InDel marker primer set and application in 'THI-P-10×P5114' variety and purity identification

Abstract

This invention relates to the field of chili pepper molecular markers, disclosing an InDel marker primer set and its application in the identification of the 'THI-P-10×P5114' variety and purity. This invention utilizes resequencing data from the maternal parent THI-P-10 and paternal parent P5114 of the chili pepper variety 'THI-P-10×P5114' to screen for differentially expressed InDel sites across the entire genome, and designs specific primers, resulting in eight pairs of InDel marker primers. Based on PCR amplification, these eight pairs of InDel molecular marker primers can rapidly and accurately identify the purity of the chili pepper variety 'THI-P-10×P5114' and hybrid seeds within 2 hours. This method requires a small sample volume, has a short cycle time, is simple to operate, has high accuracy, low cost, and high repeatability and stability. It solves the problems of long cycle time, high labor input, and inaccurate identification in the purity identification of the chili pepper variety or seeds of 'THI-P-10×P5114', and has extremely high commercial application prospects.

Description

Technical Field

[0001] This invention relates to the field of molecular markers for chili peppers, specifically to the InDel-labeled primer set and its application in the identification of the THI-P-10×P5114 variety and purity. Background Technology

[0002] Chili peppers belong to the genus Capsicum in the family Solanaceae. They are annual or short-lived perennial herbaceous plants. Originating in the tropical and subtropical regions of Central and South America, they possess abundant genetic resources. Chili peppers are not only highly nutritious and have high nutritional value, but also possess significant medicinal value, making them a food and medicine of the same origin, and thus widely loved. Chili peppers are my country's largest vegetable crop, with an annual planting area of ​​32 million mu (approximately 2.8 million hectares) and an output value exceeding 250 billion yuan. Developing the chili pepper industry has become an effective way to increase agricultural efficiency and farmers' income across my country.

[0003] With the increasing number of chili pepper varieties, their genetic differences are becoming smaller, making effective differentiation difficult. Traditional methods for identifying the purity of chili pepper varieties or hybrid seeds mainly rely on morphological markers. However, this method has many drawbacks, including high workload, long cycle time, and unstable phenotypic observation. Moreover, morphological marker identification methods require highly skilled personnel who are very familiar with the phenotypic differences between varieties and their parents, and it is difficult to eliminate the influence of environmental and human factors. Therefore, it is necessary to establish a rapid identification method based on genotype.

[0004] With the development of sequencing technology and molecular biology, the application of molecular markers to identify varieties or variety purity is becoming increasingly widespread. Insertion-deletion length polymorphism (InDel) markers are length polymorphism variations resulting from the insertion or deletion of a certain number of nucleotides at allele loci, belonging to the third generation of molecular markers. InDel markers are abundant and genetically stable, and have been widely used in genetic linkage map construction, gene mapping, and purity identification, overcoming the uncertainty of identifying new varieties based solely on morphological characteristics.

[0005] The chili pepper variety 'THI-P-10×P5114' is a high-yield, high-quality hybrid chili pepper bred by the Institute of Economic Crops, Hubei Academy of Agricultural Sciences. It is a mid-maturing variety with strong plant growth and fruit setting ability. The fruit is long and horn-shaped with straight segments. Green fruits are dark green, while red fruits are bright red. The fruit surface is relatively smooth, with two locules. The flesh is crisp and spicy. The fruit has a longitudinal diameter of 22-24 cm, a transverse diameter of 1.8 cm, a flesh thickness of 0.15 cm, and a single fruit weight of about 18 g. The yield is over 3000 kg per mu.

[0006] 'THI-P-10×P5114' is a first-generation hybrid, obtained by emasculating the female parent THI-P-10 flower and then pollinating it with pollen from the male parent P5114. However, if the female parent THI-P-10 flower is not completely emasculated or is omitted, false hybrids will be produced, which will seriously affect the purity of 'THI-P-10×P5114' seed production.

[0007] To date, there are no suitable molecular markers or identification methods for the chili pepper variety 'THI-P-10×P5114'. Developing molecular identification markers suitable for the chili pepper variety 'THI-P-10×P5114' would be beneficial for ensuring the purity of chili pepper seed production, strengthening market supervision, and enhancing intellectual property protection. Summary of the Invention

[0008] This invention provides an InDel-labeled primer set and its application in the identification of the THI-P-10×P5114 variety and purity, effectively solving the problems existing in the current work of detecting the authenticity or seed purity of the chili variety 'THI-P-10×P5114'.

