Method for qualitatively detecting safflower component in honey by using real-time fluorescent PCR (Polymerase Chain Reaction)

Abstract

The invention provides a method for qualitatively detecting a safflower component in honey by using real-time fluorescent PCR (Polymerase Chain Reaction). The method comprises the following steps: extracting DNA (Deoxyribose Nucleic Acid) in a honey sample; designing and synthesizing a primer and a probe sequence of a safflower specific gene; and carrying out real-time fluorescent PCR reaction, and reading and analyzing a fluorescent signal so as to judge whether the honey sample contains the safflower component or not. The real-time fluorescence PCR method can be used for effectively detecting the safflower specific gene segment in the honey sample, the specificity is good, the detection limit is 1%, and the method is suitable for qualitative detection of the safflower component in the honey.

Description

Technical Field

[0001] The invention belongs to the field of molecular biological detection, and in particular relates to a method for qualitatively detecting safflower components in honey by utilizing real-time fluorescent PCR. Background Art

[0002] Safflower (Carthamus tinctorius L.), also known as red and blue flower and thorny safflower, is a medicinal plant of the genus Safflower in the Asteraceae family. It is mainly produced in Xinjiang Uygur Autonomous Region, Tibet Autonomous Region, Sichuan, Hunan, Henan and other places in China, and is widely planted in Central Asia. Safflower has been used in traditional Chinese medicine since ancient times. In Chinese medicine classics such as "Tang Materia Medica", "Kaibao Materia Medica", "Leigong Paoyao Yaoxingjie", and "Jingui Yaolue", safflower is pungent and warm in nature, and has the effects of promoting blood circulation, dredge menstruation, dispersing blood stasis and relieving pain. A large number of studies have found that safflower is rich in flavonoids, fatty acids, phenolic acids, volatile oils, terpenes and other active ingredients, and has pharmacological effects such as antioxidant, anti-myocardial ischemia, anti-coagulation, and anti-inflammatory.

[0003] Safflower grows best in dry and warm climates. Xinjiang Uygur Autonomous Region has become the main safflower production area in my country due to its unique geographical environment and climate advantages, with the planting area and output accounting for about 80% of the country. The safflower planting areas in Xinjiang Uygur Autonomous Region are mainly concentrated in Yumin County, Tacheng, Yili Prefecture, and Qitai County and Jimusar County in Changji Prefecture in the northwest, with a planting area of ​​10,000 hectares and an annual output of about 40 tons of safflower honey. It has become an important local specialty honey variety with great development and utilization value. In addition, the safflower honey exported to my country by major safflower honey producing countries such as Kyrgyzstan through the economic belt is also increasing year by year.

[0004] Safflower honey is a natural sweet substance that bees collect safflower nectar, combine with their own secretions, store in the honeycomb, and fully brew. In addition to the functions of ordinary honey, safflower honey also contains a variety of safflower medicinal ingredients, which have health functions such as softening blood vessels, promoting blood circulation and removing blood stasis, improving blood circulation, and regulating endocrine disorders. It is a rare variety of honey and is expensive.

[0005] Consumers' pursuit of safflower honey has stimulated illegal counterfeiting. It is difficult to distinguish the authenticity of safflower honey products on the market, which not only seriously interferes with the fair trade of honey products and damages the healthy development of the honey industry, but also poses a safety hazard to consumers. my country's current industry standard "SN / T 4848-2017 Detection method of common nectar plant components in exported honey - real-time fluorescence PCR method" does not have a detection method for safflower honey.

[0006] In order to ensure the quality and safety of Western Region specialty honey and maintain fair trade in imported honey in the economic zone, a real-time fluorescence PCR qualitative detection method for safflower components in honey was established. This can be used to qualitatively detect whether honey contains safflower components, providing an accurate and reliable technical basis for the authenticity identification of safflower honey. Summary of the invention

[0007] The purpose of the present invention is to provide a method for qualitatively detecting safflower components in honey with high specificity and effective use of real-time fluorescence PCR in view of the above shortcomings and deficiencies to be solved.

