DNA barcoding primers, kits, methods, and applications for rapid identification of Lactobacillus plantarum strains

Abstract

This invention relates to a rapid identification method Lactobacillus plantarum The method for identifying strains, belonging to the field of species and strain identification, is based on the differences in three DNA barcode sequences. Lactobacillus plantarum CGMCC NO: 26171 strain from Lactobacillusplantarum This method allows for rapid identification from other strains of the same species. Compared to traditional morphological identification methods, the standard gene sequence obtained is beneficial for the molecular identification of *Lactobacillus plantarum* strains, effectively shortening the identification time. Three pairs of DNA barcoding primers enable specific amplification of the test strain, allowing for rapid identification. Lactobacillus plantarum strains.

Description

Technical Field

[0001] This invention relates to the field of species and strain identification, specifically to a rapid identification method. Lactobacillus plantarum DNA barcoding primers, kits, methods, and applications for strains. Background Technology

[0002] Soybeans are a popular traditional food in my country, with a protein content as high as 35% to 40%, equivalent to 3 to 6 times that of rice and wheat flour. The protein content of 7 kg of soybeans is equivalent to that of 2 kg of lean meat, 3 kg of eggs, and 12 kg of milk. Compared to animal protein, soy protein is relatively inexpensive, making it an ideal ingredient for creating a variety of palatable protein foods. Furthermore, because it is lactose-free, soy products are considered a potential alternative to dairy products, especially suitable for lactose-free individuals and those with lactose intolerance. Soybeans not only serve as a high-quality protein source but also offer benefits such as lowering cholesterol, improving blood sugar control, providing antioxidant effects, and supplementing estrogen. With increasing living standards and health awareness, soybeans are becoming increasingly popular, and the growing market demand is driving the development of the soybean industry and promoting economic growth in many regions.

[0003] Nutritional value is a key quality standard that must be considered when developing healthy and green foods. Fermentation is considered a reasonable strategy to improve the nutritional and sensory characteristics of soy products. During fermentation, macromolecules (such as proteins, carbohydrates, and lipids) are broken down by microbial enzymes into peptides, amino acids, sugars, and fatty acids, thereby improving the digestibility and absorption of soy products. This significantly alters the nutritional composition of soy products; fermentation results in higher nutritional value. α After microbial fermentation with galactosidase activity, the amount of oligosaccharides (such as raffinose and stachyose), which are major flatulence factors, in soy products is significantly reduced, while the bioavailability of calcium, iron, zinc, and magnesium increases by 30-50%, which is especially beneficial for vegetarians to supplement minerals. Moreover, fermentation has the unique advantage of improving the flavor, taste, and texture of soy products, removing the unpleasant beany smell, and increasing satiety.

[0004] Lactic acid bacteria fermented soy protein combines the nutritional value of soybeans with the health benefits of probiotics, forming a unique "dual health matrix." The fermentation process requires... Lactobacillus plantarum The fermentation process involves the action of various microorganisms, among which strain CGMCC NO: 26171 is a key strain. Summary of the Invention

[0005] To overcome the problems existing in the background art, the present invention discloses a rapid identification method. Lactobacillus plantarum A method for strains, said method being able to, based on the sequence differences of three DNA fragments, Lactobacillus plantarumCGMCC NO: 26171 strain from Lactobacillus plantarum This method allows for rapid identification from other strains of the same species. Compared to traditional morphological identification methods, the standard gene sequence obtained is beneficial for the molecular identification of *Lactobacillus plantarum* strains, effectively shortening the identification time. Three pairs of DNA barcoding primers enable specific amplification of the test strain, allowing for rapid identification. Lactobacillus plantarum strain. Overcame Lactobacillus plantarum Overcoming the shortcomings of traditional morphological identification of different strains within a species, this method is characterized by its universality, ease of amplification, and ease of comparison. Its identification reliability and accuracy are also greatly improved, providing a reliable method for the rapid identification of key strains for soybean fermentation. It also provides powerful technical means and research tools for the controllable fermentation process protection and the exploration, protection, and utilization of strain resources in the soybean food fermentation industry.