[0009] To achieve the above objectives, the present invention employs the following technical solution:

[0010] The InDel-labeled primer set consists of 8 pairs of primers:

[0011] The primers for the molecular marker InDel-PepChr01-1 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.1 and downstream primer as shown in SEQ ID NO.2.

[0012] The primers for the molecular marker InDel-Chr04-1 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.3 and downstream primer as shown in SEQ ID NO.4.

[0013] The primers for the molecular marker InDel-PepChr04-4 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.5 and downstream primer as shown in SEQ ID NO.6.

[0014] The primers for the molecular marker InDel-Chr08-1 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.7 and downstream primer as shown in SEQ ID NO.8.

[0015] The primers for the molecular marker InDel-PepChr10-5 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.9 and downstream primer as shown in SEQ ID NO.10.

[0016] The primers for the molecular marker InDel-PepChr11-3 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.11 and downstream primer as shown in SEQ ID NO.12.

[0017] The primers for the molecular marker InDel-Chr12-2 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.13 and downstream primer as shown in SEQ ID NO.14.

[0018] The primers for the molecular marker InDel-Chr12-3 have the upstream primer nucleotide sequence shown in SEQ ID NO.15 and the downstream primer nucleotide sequence shown in SEQ ID NO.16.

[0019] Application of InDel marker primer set in identifying the authenticity of chili pepper variety 'THI-P-10×P5114'.

[0020] Application of InDel-labeled primer set in identifying the purity of pepper 'THI-P-10×P5114' seeds.

[0021] The method for identifying the authenticity or seed purity of the chili pepper variety 'THI-P-10×P5114' includes the following steps:

[0022] (1) Extract genomic DNA from seed samples of the pepper variety to be tested;

[0023] (2) Using the extracted genomic DNA of the sample as a template, PCR amplification systems were established using the above 8 pairs of primers as forward and reverse primers, and PCR amplification was performed respectively.

[0024] (3) The amplification products were detected by agarose gel electrophoresis;

[0025] (4) If the band pattern of each of the 8 amplification products simultaneously has the band pattern of both the maternal parent THI-P-10 and the paternal parent P5114 of the chili hybrid 'THI-P-10×P5114', then the chili variety to be tested is the chili hybrid 'THI-P-10×P5114'; if the band pattern of any of the 8 amplification products does not simultaneously have the band pattern of both the maternal parent THI-P-10 and the paternal parent P5114 of the chili hybrid 'THI-P-10×P5114', then the chili variety to be tested is not the chili hybrid 'THI-P-10×P5114'.

[0026] (5) Calculate the seed purity according to the seed purity formula.

[0027] As a preferred embodiment of the above scheme, in step (1), when identifying the authenticity of the chili pepper variety 'THI-P-10×P5114', genomic DNA is extracted from seed samples of similar chili pepper varieties to be tested; when identifying the purity of chili pepper 'THI-P-10×P5114' seeds, genomic DNA is extracted from seed samples of chili pepper 'THI-P-10×P5114' varieties to be tested.

[0028] As a preferred embodiment of the above scheme, in step (1), the genomic DNA of the chili seeds to be tested is extracted using the modified CTAB method.

[0029] As a preferred embodiment of the above scheme, in step (2), the PCR amplification system is: 5 μL of 2×Magic Green Taq SuperMix, 1.0 μL each of 10 μM forward and reverse primers, 10 ng-100 ng of DNA template, and ddH2O added to 10 μL.

[0030] The PCR amplification program was as follows: 95℃ for 3 min; 95℃ for 15 s, 52℃ for 15 s, 72℃ for 35 s, for 35 cycles; 72℃ for 10 min.

[0031] As a preferred embodiment of the above scheme, in step (3), the electrophoresis detection includes: using a 3% agarose gel, electrophoresis on a 3% agarose gel for 35 minutes at a constant voltage of 150V / cM, and then taking a photograph using a gel imaging system.