[0008] The purpose of the present invention is achieved through the following technical solutions:

[0009] A method for qualitatively detecting safflower components in honey using real-time fluorescence PCR, comprising the following steps:

[0010] (1) Extract DNA from honey samples;

[0011] (2) Design and synthesize primers and probe sequences for safflower-specific genes;

[0012] (3) Perform real-time fluorescence PCR reaction, read and analyze the fluorescence signal, and thus determine whether the honey sample contains safflower components.

[0013] Preferably, the safflower-specific gene is anthocyanidin synthase gene.

[0014] Preferably, the upstream primer of the safflower-specific gene has a nucleotide sequence as shown in SEQ ID NO.4, the downstream primer has a nucleotide sequence as shown in SEQ ID NO.5, and the probe sequence has a nucleotide sequence as shown in SEQ ID NO.6.

[0015] Preferably, the PCR reaction system is 25 μL, including: 12.5 μL of 2× real-time fluorescence PCR premix, 1 μL of upstream and downstream primers and probes at a concentration of 12.5 pmol / μL, 5 μL of DNA template, and ddH2O to make up the volume.

[0016] Preferably, the real-time fluorescence PCR reaction conditions are: 50°C for 2 min; pre-denaturation at 95°C for 10 min; 95°C for 15 s, 60°C for 1 min, and 45 cycles.

[0017] Preferably, the detection limit of the safflower component in honey by the method is 1%.

[0018] Preferably, in the method, the internal reference gene is tRNALeu.

[0019] Preferably, in the method, the determination rule is as follows: if the Ct value ≤ 35.0, the tested sample is determined to be positive; if the Ct value ≥ 40.0, the tested sample is determined to be negative; if 35.0 < Ct value < 40.0, repeat once; if the Ct value is still < 40.0 after the second amplification, the tested sample is determined to be positive; if the Ct value ≥ 40.0 after the second amplification, the tested sample is determined to be negative.

[0020] The present invention can effectively detect the safflower specific gene fragment in honey samples by real-time fluorescence PCR method, with good specificity and no cross-reaction with other plant components; the detection limit is 1%, meeting the technical requirements; it is applicable to the qualitative detection of safflower components in honey. This method can provide technical support for the authenticity identification of safflower components in honey. Description of the Drawings

[0021] Figure 1 It is a graph showing the results of the screening experiment of safflower specific primer-probe.

[0022] Figure 2 It is a graph showing the results of the specificity verification experiment.

[0023] Figure 3 It is a graph showing the results of the optimization experiment of primer-probe concentration.

[0024] Figure 4 It is a graph showing the results of the detection limit verification experiment.

[0025] Figure 5 It is a graph showing the results of the stability verification experiment of 10% safflower honey.

[0026] Figure 6 It is a graph showing the results of the stability verification experiment of 5% safflower honey.

[0027] Figure 7 It is a graph showing the results of the stability verification experiment of 1% safflower honey.

[0028] Figure 8 It is a graph showing the results of the internal reference gene selection experiment of honey sample No. 1.

[0029] Fig. 9 It is a graph showing the results of the internal reference gene selection experiment of honey sample No. 2.

[0030] Fig.10 It is a graph showing the results of the internal reference gene selection experiment of honey sample No. 3.

[0031] Fig.11 It is a graph showing the results of the internal reference gene selection experiment of honey sample No. 4.

[0032] Fig.12 It is a graph showing the results of the internal reference gene selection experiment of honey sample No. 5.

[0033] Fig.13 This is the result of the internal reference gene selection experiment for honey sample No. 6.

[0034] Fig.14 This is the result of the internal reference gene selection experiment for honey sample No. 7.

[0035] Fig.15 This is the result of the internal reference gene selection experiment for honey sample No. 8.

[0036] Fig.16 This is the result of the internal reference gene selection experiment for honey sample No. 9.

[0037] Fig.17 This is the result of the internal reference gene selection experiment for honey sample No. 10.

