight within pigs.

[0041] 3. Genome-wide association analysis

[0042] The standard deviation of litter weight within the pigs was corrected according to the farm and batch, and then the breeding value was estimated by ASReml. The association analysis between SNPs and breeding values ​​was performed using GCTA software. The significance threshold for the association between SNPs and breeding values ​​was 1.0786×10 -6 GWAS analysis results are as follows Figure 1 As shown. Figure 1 It can be seen that there is a locus on chromosome 16 that significantly affects the standard deviation of pig litter weight. The SNP locus g.47023718G>A is significantly correlated with the standard deviation of pig litter weight (P<2.94×10 -7 ).from Figure 2 It can be seen that the phenotypes of different genotypes in the group are significantly different. The standard deviation of piglet uniformity within the AA individual pig is significantly lower than that of the GG individual (P<0.05), and the standard deviation of piglet uniformity within the heterozygous AG type individual pig is between the two pure and type individuals. The larger the standard deviation of piglet uniformity within the pig, the lower the individual resilience, and vice versa. The above shows that this molecular marker significantly affects the resilience of pigs, and it can be used for marker-assisted selection to improve the resilience of pigs in this group, thereby accelerating the breeding process of resilience traits.

[0043] 4. Determination of the polymorphism of the porcine SNP site g.47023718G>A

[0044] (1) Three pig ear samples were used as experimental materials, and genomic DNA was extracted from each of them.

[0045] (2) Primer design and synthesis

[0046] According to the pig reference genome Sscrofa11.1 sequence, the following primers were designed and synthesized:

[0047] U (upstream primer): 5′-TCCAAAGCCCTCATAAATGG-3′ (SEQ ID No. 2);

[0048] D (downstream primer): 5'-TCCATCCTCACCCTCTTCTG-3' (SEQ ID No. 3).

[0049] (3) PCR amplification

[0050] The three pig genomic DNAs obtained in step (1) were used as templates and U and D were used as primers to perform PCR amplification to obtain PCR amplification products, which were named products 1, 2 and 3, respectively.

[0051] PCR amplification system: 100 ng genomic DNA, 25 μL Green Taq Mix, 200 nm upstream and downstream primers, and ddH2O was used to make up the system to 50 μL.

[0052] PCR amplification program: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 62°C for 15 seconds, extension at 72°C for 60 seconds, for a total of 35 cycles; and final extension at 72°C for 5 minutes.

[0053] Sequencing and sequence analysis

[0054] Products 1, 2, and 3 were sequenced to obtain the sequences of products 1, 2, and 3. The three product sequences differed by only one base, which was a G>A mutation at position 106 from the 5' end of the three sequences. Figure 3 Indicated by the arrow in the middle. This site is the 47023718th base from the 5′ end on chromosome 16 of the pig reference genome Sscrofa11.1, so the site is named SSC16 g.47023718G>A. Sequencing Below is the primer amplification sequence, the 106th base is M, M can be G or A, SEQ ID No.1:

[0055] TCCAAAGCCCTCATAAATGGTGGGTAAGCCAATATTTATGTCAAAGATTGGGGAAAGTGG

[0056] CATAGCCAGACCACATAAATTTCAAAGGAAAAGAGACTTTTGCATMAGGGTCCAAGAGA

[0057] AATGGTTTAGTGGGACATGAAGAAACACAAACGCCTCCCTTGGCCCAGGGATGTGTAGAA

[0058] TATGAAAGAATGAGCCTCCTTTCCTCCAAAGGGCCACTGAGGAAGCAGGTCCTAAGGAGG

[0059] AATGCATTCAGTGAGAGCTAGGGGGTGAAAAGAAGGTTTTTAAGAAGTTTAAGATATA

[0060] GAAGAGATCATTTAAAATAGAATGAGGTACGGAGGATGCAGAAGAGGGTGAGGATGGA

[0061] The individual whose base at the 47023718th position from the 5' end on chromosome 16 of the pig reference genome Sscrofa11.1 or the base at the 106th position from the 5' end of the PCR amplification product obtained in step (3) is G is a homozygous individual, and the genotype of this individual is named GG. The individual whose base at the 47023718th position from the 5' end on chromosome 16 of the pig reference genome Sscrofa11.1 or the base at the 106th position from the 5' end of the PCR amplification product obtained in step (3) is A is a homozygous individual, and the genotype of this individual is named AA. The individual whose base at the 47023718th position from the 5' end on chromosome 16 of the pig reference genome Sscrofa11.1 or the base at the 106th position from the 5' end of the PCR amplification product obtained in step (3) is G and A is a heterozygous individual, and the genotype of this individual is named GA.