[0032] As a preferred embodiment of the above scheme, in step (4), the molecular marker InDel-PepChr01-1 amplifies one characteristic band in both the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 146bp and 180bp respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The molecular marker InDel-Chr04-1 amplifies one characteristic band in each of the 'THI-P-10×P5114' varieties. One characteristic band was amplified in the 14' maternal parent THI-P-10 and the paternal parent P5114, with band sizes of 172bp and 141bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The molecular marker InDel-PepChr04-4 amplified one characteristic band in both the maternal parent THI-P-10 and the paternal parent P5114. The band sizes were 141bp and 172bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The molecular marker InDel-Chr08-1 amplified one characteristic band each in the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 174bp and 151bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The 'THI-P-10×P5114' variety possesses two characteristic bands from the maternal parent THI-P-10 and the paternal parent P5114. The molecular marker InDel-PepChr10-5 amplifies one characteristic band each in the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 120bp and 154bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114'.Molecular marker InDel-PepChr11-3 amplified one characteristic band each in the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 140bp and 177bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. Molecular marker InDel-Chr12-2 amplified one characteristic band each in the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 140bp and 177bp, respectively. The bands 44bp and 166bp indicate that the 'THI-P-10×P5114' variety possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The molecular marker InDel-Chr12-3 amplified one characteristic band each in both the maternal parent THI-P-10 and the paternal parent P5114, with band sizes of 181bp and 153bp respectively. Therefore, the 'THI-P-10×P5114' variety possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114.

[0033] As a preferred embodiment of the above scheme, in step (5), the seed purity = the number of the number of bands of the 8 amplification products detected that simultaneously have the bands of the female parent THI-P-10 and the male parent P5114 of the chili hybrid 'THI-P-10×P5114' / the total number of seeds detected × 100%.

[0034] Due to the above structure, the beneficial effects of the present invention are as follows:

[0035] 1. This invention utilizes resequencing data from the maternal parent THI-P-10 and paternal parent P5114 of the chili variety 'THI-P-10×P5114' to screen for differentially expressed InDel sites across the entire genome and design specific primers, achieving high accuracy and stable, reliable results.

[0036] 2. This invention utilizes agarose gel electrophoresis for detection, which has advantages such as simple operation, fast speed, low cost, and high safety compared to polyacrylamide gel electrophoresis.

[0037] 3. This invention, based on PCR amplification, utilizes InDel molecular markers at eight loci to rapidly and accurately identify the authenticity of the chili variety 'THI-P-10×P5114' or the purity of hybrid seeds within a short time. The method is simple, fast, has a short detection cycle, and saves costs, showing great promise for application and promotion. Using these eight InDel molecular markers facilitates standardized, large-scale, and rapid identification of the authenticity or seed purity of the chili variety 'THI-P-10×P5114'. Attached Figure Description

[0038] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below.

[0039] Figure 1 Agarose gel electrophoresis image of PCR amplification products of 8 primer pairs for the female parent THI-P-10, the male parent P5114, and the chili variety 'THI-P-10×P5114'; M in the image is the marker, and lanes 1, 2, and 3 are respectively 5 seeds from each of the female parent THI-P-10, the male parent P5114, and the chili variety 'THI-P-10×P5114'.

[0040] Figure 2Electrophoresis results of the chili pepper variety 'THI-P-10×P5114' were obtained using primers InDel-PepChr01-1, InDel-Chr04-1, InDel-PepChr04-4, InDel-Chr08-1, InDel-PepChr10-5, InDel-PepChr11-3, InDel-Chr12-2, and InDel-Chr12-3, respectively. In the figure, M represents the marker, and lanes 01-19 represent the maternal parent THI-P-10 of 'THI-P-10×P5114' and the paternal parent P of the chili pepper hybrid 'THI-P-10×P5114'. 5114, samples of the following varieties: 'THI-P-10×P5114', THI-P-10 (the female parent of the chili hybrid 'THI-P-10×P5114B'), TP023-PM-1 (the male parent of the chili hybrid 'THI-P-10×P5114B'), 'THI-P-10×P5114B', '8819 Line Pepper A', 'Erjintiao', 'Zhaibubai Green Line Pepper', 'Xiangla Erjintiao', 'Hongtianxia·Line Pepper F1', 'Xiangla No. 6', 'Lahuangfei No. 1', '8819 Line Pepper B', 'Haoji Changxian', 'Heilong Green Line Pepper', 'Shenhe Xiangla Line Pepper', 'Line Pepper Xiangchu Mojin', and 'Chuanjiao No. 19';

[0041] Figure 3 The image shows partial electrophoresis results for detecting the seed purity of chili pepper variety 'THI-P-10×P5114' using primers InDel-PepChr01-1. In the image, M is the marker, lane 01 is the female parent THI-P-10 of chili pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of chili pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested.