[0006] To achieve the above objectives, the present invention is implemented through the following technical solution:

[0007] The rapid identification Lactobacillus plantarum The DNA barcoding primer sequences for the strain are M.LpnPI, OAT, and GDPD; these three primer pairs specifically amplify the test strain and can be used for identification. Lactobacillus plantarum The strain; the DNA barcoding primer sequences M.LpnPI, OAT, and GDPD amplified the DNA barcoding sequences SEQ ID No. 1–3; SEQ ID No. 1–3 include:

[0008] The primer sequence of the first primer pair is M.LpnPI:

[0009] Forward primer, M.LpnPI-F: 5'-GGAGTTACCGATAATAGTTGGG-3',

[0010] Reverse primer, M.LpnPI-R: 5'-GCTTCACTGATCCGTTGTTC-3';

[0011] One of the DNA barcode sequences, SEQ ID No. 1, was obtained by PCR amplification, with a fragment size of 611 bp:

[0012] GGAGTTACCGATAATAGTTGGGATAGTGTAATACATTTGATCAATTGTGGCAGCAGTATAGAAGAATCATTAAGACAGGCTCAGCAATTGTACTTTTTGCTACAGAACCATTTGCGAGCAAATTGCGTTTATCGAATTGTGAAGAGTATAA GTACGATTGGATCTGGAATAAGAAAAAAGGTGGCAATATTTTTAATCTAAAACGGCAACCATATAAGATACATGAAAACATTCTGGTATTCCATGCAACGGAAAACGCTTATCATCCAATAATGATTCCACAAAAAGAACGTACTGGAAAAAT TTATTCTCAAACTGACAATTTTAAAGCACCAAAGTATCGGGATACGAGAACTTACAAGTTTAAGAATCCTCAATCCATATTGACTTTTAGCAATGCTAATCAGCATAAAGTTCATCCAACCCAAAAGCCAGTTGACTTACTAGAGTATCTAAT CAAAACTTACACCAATGAAAATGAAACCGTACTTGATAATTGCATGGGTTCAGGAAGTACTGGCGTGGCTGCTGTCAATCTAAACAGATCATTCATTGGTATGGAGTTGGATTGCGATTATTTCAAGATTGCAGAACAACGGATCAGTGAAGC

[0013] Second primer pair primer sequence OAT:

[0014] Forward primer, OAT-F: 5'-CATACAAACCATTTGGTTCCGT-3',

[0015] Reverse primer, OAT-R: 5'-TAGAGATGGCTGTCAACGTCGA -3';

[0016] One of the DNA barcode sequences, SEQ ID No. 2, was obtained by PCR amplification, with a fragment size of 429 bp:

[0017] CATACAAACCATTTGGGTTCCGTACTCTTTGTAACTACAGCACCCGCTCCTATTACACAGCCTTTTTTTATTGTTACACCAGGTAATACAGTTACGTTTGCTCCTAACCAGCTTCCGTCTTCAATTTTAACATTTTGATAAATCCCCTCACCGGCCCTAGCATTCCGTTGACCAATCTTATGCGTGATTCCCAATATAGTAGAATTGGGTCCAAT TTGAACCTTATTGCCAATAAATATTTTTGCATTTCCTGCGCCACAAATTATCGAGGTACCAACATTTAGGACACATGAATTACCGATAGTTATTGCTGATTGATCCATGTATACATGCAGAGCAATTATTACCTTATCACCAATTTTAATCCCAGTTCTTCTAAGTAGTTTAACCTTGGTTTTACTTCGCAAATTCGACGTTGACAGCCATCTTA

[0018] The third primer pair primer sequence is GDPD:

[0019] Forward primer, GDPD-F: 5'-GTCATAATTGCGCTAACACCAAG-3',

[0020] Reverse primer, GDPD-R: 5'-GATAACAAACCGGCCATAATC-3';

[0021] One of the DNA barcode sequences, SEQ ID No. 3, was obtained by PCR amplification, with a fragment size of 1379 bp:

[0022]

[0023] The three primer pairs enable specific amplification of the test strain, allowing for rapid identification. Lactobacillus plantarum strains.

[0024] As a preferred option: the Lactobacillus plantarum The strain is a soybean protein fermentation microorganism with the biological preservation number: CGMCC NO: 26171.

[0025] Preferably, the DNA barcoding primer composition is added to the kit, which is used to identify soybean protein fermentation microorganisms. Lactobacillus plantarum strains.