[0038] Fig.18 These are the results of a comparative experiment on DNA extraction methods. DETAILED DESCRIPTION

[0039] The present invention is further described in detail below in conjunction with specific embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0040] 1. Materials

[0041] 1.1 Experimental Materials

[0042] Nectar plants and Asteraceae medicinal plants such as litchi, longan, julibrissin, honeysuckle, gardenia, sophora japonica, zelan, chrysanthemum, lotus seed, carrot, motherwort, burdock, dandelion, nepeta, coltsfoot, atractylodes, atractylodes, artemisia annua, osmanthus, corn, lavender, safflower were purchased from local supermarkets and e-commerce platforms. Seven samples of safflower honey were produced in many places in Xinjiang Uygur Autonomous Region, Yunnan and Kyrgyzstan, and 16 samples of other honey varieties sold in Xinjiang Uygur Autonomous Region were purchased.

[0043] 1.2 Main Reagents

[0044] Quick Gene DNA tissue kit S (KURABO, Japan), TaqMan TM Fast Advanced Master Mix (Thermo Fisher Scientific, USA), primers and probes (Shanghai Shanjing Molecular Biotechnology Co., Ltd.), Promega Genomic DNA purification kit (Cat. No.: A1120), Plant genomic DNA extraction kit (Cat. No.: DP305), Reagent MagDEADNA200GC (Cat. No.: E7001), QuickGene DNA tissue kit S (Cat. No.: DT-S), Honey DNA Extraction Kit (Cat. No.: HDEB100).

[0045] 1.3 Main instruments and equipment

[0046] ABI 7900HT real-time fluorescence PCR instrument (Thermo Fisher Scientific, USA), Nanospec micro-nucleic acid protein analyzer (Shimadzu, Japan), Centrifuge 5424 small high-speed centrifuge (Eppendorf, Germany), Tube-Mill Control test tube mill (IKA, Germany), MS2 vortex mixer (IKA, Germany), AB204-S METLER TOLEDO electronic balance (Teller, Switzerland).

[0047] 2. Determination of DNA Extraction Concentration and Purity

[0048] The above-mentioned nectar plants such as safflower and medicinal plants of Asteraceae were homogenized with a test tube grinder, and then the DNA of the test samples was extracted according to the steps of the DNA extraction kit (Quick Gene DNA tissue kit S). The DNA concentration was determined using a micro nucleic acid protein analyzer, and the DNA was diluted to 20 ng / μL and placed at 4°C for use.

[0049] 3. Real-time fluorescence PCR primer and probe design

[0050] Three safflower-specific genes were selected, and their nucleotide sequences are as follows:

[0051] Accession No. KP300881.1, Carthamus tinctorius anthocyanidin synthase (SEQ ID NO. 1)

[0052] TAGATGATGGATCCAAAGGGAATATATGTTGGGGGTTCACTCCCGGTTCCTAGTGTACAAGAATTGGCTAAGGAATCGCCGAGAGAGGTTCCACCACGATATATACGTCCAGATCAAGATGCTCCAGT CATATCATCGTTGTCTCAAGTACCAATAATCAATATGGAGTATTTATCGTCAAAAAGCTCCGAGCTAGAGAAACTACACCTTGCTTGTAAAGATTGGGGTTTTTCCAGTTGATAAATCATGGGGTGAG

[0053] Accession No. HQ831357.1, Carthamus tinctorius plastid oleate dehydrogenase FAD6 (SEQ ID NO. 2)

[0054] CTCTCTACAGGGGTTTGCTGAATTTGCTCCTTTTCTTCTCCTTCCAATGGCTTGCAGACTCGCAGATTCTAGTTTCCTTTTGAAGGGTCCCCAACAAAAGCCATTGCATGGGTATAGATTTGGGTCACTCTATCCAGCAGGCACATCTTTTTGAAGTGGGATATTCTACCTAAATGTAGAACCAAACATCAAACATATGTAGTTCCTTTGAGAAGGACTAAAATAGTACAAGCAGTGACTAGTTCTGTTACAGCAC

[0055] Accession No. KP300884.1, safflower flavonol synthase (SEQ ID NO. 3)