[0042] Figure 4 The image shows partial electrophoresis results for detecting the seed purity of chili pepper variety 'THI-P-10×P5114' using primer InDel-Chr04-1. In the image, M is the marker, lane 01 is the female parent THI-P-10 of chili pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of chili pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested.

[0043] Figure 5The image shows partial electrophoresis results for detecting the seed purity of chili pepper variety 'THI-P-10×P5114' using primers InDel-PepChr04-4. In the image, M is the marker, lane 01 is the female parent THI-P-10 of chili pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of chili pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested.

[0044] Figure 6 The image shows partial electrophoresis results for detecting the seed purity of chili pepper variety 'THI-P-10×P5114' using primer InDel-Chr08-1. In the image, M is the marker, lane 01 is the female parent THI-P-10 of chili pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of chili pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested.

[0045] Figure 7 The image shows partial electrophoresis results for detecting the seed purity of chili pepper variety 'THI-P-10×P5114' using primers InDel-PepChr10-5. In the image, M is the marker, lane 01 is the female parent THI-P-10 of chili pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of chili pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested.

[0046] Figure 8 The image shows partial electrophoresis results for detecting the seed purity of chili pepper variety 'THI-P-10×P5114' using primers InDel-PepChr11-3. In the image, M is the marker, lane 01 is the female parent THI-P-10 of chili pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of chili pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested.

[0047] Figure 9 The image shows partial electrophoresis results for detecting the seed purity of chili pepper variety 'THI-P-10×P5114' using primers InDel-Chr12-2. In the image, M is the marker, lane 01 is the female parent THI-P-10 of chili pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of chili pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested.

[0048] Figure 10The image shows partial electrophoresis results for detecting the seed purity of chili pepper variety 'THI-P-10×P5114' using primers InDel-Chr12-3. In the image, M is the marker, lane 01 is the female parent THI-P-10 of chili pepper variety 'THI-P-10×P5114', lane 02 is the male parent P5114 of chili pepper variety 'THI-P-10×P5114', and lanes 03-90 are 88 seeds of the sample to be tested. Detailed Implementation

[0049] The technical solution of the present invention will now be clearly and completely described with reference to the accompanying drawings. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0050] The first aspect of this invention provides an InDel-marked primer set for identifying the authenticity or seed purity of the chili pepper variety 'THI-P-10×P5114', wherein the primer set preferably consists of 8 primer pairs, namely:

[0051] The primers for the molecular marker InDel-PepChr01-1 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.1 and downstream primer as shown in SEQ ID NO.2.

[0052] The primers for the molecular marker InDel-Chr04-1 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.3 and downstream primer as shown in SEQ ID NO.4.

[0053] The primers for the molecular marker InDel-PepChr04-4 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.5 and downstream primer as shown in SEQ ID NO.6.

[0054] The primers for the molecular marker InDel-Chr08-1 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.7 and downstream primer as shown in SEQ ID NO.8.

[0055] The primers for the molecular marker InDel-PepChr10-5 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.9 and downstream primer as shown in SEQ ID NO.10.

[0056] The primers for the molecular marker InDel-PepChr11-3 have the upstream primer nucleotide sequence shown in SEQ ID NO.11 and the downstream primer nucleotide sequence shown in SEQ ID NO.12.

[0057] The primers for the molecular marker InDel-Chr12-2 have the upstream primer nucleotide sequence shown in SEQ ID NO.13 and the downstream primer nucleotide sequence shown in SEQ ID NO.14.

[0058] The primers for the molecular marker InDel-Chr12-3 have the upstream primer nucleotide sequence shown in SEQ ID NO.15 and the downstream primer nucleotide sequence shown in SEQ ID NO.16.

[0059] The second aspect of this invention provides an application of the above-mentioned InDel marker primer pair set in the authenticity identification of the chili hybrid 'THI-P-10×P5114', the identification method comprising:

[0060] (1) Extract genomic DNA from seed samples of similar types of chili peppers to be tested;

[0061] (2) Using the extracted genomic DNA of the sample as a template, PCR amplification systems were established using the above 8 pairs of primers as forward and reverse primers, and PCR amplification was performed respectively.

[0062] (3) The amplification products were detected by agarose gel electrophoresis;

[0063] (4) If the band pattern of each of the 8 amplification products simultaneously has the band pattern of both the maternal parent THI-P-10 and the paternal parent P5114 of the chili hybrid 'THI-P-10×P5114', then the chili variety to be tested is the chili hybrid 'THI-P-10×P5114'; if the band pattern of any of the 8 amplification products does not simultaneously have the band pattern of both the maternal parent THI-P-10 and the paternal parent P5114 of the chili hybrid 'THI-P-10×P5114', then the chili variety to be tested is not the chili hybrid 'THI-P-10×P5114'.