[0026] Preferably, the DNA barcoding primer pair is used. Lactobacillus plantarum The method for molecular identification of strains includes the following steps:

[0027] (1) Genomic DNA was isolated and extracted from the tissue sample to be tested;

[0028] (2) Using the genomic DNA extracted in step (1) as a template, polymerase chain reaction amplification was performed using DNA barcode primers M.LpnPI, OAT, and GDPD, respectively;

[0029] (3) Perform gel electrophoresis analysis and sequencing on the DNA products amplified in step (2);

[0030] (4) Compare the sequencing results with the reference sequence in the NCBI database. If the sequence homology is greater than 99%, the sample to be tested can be determined to be a soybean protein fermentation microorganism. Lactobacillus plantarum strains.

[0031] Preferably: the DNA barcode primer pair Lactobacillus plantarum The conditions for polymerase chain reaction amplification of DNA barcoding primers M.LpnPI, OAT, and GDPD in step (2) of the method for molecular identification of the strain are as follows:

[0032] M.LpnPI: Pre-denaturation at 95℃ for 2 min, followed by denaturation at 95℃ for 45 s, annealing at 52℃ for 45 s, extension at 72℃ for 1 min, for a total of 25 cycles, and finally extension at 72℃ for 5 min.

[0033] OAT: 95℃ pre-denaturation for 2 min, followed by 95℃ denaturation for 45 s, 62℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 25 cycles, and finally 72℃ extension for 5 min.

[0034] GDPD: Pre-denaturation at 95℃ for 2 min, followed by denaturation at 95℃ for 45 s, annealing at 62℃ for 30 s, extension at 72℃ for 1 min 30 s, for a total of 25 cycles, and finally extension at 72℃ for 5 min.

[0035] Preferably, the lengths of the DNA barcode standard sequences SEQ ID No. 1 to 3 are 611bp, 429bp, and 1379bp, respectively.

[0036] The beneficial effects of this invention are:

[0037] 1. This invention preferentially selects three specific DNA barcode fragments, SEQ ID No. 1-3, as the identification strains for soybean protein fermentation production. Lactobacillus plantarum These three DNA sequences, compared to other DNA sequences, are characterized by high specificity, ease of amplification, and ease of comparison.

[0038] 2. This invention establishes a strain for the industrial fermentation production of soybean protein. Lactobacillus plantarum This method, which utilizes specific DNA barcoding sequences and sample identification techniques, significantly improves identification accuracy compared to traditional morphological identification methods and 16S rRNA sequence identification methods. It has lower requirements for bacterial strains, and the identification indicators can be quantified, which is crucial for timely determination. Lactobacillus plantarum It provides an accurate and effective method, increasing the specificity and accuracy of identification. Attached Figure Description

[0039] Figure 1 The image shows an electrophoresis result of amplification using the DNA barcoding primers M.LpnPI designed in this invention, where the marker is 2000 bp.

[0040] In the diagram, 1 represents... Lactobacillus plantarum CGMCC NO: 26171 strain; 2 is Chuxin yogurt sample; 3 is Zhadian charcoal-roasted yogurt sample; 4 is Jian'ai yogurt sample; 5 is Eurasia yogurt sample; 6 is Zhadian organic yogurt sample; 7 is Bright Dairy Changyou yogurt sample. Samples 2-7 all contained... Lactobacillus plantarum Strains. Amplification electrophoresis results showed that only sample 1 had a strain at the 611bp position. Lactobacillus plantarum CGMCC NO: 26171 strain amplification result was positive, while other samples 2-7 amplification results were negative.

[0041] Figure 2 Electrophoresis image of DNA barcoding primer OAT amplified using the method designed in this invention, where the marker is 2000 bp;

[0042] In the diagram, 1 represents... Lactobacillus plantarumCGMCC NO: 26171 strain; 2 is Chuxin yogurt sample; 3 is Zhadian charcoal-roasted yogurt sample; 4 is Jian'ai yogurt sample; 5 is Eurasia yogurt sample; 6 is Zhadian organic yogurt sample; 7 is Bright Dairy Changyou yogurt sample. Samples 2-7 all contained... Lactobacillus plantarum strains.

[0043] The amplification electrophoresis results showed that only sample 1 was present at the 429bp position. Lactobacillus plantarum CGMCC NO: 26171 strain amplification result was positive, while other samples 2-7 amplification results were negative.