[0056] GTTCCGGTGATCGATCTCAGCCTCCCGGATGCCGAAAAGCTGGTAGCCTCCATCTCAGAAGCCAGCAAAGAATGGGGCATCTTTCAAGTGGTAAACCATGGGATACCAAGTGAACTCATAAGCAGGTTACAGAAAGTTGGAAGAGAGTTCTTTGAGTTGCCACTAGAAGAGAAGGAAACCATAGCCAAGCCTGCAAATATGAAAGATGGTATTGAAGG

[0057] Three sets of PCR primers and probe sequences were designed according to the safflower-specific gene sequences (Table 1).

[0058] Table 1. Primer and probe sequence information

[0059]

[0060] 4. Real-time fluorescence PCR reaction

[0061] Using 100% safflower DNA as a positive control, 2 PCR parallels were set up for the screening of primers and probes. Real-time fluorescence PCR reaction system (25 μL): 12.5 μL of 2× real-time fluorescence PCR premix, 1 μL each of upstream and downstream primers (10 pmol / μL) and probe (10 pmol / μL), 5 μL of DNA template (50 ng - 500 ng), and the volume was made up with ddH2O. The PCR reaction conditions were: 50°C for 2 min; pre-denaturation at 95°C for 10 min; 95°C for 15 s, 60°C for 1 min, for 45 cycles.

[0062] Judgment rule: If the Ct value ≤ 35.0, it is judged that the tested sample is positive; if the Ct value ≥ 40.0, it is judged that the tested sample is negative; if 35.0 < Ct value < 40.0, repeat once; if the Ct value is still < 40.0 after re-amplification, it is judged that the tested sample is positive; if the Ct value ≥ 40.0 after re-amplification, it is judged that the tested sample is negative.

[0063] 5. Primer-probe specificity experiment

[0064] To evaluate the specificity of this method, genomic DNA of 21 samples of common nectariferous plants and Compositae medicinal plants was extracted respectively, and real-time fluorescence PCR detection was carried out using the first set of primer-probe AS in Table 1, with 2 PCR parallels set up.

[0065] 6. Optimization of primer-probe concentration

[0066] To optimize the PCR reaction system, the final concentrations of primers and probes in the PCR reaction system were set as F / R / P (upstream primer / downstream primer / probe) (nmol / L): 100 / 100 / 100, 100 / 100 / 50, 200 / 200 / 200, 200 / 200 / 100, 300 / 300 / 300, 300 / 300 / 150, 400 / 400 / 400, 400 / 400 / 200, 500 / 500 / 500, 500 / 500 / 250, 600 / 600 / 600, 600 / 600 / 300, a total of 12 combinations. PCR detection was carried out on safflower DNA, with 2 PCR parallels set up.

[0067] 7. Detection limit verification

[0068] To evaluate the limit of detection (LOD) of this method, samples of safflower honey and lavender honey were taken and mixed by mass percentage to form gradient concentration samples with safflower honey contents of 10%, 5%, 1%, 0.5%, 0.1%, 0.05% and 0.01% (mass percentage) respectively. 3 parallels were set up for PCR detection to verify the detection limit.

[0069] 8. Stability experiment

[0070] In order to evaluate the stability of this method, 10 parallel PCR tests were performed on safflower honey samples with mass percentages of 10%, 5% and 1%, respectively.

[0071] 9. Selection of internal reference genes

[0072] Priority is given to the internal reference genes of nectar plants in the current standard methods, and the NADH gene in "SN / T 4848.1-2017 Detection method of common nectar plant ingredients in exported honey-Real-time fluorescence PCR method Part 1: Vitex" and the tRNALeu gene in "SN / T1202-2010 Qualitative PCR detection method for genetically modified plant ingredients in food" are selected as candidate genes for verification experiments.

[0073] Ten honey samples of different varieties and origins were selected, and honey DNA was extracted according to this method. PCR detection was performed according to the NADH gene in "SN / T 4848.1-2017 Detection method of common nectar-producing plant components in exported honey - Real-time fluorescence PCR method - Part 1: Vitex" and the tRNALeu detection method in "SN / T 1202-2010 Qualitative PCR detection method for genetically modified plant components in food" respectively.