[0064] In step (1), the modified CTAB method was used to extract genomic DNA from the chili seeds to be tested.

[0065] In step (2), the PCR amplification system is as follows: 5 μL of 2×Magic Green Taq SuperMix (containing specially modified Taq DNA Polymerase, dNTPs and an optimized buffer system), 1.0 μL each of 10 μM forward and reverse primers, 10 ng-100 ng of DNA template, and ddH2O added to 10 μL; the PCR amplification program is as follows: 95℃ for 3 min; 95℃ for 15 s, 52℃ for 15 s, 72℃ for 35 s, for 35 cycles; 72℃ for 10 min.

[0066] In step (3), the electrophoresis detection is performed by using a 3% agarose gel and electrophoresis at a constant voltage of 150V / cM for 35 minutes, followed by photographing using a gel imaging system.

[0067] In step (4), the molecular marker InDel-PepChr01-1 amplified one characteristic band in both the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 146bp and 180bp respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114'. The molecular marker InDel-Chr04-1 amplified one characteristic band in the maternal parent THI-P-10 of 'THI-P-10×P5114'. One characteristic band was amplified in both I-P-10 and 'THI-P-10×P5114' paternal parent P5114, with band sizes of 172bp and 141bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the 'THI-P-10' maternal parent THI-P-10 and 'THI-P-10×P5114' paternal parent P5114. The molecular marker InDel-PepChr04-4 amplified one characteristic band in each of the 'THI-P-10' maternal parent THI-P-10 and 'THI-P-10×P5114' paternal parent P5114, with band sizes of 172bp and 141bp, respectively. The band sizes were 141bp and 172bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The molecular marker InDel-Chr08-1 amplified one characteristic band each in the maternal parent THI-P-10 and the paternal parent P5114, with band sizes of 174bp and 151bp, respectively. Therefore, the 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The 5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114 both exhibit two characteristic bands; the molecular marker InDel-PepChr10-5 amplified one characteristic band in each of the 'THI-P-10' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114, with band sizes of 120bp and 154bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the 'THI-P-10' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114.Molecular marker InDel-PepChr11-3 amplified one characteristic band each in the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 140bp and 177bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. Molecular marker InDel-Chr12-2 amplified one characteristic band each in the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 140bp and 177bp, respectively. The bands 44bp and 166bp indicate that the 'THI-P-10×P5114' variety possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The molecular marker InDel-Chr12-3 amplified one characteristic band each in both the maternal parent THI-P-10 and the paternal parent P5114, with band sizes of 181bp and 153bp respectively. Therefore, the 'THI-P-10×P5114' variety possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114.

[0068] A third aspect of this invention provides a method for identifying the purity of seeds of the pepper hybrid 'THI-P-10×P5114' using the InDel-based marker primer pair described above. The method includes:

[0069] (1) Extract genomic DNA from seed samples of the pepper variety 'THI-P-10×P5114' to be tested;

[0070] (2) Using the extracted genomic DNA of the sample as a template, PCR amplification systems were established using the above 8 pairs of primers as forward and reverse primers, and PCR amplification was performed respectively.

[0071] (3) The amplification products were detected by agarose gel electrophoresis;

[0072] (4) If the band pattern of each of the 8 amplification products simultaneously has the band pattern of both the maternal parent THI-P-10 and the paternal parent P5114 of the chili hybrid 'THI-P-10×P5114', then the chili variety to be tested is the chili hybrid 'THI-P-10×P5114'; if the band pattern of any of the 8 amplification products does not simultaneously have the band pattern of both the maternal parent THI-P-10 and the paternal parent P5114 of the chili hybrid 'THI-P-10×P5114', then the chili variety to be tested is not the chili hybrid 'THI-P-10×P5114'.

[0073] (5) Seed purity = Number of the 8 amplification products detected that simultaneously have the band patterns of the female parent THI-P-10 and the male parent P5114 of the chili hybrid 'THI-P-10×P5114' / Total number of seeds detected × 100%.

[0074] In step (1), the modified CTAB method was used to extract genomic DNA from the chili seeds to be tested.