[0044] Figure 3 Electrophoresis image of GDPD amplification using the DNA barcoding primers designed in this invention, where the marker is 2000 bp;

[0045] In the diagram, 1 represents... Lactobacillus plantarum CGMCC NO: 26171 strain; 2 is Chuxin yogurt sample; 3 is Zhadian charcoal-roasted yogurt sample; 4 is Jian'ai yogurt sample; 5 is Eurasia yogurt sample; 6 is Zhadian organic yogurt sample; 7 is Bright Dairy Changyou yogurt sample. Samples 2-7 all contained... Lactobacillus plantarum Strains. Amplification electrophoresis results showed that only sample 1 had a strain at the 1379bp position. Lactobacillus plantarum The amplification result of the strain was positive, while the amplification results of other samples 2-7 were negative. Detailed Implementation

[0046] To make the above objectives, technical solutions, and beneficial effects clearer and more explicit, the present invention will be described in detail below with reference to the accompanying drawings and embodiments.

[0047] Example:

[0048] 1. Microorganisms for soybean protein fermentation Lactobacillus plantarum The strain, with accession number CGMCC NO: 26171, is similar to those available on the market. Lactobacillus plantarum Gene sequence amplification was performed on six lactic acid bacteria strains used in the fermentation of yogurt.

[0049] Based on PCR amplification using three pairs of DNA barcode sequence primers M.LpnPI, OAT, and GDPD, the homology of the obtained PCR sequences with the three DNA barcode sequences SEQ ID Nos. 1–3 was compared to determine whether the test strain was [specifically, a specific type of DNA barcode sequence]. Lactobacillus plantarum strain;

[0050] Table 1 shows the amplification results of seven samples using three different primer pairs and the homology comparison results with three DNA barcode sequences in the ncbi database.

[0051] Table 1. Sample strain information and PCR amplification comparison results:

[0052]

[0053] Based on the sequencing results, if the sequence homology is greater than 99%, the strain can be identified as [a specific strain]. Lactobacillus plantarum strains.

[0054] 2. Extract DNA from strains separately: using Chelex... Ⓡ Genomic DNA was extracted by lysis at 100°C, and the DNA concentration of the sample was diluted to 0.5 μg / μL with sterile deionized water.

[0055] 3. Amplify the DNA fragment and perform a polymerase chain reaction (PCR). The three primer sequences used are as follows:

[0056] The primer sequence of this invention is M.LpnPI.

[0057] Forward primer, M.LpnPI-F: 5'-GGAGTTACCGATAATAGTTGGG-3',

[0058] Reverse primer, M.LpnPI-R: 5'-GCTTCACTGATCCGTTGTTC-3';

[0059] Primer sequence OAT,

[0060] Forward primer, OAT-F: 5'-CATACAAACCATTTGGTTCCGT-3',

[0061] Reverse primer, OAT-R: 5'-TAGAGATGGCTGTCAACGTCGA -3';

[0062] Primer sequence GDPD,

[0063] Forward primer, GDPD-F: 5'-GTCATAATTGCGCTAACACCAAG-3',

[0064] Reverse primer, GDPD-R: 5'-GATAACAAACCGGCCATAATC-3';

[0065] The PCR reaction system consisted of 20 μL: 10 μL 2×Taq PCR Master Mix, 7 μL ddH2O, 1 μL forward primer, 1 μL reverse primer, and 1 μL DNA template, without dye; the amplification conditions were as follows:

[0066] SEQ ID No.1: Pre-denaturation at 95℃ for 2 min, followed by denaturation at 95℃ for 45 s, annealing at 52℃ for 45 s, extension at 72℃ for 1 min, for a total of 25 cycles, and finally extension at 72℃ for 5 min;

[0067] SEQ ID No. 2: Pre-denaturation at 95℃ for 2 min, followed by denaturation at 95℃ for 45 s, annealing at 62℃ for 30 s, extension at 72℃ for 30 s, for a total of 25 cycles, and finally extension at 72℃ for 5 min;

[0068] SEQ ID No. 3: Pre-denaturation at 95℃ for 2 min, followed by denaturation at 95℃ for 45 s, annealing at 62℃ for 30 s, extension at 72℃ for 1 min 30 s, for a total of 25 cycles, and finally extension at 72℃ for 5 min.