[0074] 10. Comparison of DNA extraction methods for honey samples

[0075] In order to better enrich, extract and purify the nectar plant DNA in honey samples, this method was compared with the DNA extraction methods based on "SN / T4848.1-2017 Detection method of common nectar plant components in exported honey - Real-time fluorescence PCR method - Part 1: Vitex negundo".

[0076] Sample No. 1 (RFY safflower honey) in Table 3 was selected and DNA was extracted using 7 different methods. The 7 methods were: according to 8.1.1 "DNA extraction from honey precipitate" (CTAB method) in SN / T 4848.1; according to 8.1.2 "DNA extraction from honey supernatant" (Promega magnetic bead kit) in SN / T 4848.1; and 5 commercial kits were used to extract DNA from the centrifugal precipitate of the honey sample obtained in 8.1.1.3 in SN / T 4848.1: Genomic DNA purification kit (Cat. No.: A1120), Plant genomic DNA extraction kit (Cat. No.: DP305), ReagentMagDEA DNA 200GC (Cat. No.: E7001), QuickGene DNA tissue kit S (Cat. No.: DT-S), Honey DNA Extraction Kit (Cat. No.: HDEB100). Determine the DNA concentration, perform PCR detection of the internal reference gene tRNALeu on the DNA to compare the DNA extraction methods, and set up 2 parallels.

[0077] 11. Actual sample verification experiment

[0078] This method was used to collect 7 commercial samples of safflower honey, which originated from many places in Xinjiang Uygur Autonomous Region, Yunnan and Kyrgyzstan. This method was also used to collect 16 commercial samples of other types of honey sold in Xinjiang Uygur Autonomous Region. These actual samples were used for verification experiments according to this method.

[0079] 12. Results of real-time fluorescence PCR detection of safflower components in honey

[0080] 12.1 Primer and probe selection and specificity experimental results

[0081] The real-time fluorescence PCR results of the three sets of primers and probes in Table 1 are shown in Figure 1 , A, B, and C are the PCR experimental results of the first, second, and third sets of primers and probes, respectively. Figure 1 It can be seen that the first and second sets of primer probes both showed amplification, with average Ct values ​​of 26 and 31, respectively, and the third set of primer probes did not show fluorescence amplification. Therefore, the first set of primer probes (AS) was selected for the next step of research.

[0082] The specificity test results are shown in Table 2 and Figure 2 From Table 2 and Figure 2 It can be seen that the AS primer probe can only amplify the safflower gene, with an average Ct value of 26, and there is no cross reaction to the other 21 common nectar plants and Compositae medicinal plants.

[0083] Table 2. Specificity verification experiment results

[0084]

[0085]

[0086] 12.2 Optimization results of primer and probe concentrations

[0087] The optimization results of primer and probe concentrations are shown in Figure 3 .

[0088] Depend on Figure 3 It can be seen that when the final concentration of primers and probes in the PCR reaction system is 500nmol / L, the average Ct value is 24, the Ct value is the smallest and the fluorescence signal value is the highest. Therefore, the final concentration of primers and probes in the PCR reaction system of this method is determined to be 500nmol / L.

[0089] 12.3 Detection limit verification test results

[0090] The results of the detection limit verification experiment are shown in Figure 4 .

[0091] The results showed that this method can stably detect safflower honey samples with a mass percentage of 10%, 5% and 1%, but cannot detect safflower honey samples with a mass percentage of 0.5% and 0.1%. Therefore, the detection limit of safflower components in safflower honey by this method is set at 1% (mass percentage).

[0092] 12.4 Stability Verification Experiment Results

[0093] The stability verification test results are shown in Figure 5 , Figure 6 and Figure 7 .

[0094] The results showed that this method could stably detect safflower honey samples with concentrations of 10%, 5% and 1% (mass percentage).