[0075] The PCR amplification system described in step (2) is as follows: 5 μL of 2×Magic Green Taq SuperMix (containing specially modified Taq DNA Polymerase, dNTPs and an optimized buffer system), 1.0 μL each of 10 μM forward and reverse primers, 10 ng-100 ng of DNA template, and ddH2O added to 10 μL; the PCR amplification program is as follows: 95℃ for 3 min; 95℃ for 15 s, 52℃ for 15 s, 72℃ for 35 s, for 35 cycles; 72℃ for 10 min.

[0076] The electrophoresis detection described in step (3) is as follows: using a 3% agarose gel, electrophoresis is performed on a 3% agarose gel at a constant voltage of 150V / cM for 35 minutes, and then photographs are taken using a gel imaging system.

[0077] In step (4), the molecular marker InDel-PepChr01-1 amplified one characteristic band in both the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 146bp and 180bp respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114'. The molecular marker InDel-Chr04-1 amplified one characteristic band in the maternal parent THI-P-10 of 'THI-P-10×P5114'. One characteristic band was amplified in both I-P-10 and 'THI-P-10×P5114' paternal parent P5114, with band sizes of 172bp and 141bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the 'THI-P-10' maternal parent THI-P-10 and 'THI-P-10×P5114' paternal parent P5114. The molecular marker InDel-PepChr04-4 amplified one characteristic band in each of the 'THI-P-10' maternal parent THI-P-10 and 'THI-P-10×P5114' paternal parent P5114, with band sizes of 172bp and 141bp, respectively. The band sizes were 141bp and 172bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The molecular marker InDel-Chr08-1 amplified one characteristic band each in the maternal parent THI-P-10 and the paternal parent P5114, with band sizes of 174bp and 151bp, respectively. Therefore, the 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The 5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114 both exhibit two characteristic bands; the molecular marker InDel-PepChr10-5 amplified one characteristic band in each of the 'THI-P-10' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114, with band sizes of 120bp and 154bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the 'THI-P-10' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114.Molecular marker InDel-PepChr11-3 amplified one characteristic band each in the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 140bp and 177bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. Molecular marker InDel-Chr12-2 amplified one characteristic band each in the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 140bp and 177bp, respectively. The bands 44bp and 166bp indicate that the 'THI-P-10×P5114' variety possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The molecular marker InDel-Chr12-3 amplified one characteristic band each in both the maternal parent THI-P-10 and the paternal parent P5114, with band sizes of 181bp and 153bp respectively. Therefore, the 'THI-P-10×P5114' variety possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114.

[0078] Specifically:

[0079] Example 1: Screening for differentially expressed InDel sites across the entire genome and designing screening-specific primers

[0080] 1. Experimental Methods

[0081] 1.1 Illumina high-throughput sequencing

[0082] Genomic DNA was extracted from the superior inbred lines of the female parent 'THI-P-10' and the male parent 'P5114' of the chili variety 'THI-P-10×P5114'. After the genomic DNA passed the quality test, it was mechanically fragmented (using ultrasound). Fragment size selection was then performed, followed by end repair, 3' end A addition, and sequencing adapter ligation. PCR amplification and purification were then performed. The PCR-amplified DNA fragments were circularized to form circular DNA. Using the circularized DNA as a template, a unique linear amplification mode (rolling circle amplification) was used to prepare DNA nanoballs (DNB). The prepared DNB library was then bound to an array of sites on a sequencing chip for sequencing. The raw reads (paired-end sequences) obtained from the sequencing were quality-assessed and filtered to obtain clean reads for subsequent bioinformatics analysis. Clean Reads were aligned with the CA59 sequence of the reference genome (Ver 2024-2-21, https: / / db.cngb.org / search / project / CNP0001129 / ), and InDel variant detection analysis was performed based on the alignment results.

[0083] 1.2 InDel site screening and specific primer design

[0084] Perl scripts were used to screen for InDel sites specific to the parent genomes of the pepper variety 'THI-P-10×P5114'. The InDel size was set to 20-100 bp, and the sequencing depth was greater than 8. Based on reference genome information, the screened sites were located on the genome, and nucleotide sequences of 180 bp upstream and downstream of the InDel marker sites were extracted. Primers were designed using Primer 5.0 with the following parameters set: Tm value of (60±2)℃, primer length of (25±2) bp, expected PCR product length of 100–280 bp, and other parameters left as default. PCR amplification was performed on the pepper variety 'THI-P-10×P5114' and its parent plants using the designed and synthesized primers.