[0062] The present invention provides a SNP molecular marker that can significantly reduce the standard deviation of pig litter weight. Using the SNP molecular marker for marker-assisted selection can greatly accelerate the breeding process of Landrace pigs with high resilience. The standard deviation of pig litter weight within the AA type individual is 2.79kg, and the standard deviation of pig litter weight within the GG individual is 4.38kg. The AA type individual is significantly smaller than the GG type individual. If the present invention selects all GG type individuals into AA type individuals, the resilience of the pig herd will be significantly improved, and the potential for economic benefits of a large-scale pig farm with 10,000 heads is huge. Among the individuals of this SNP molecular marker, by optimizing the dominant allele A of the SNP, it is possible to ultimately achieve the improvement of the economic benefits of commercial pigs, thereby increasing the profits of the enterprise.

[0063] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A molecular marker located on chromosome 16 of the porcine reference genome Sscrofa11.1 and associated with the standard deviation of litter weight within pigs, characterized in that: The SNP site of the molecular marker corresponds to the G>A mutation at the 47023718th base from the 5′ end on chromosome 16 of the pig reference genome Sscrofa11.1 in the GenBank database. The polymorphism of the bases at this site leads to different standard deviations of pig litter weights and different levels of pig resilience. When the single nucleotide at the SNP site is A, the standard deviation of pig litter weights is small and the pig resilience is high; when the single nucleotide at the SNP site is G, the standard deviation of pig litter weights is large and the pig resilience is low.

2. The molecular marker according to claim 1, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein M in the sequence is G or A.

3. A primer pair for detecting the aforementioned molecular marker, characterized in that: It contains upstream primer U and downstream primer D, and its nucleic acid sequence is as follows: U (upstream primer): 5′-TCCAAAGCCCTCATAAATGG-3′ (SEQ ID No. 2); D (downstream primer): 5'-TCCATCCTCACCCTCTTCTG-3' (SEQ ID No. 3).

4. A kit for detecting the molecular marker according to claim 1 or 2, characterized in that: The kit comprises the primer pair according to claim 3.

5. Use of the molecular markers of claim 1 or 2, the primer pairs of claim 3 or the kit of claim 4 in identifying the standard deviation of litter weight within pigs, screening pig breeds with small standard deviation of litter weight within pigs or pig genetic breeding, wherein the pigs include Landrace pigs and their synthetic strains.

6. A method for determining the standard deviation of litter weight within pigs, characterized in that: The method comprises the following steps: detecting the SNP site of the molecular marker of claim 1 or 2 on chromosome 16 of pigs, and judging the standard deviation of pig litter weight according to the genotype of the SNP site, wherein when the SNP site is the AA genotype, the standard deviation of pig litter weight is smaller than that of the AG genotype; when the SNP site is the AG genotype, the standard deviation of pig litter weight is smaller than that of the GG genotype; The AA genotype pig is a pig whose base 47023718 from the 5′ end on chromosome 16 of the pig reference genome Sscrofa11.1 is A; The pig of the AG genotype is a pig whose base 47023718 from the 5′ end on chromosome 16 of the pig reference genome Sscrofa11.1 is A and G; The pig with the GG genotype is a pig whose base 47023718 from the 5′ end on chromosome 16 of the pig reference genome Sscrofa11.1 is G; The pig reference genome Sscrofa11.1 is the pig reference genome sequence in the GenBank database.

7. A method for selecting pig breeds with small internal litter weight standard deviation, characterized in that: The following steps are involved: The SNP sites of the aforementioned molecular markers on pig chromosome 16 are detected, individuals whose single nucleotide at the SNP site is G are eliminated, and individuals whose single nucleotide at the SNP site is A are retained as breeding pigs; the pigs include Landrace pigs and their synthetic lines.

8. The method according to claim 7, characterized in that The detection method comprises the following steps: (1) Extracting genomic DNA from the pig to be tested; (2) using the primer pair described in claim 3 or the primer pair in the kit described in claim 4 as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, to perform PCR amplification to obtain a PCR amplification product; (3) sequencing the PCR amplification product to obtain sequencing results; (4) Determine the genotype based on the sequencing results.

9. A method for genetic improvement of pigs, comprising the following steps: Determine the molecular markers of claim 1 or 2 of the breeding pigs in the breeding pig core group, and make corresponding selections based on the molecular markers: for the breeding pig succession selection, select the breeding pigs with AA or AG genotype at the 47023718th base from the 5′ end on chromosome 16 of the pig reference genome Sscrofa11.1, and eliminate the breeding pigs with GG genotype at this point, so as to increase the frequency of allele A at this site from generation to generation, thereby reducing the standard deviation of litter weight within the offspring pigs and improving the resilience of the offspring pigs; the pigs include Landrace pigs and their synthetic lines.

10. Use of the molecular marker according to claim 1 or 2, the primer pair according to claim 3 or 4 and / or the method according to any one of claims 4 to 9 in pig breeding.

Images