[0095] 12.5 Results of selection of internal reference genes

[0096] The experimental results of internal reference gene selection are shown in Tables 3 and Figures 8 to 17 From the experimental results, we can see that the PCR detection of 10 honey sample DNAs using NADH and tRNALeu was positive. By comparing the Ct value, the smoothness of the PCR fluorescence amplification curve and the repeatability of two parallels, we can see that tRNALeu performed better.

[0097] Therefore, tRNALeu was selected as the internal reference gene.

[0098] Table 3. Results of the internal reference gene selection experiment

[0099]

[0100]

[0101] 12.6 Comparison of DNA extraction methods for honey samples

[0102] The experimental results of the comparison of DNA extraction methods are shown in Tables 4 and Fig.18. The experimental results showed that the DNA obtained according to the method 8.1.2 of SN / T 4848.1-2017 was the least, and the Ct value of the internal reference gene tRNALeu detection result was the largest. The DNA concentrations extracted by the other 6 methods were all greater than 20ng / μL, and the Ct values ​​were between 23 and 27. Therefore, this method uses 8.1.1 of SN / T4848.1-2017 for honey sample pretreatment and stipulates that only the precipitate is taken for the next step of DNA extraction. DNA extraction can be carried out by CTAB method, or a variety of equivalent commercial kits can be used.

[0103] Table 4. DNA extraction method comparison experimental results

[0104]

[0105] 12.7 Actual Sample Verification

[0106] The test results of actual sample verification are shown in Tables 5 and 6. The experimental results show that tRNALeu can be detected in 7 safflower honeys and 16 other varieties of honey products, indicating that this method can effectively extract genomic DNA of nectar plants in honey; safflower components (AS) were detected in 7 safflower honey samples, and safflower components were not detected in 16 other varieties of honey samples, indicating that this method can effectively identify safflower components in honey, providing a technical basis for the authenticity identification of safflower honey.

[0107] Table 5. Results of actual sample verification experiment (safflower honey commercial sample)

[0108]

[0109]

[0110] Table 6. Results of actual sample verification experiments (commercial samples of other types of honey)

[0111]

Claims

1. A method for qualitatively detecting safflower components in honey using real-time fluorescence PCR, characterized in that It includes the following steps: (1) Extract DNA from the honey sample; (2) Design and synthesize primer and probe sequences for the safflower specific gene; (3) Perform real-time fluorescence PCR reaction, read and analyze the fluorescence signal, so as to determine whether the honey sample contains safflower components.

2. The method according to claim 1, characterized in that The safflower specific gene is the anthocyanin synthase gene.

3. The method according to claim 1, characterized in that The upstream primer of the safflower specific gene has the nucleotide sequence shown in SEQ ID NO.4, the downstream primer has the nucleotide sequence shown in SEQ ID NO.5, and the probe sequence has the nucleotide sequence shown in SEQ ID NO.

6.

4. The method according to claim 1, characterized in that The PCR reaction system is 25 μL, including: 12.5 μL of 2× real-time fluorescence PCR premix, 1 μL each of the upstream and downstream primers and probes with a concentration of 12.5 pmol / μL, 5 μL of DNA template, and the volume is made up with ddH2O.

5. The method according to claim 1, characterized in that The conditions of the real-time fluorescence PCR reaction are: 50°C for 2 min; pre-denaturation at 95°C for 10 min; 95°C for 15 s, 60°C for 1 min, for 45 cycles.

6. The method according to claim 1, characterized in that The detection limit of the method for safflower components in honey is 1%.

7. The method according to claim 1, characterized in that In the method, the internal reference gene is tRNALeu.

8. The method according to claim 1, characterized in that In the method, the determination rule is: if the Ct value ≤ 35.0, it is determined that the tested sample is positive; if the Ct value ≥ 40.0, it is determined that the tested sample is negative; if 35.0 < Ct value < 40.0, repeat once; if the Ct value is still < 40.0 after re-amplification, it is determined that the tested sample is positive; if the Ct value ≥ 40.0 after re-amplification, it is determined that the tested sample is negative.

Images