[0085] 2. Experimental Results

[0086] Figure 1Electrophoresis images of PCR amplification products from eight primer pairs for the chili pepper variety 'THI-P-10×P5114' (mother parent THI-P-10, father parent P5114). The eight InDel primer pairs simultaneously amplified characteristic bands from both the mother parent THI-P-10 and the father parent P5114 in the 'THI-P-10×P5114' chili pepper variety, which can be used to identify the variety and seed purity of 'THI-P-10×P5114' (e.g., [missing information]). Figure 1 (As shown).

[0087] Table 1. Primer sets used for seed purity identification of chili variety 'THI-P-10×P5114'

[0088]

[0089] Table 1 shows the eight InDel marker primer pairs used in Experiments 2 and 3 to identify the purity of the 'THI-P-10×P5114' chili variety or 'THI-P-10×P5114' hybrid seeds.

[0090] Example 2: Rapid identification of chili pepper variety 'THI-P-10×P5114'

[0091] 1. Experimental Methods

[0092] 1.1 Extraction of seed genomic DNA

[0093] Prepare 5 seeds each of the following: 'THI-P-10×P5114' (mother parent THI-P-10), 'THI-P-10×P5114' (father parent P5114), 'THI-P-10×P5114B' (father parent TP023-PM-1), 'THI-P-10×P5114', 'THI-P-10×P5114B', '8819 Line Pepper A', 'Erjintiao', 'Zhaibubai Green Line Pepper', 'Xiangla Erjintiao', 'Hongtianxia·Line Pepper F1', 'Xiangla No. 6', 'Lahuangfei No. 1', '8819 Line Pepper B', 'Haoji Changxian', 'Heilong Green Line Pepper', 'Shenhe Xiangla Line Pepper', 'Line Pepper Xiangchu Mojin', and 'Chuanjiao No. 19'.

[0094] The seeds were germinated for 48 hours. After germination, genomic DNA was extracted from the samples using the standard CTAB method and stored at -20°C for later use.

[0095] 1.2 PCR amplification

[0096] Using the genomic DNA of the above-mentioned seed samples as templates, and using InDel-PepChr01-1, InDel-Chr04-1, InDel-PepChr04-4, InDel-Chr08-1, InDel-PepChr10-5, InDel-PepChr11-3, InDel-Chr12-2 and InDel-Chr12-3 as primers, PCR amplification was performed respectively.

[0097] The PCR amplification system was as follows: 5 μL of 2×Magic Green Taq SuperMix (containing specially modified Taq DNA Polymerase, dNTPs and an optimized buffer system), 1.0 μL each of 10 μM forward and reverse primers, 10 ng-100 ng of DNA template, and ddH2O to 10 μL.

[0098] The PCR amplification program was as follows: 95℃ for 3 min; 95℃ for 15 s, 52℃ for 15 s, 72℃ for 35 s, for 35 cycles; 72℃ for 10 min.

[0099] 1.3 Detection and analysis of PCR amplification products

[0100] After electrophoresis on a 3% agarose gel for 35 minutes at a constant voltage of 150 V / cM, the gel imaging system was used to take pictures. The authenticity of 'THI-P-10×P5114' was determined based on the electrophoretic banding pattern. If the banding patterns of all 8 InDel loci simultaneously exhibited the banding patterns of both the maternal parent THI-P-10 and the paternal parent P5114 of the chili hybrid 'THI-P-10×P5114', then the tested chili variety was identified as the chili hybrid 'THI-P-10×P5114'. If, among the 8 InDel loci, one marker did not simultaneously exhibit the banding patterns of both the maternal parent THI-P-10 and the paternal parent P5114 of the chili hybrid 'THI-P-10×P5114', then the tested chili variety was identified as not being the chili hybrid 'THI-P-10×P5114'.

[0101] 2. Identification Results

[0102] The agarose gel electrophoresis results of the varietal authenticity identification of the chili hybrid 'THI-P-10×P5114' using the above method are shown below. Figure 2As shown in the figure. M is the marker, and lanes 01-19 represent the female parent THI-P-10 of the chili pepper hybrid 'THI-P-10×P5114', the male parent P5114 of the chili pepper hybrid 'THI-P-10×P5114', the 'THI-P-10×P5114' variety, the female parent THI-P-10 of the chili pepper hybrid 'THI-P-10×P5114B', and the chili pepper hybrid 'THI-P-10×P5114B'. The parent of 5114B' is TP023-PM-1, the chili hybrid 'THI-P-10×P5114B', '8819 Line Pepper A', 'Erjintiao', 'Zhaibubai Green Line Pepper', 'Xiangla Erjintiao', 'Hongtianxia·Line Pepper F1', 'Xiangla No. 6', 'Lahuangfei No. 1', '8819 Line Pepper B', 'Haoji Changxian', 'Heilong Green Line Pepper', 'Shenhe Xiangla Line Pepper', 'Line Pepper Xiangchu Mojin', and 'Chuanjiao No. 19'.