[0069] 4. Detection of amplification products: Electrophoresis was performed on a 1.0% agarose gel in 1×TAE buffer. The PCR fragment size was detected using a DNA marker. If the tested strain did not show an amplification band, it indicates that the strain is not... Lactobacillus plantarum If clear and distinct bands are observed without any extraneous bands, the sample should be sent to a biological sequencing company for DNA fragment sequencing.

[0070] 5. First, use Chrgmas Lite software to check the quality of the sequence peaks obtained after sequencing. After confirming that the peak quality meets the requirements for data analysis, use the CAP3 assembly tool built into UGENE to assemble the forward and reverse sequences. Manually proofread and assemble the sequencing results. If the three DNA fragment sequences are respectively... Lactobacillus plantarum By comparing the three DNA barcode sequences SEQ ID Nos. 1 to 3, and finding that the homology is above 99%, it can be determined that the sample to be tested is or contains [the specific DNA sequence]. Lactobacillus plantarum strains.

[0071] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.

Claims

1. A DNA barcode primer for rapid identification of bacterial strains, characterized in that, Lactobacillus plantarum The DNA barcoding primer consists of M.LpnPI, OAT, and GDPD; the sequence of the DNA barcoding primer M.LpnPI is as follows: ​ Forward primer, M.LpnPI-F: 5'-GGAGTTACCGATAATAGTTGGG-3', reverse primer, M.LpnPI-R: 5'-GCTTCACTGATCCGTTGTTC-3'; The sequence of the DNA barcode primer OAT is as follows: forward primer, OAT-F: 5'-CATACAAACCATTTGGTTCCGT-3', reverse primer, OAT-R: 5'-TAGATGGCTGTCAACGTCGA-3'; The sequence of the DNA barcoding primer GDPD is as follows: forward primer, GDPD-F: 5'-GTCATAATTGCGCTAACACCAAG-3', reverse primer, GDPD-R: 5'-GATAACAAACCGGCCATAATC-3'; The Lactobacillus plantarum The strain is a soybean protein fermentation microorganism, and the biological preservation number is CGMCC NO: 26171.

2. A rapid identification method according to claim 1 Lactobacillus plantarum DNA barcoding primers for the strain, characterized by: using the DNA barcode primer pair Lactobacillus plantarum The method of molecular identification of a strain comprises the following steps: (1) Isolate and extract genomic DNA from the sample tissue; (2) Using the genomic DNA extracted in step (1) as a template, polymerase chain reaction amplification was performed using DNA barcode primers M.LpnPI, OAT and GDPD respectively; (3) Perform gel electrophoresis analysis and sequencing on the DNA products amplified in step (2); (4) Compare the sequencing results of the DNA product amplified by DNA barcoding primer M.LpnPI with SEQ ID No.1, compare the sequencing results of the DNA product amplified by DNA barcoding primer OAT with SEQ ID No.2, and compare the sequencing results of the DNA product amplified by DNA barcoding primer GDPD with SEQ ID No.

3. If the sequence homology is greater than 99%, the sample to be tested can be determined to be a soybean protein fermentation microorganism. Lactobacillus plantarum strain, the Lactobacillus plantarum The strain has the biological accession number CGMCC NO: 26171.

3. A rapid identification method according to claim 2 Lactobacillus plantarum DNA barcoding primers for the strain, characterized by: The DNA barcode primer pair Lactobacillus plantarum The amplification conditions for polymerase chain reaction of DNA barcoding primers M.LpnPI, OAT, and GDPD in step (2) of the method for molecular identification of the strain are as follows: M.LpnPI: Pre-denaturation at 95℃ for 2 min; followed by denaturation at 95℃ for 45 s, annealing at 52℃ for 45 s, extension at 72℃ for 1 min, for a total of 25 cycles; finally, extension at 72℃ for 5 min. OAT: 95℃ pre-denaturation for 2 min; followed by 95℃ denaturation for 45 s, 62℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 25 cycles; finally, 72℃ extension for 5 min. GDPD: 95℃ pre-denaturation for 2 min; followed by 95℃ denaturation for 45 s, 62℃ annealing for 30 s, and 72℃ extension for 1 min 30 s; a total of 25 cycles, and finally 72℃ extension for 5 min.

4. A method for identifying microorganisms involved in soybean protein fermentation. Lactobacillus plantarum The reagent kit for the strain is characterized by, The kit contains the DNA barcoding primers as described in claim 1. Lactobacillus plantarum The strain has the biological accession number CGMCC NO: 26171.

Images