[0103] The test results show that the banding patterns at eight InDel loci of the chili hybrid 'THI-P-10×P5114' simultaneously possess the banding patterns of both parents of the chili hybrid 'THI-P-10×P5114'. Other chili hybrids include 'THI-P-10×P5114B', '8819 Line Pepper A', 'Erjintiao', 'Zhaibubai Green Line Pepper', 'Xiangla Erjintiao', 'Hongtianxia·Line Pepper F1', 'Xiangla No. 6', and 'Lahuangfei No. 1'. The banding patterns of eight InDel loci in peppers '8819 Line Pepper B', 'Haoji Long Line Pepper', 'Heilong Green Line Pepper', 'Shenhe Spicy Line Pepper', 'Line Pepper Xiangchu Mojin', and 'Chuanjiao No. 19' were different but possessed the banding patterns of the parent pepper hybrid 'THI-P-10×P5114'. According to the identification results, the primer set designed in this invention can accurately identify the pepper hybrid 'THI-P-10×P5114' from other pepper varieties.

[0104] Example 3: Identification of the purity of hybrid seeds of chili variety 'THI-P-10×P5114'

[0105] 1. Experimental Methods

[0106] 1.1 Extraction of seed genomic DNA

[0107] Five seeds each of the 'THI-P-10' female parent THI-P-10 and the 'THI-P-10' male parent P5114 were collected. A total of 88 hybrid seeds were randomly selected from a batch of 'THI-P-10×P5114' chili pepper hybrid seeds.

[0108] Seeds and sample seeds of the chili pepper hybrid 'THI-P-10×P5114' (mother parent THI-P-10 and father parent P5114) were simultaneously germinated for 48 hours. After germination, five seeds from each parent were mixed and sampled separately, and individual seeds from the 88 hybrid sample seeds were collected. Genomic DNA was extracted using the standard CTAB method and stored at -20℃ for later use.

[0109] 1.2 PCR amplification

[0110] Using genomic DNA from the female parent THI-P-10, the male parent P5114, and the hybrid of the chili variety 'THI-P-10×P5114' as templates, PCR amplification was performed using InDel-PepChr01-1, InDel-Chr04-1, InDel-PepChr04-4, InDel-Chr08-1, InDel-PepChr10-5, InDel-PepChr11-3, InDel-Chr12-2, and InDel-Chr12-3 as primers.

[0111] The PCR amplification system was as follows: 5 μL of 2×Magic Green Taq SuperMix (containing specially modified Taq DNA Polymerase, dNTPs and an optimized buffer system), 1.0 μL each of 10 μM forward and reverse primers, 10 ng-100 ng of DNA template, and ddH2O to 10 μL.

[0112] The PCR amplification program was as follows: 95℃ for 3 min; 95℃ for 15 s, 52℃ for 15 s, 72℃ for 35 s, for 35 cycles; 72℃ for 10 min.

[0113] 1.3 Detection and analysis of PCR amplification products

[0114] After electrophoresis on a 3% agarose gel for 35 minutes at a constant voltage of 150 V / cM, the gel imaging system was used to take photographs. The purity of the 'THI-P-10×P5114' hybrid seeds was determined based on the electrophoretic banding patterns. If the banding patterns at all 8 InDel loci simultaneously exhibited the banding patterns of both the maternal parent THI-P-10 and the paternal parent P5114 of the chili hybrid 'THI-P-10×P5114', then the tested chili variety was identified as the chili hybrid 'THI-P-10×P5114'.

[0115] 2. Identification Results

[0116] Partial results of agarose gel electrophoresis for seed purity identification of pepper hybrid 'THI-P-10×P5114' using the above method are shown below. Figure 3 , Figure 4 , Figure 5 , Figure 6 , Figure 7 , Figure 8 , Figure 9 , Figure 10 As shown in the figure. M is the marker, lane 01 is the female parent THI-P-10 of the chili hybrid 'THI-P-10×P5114', lane 02 is the male parent P5114 of the chili hybrid 'THIP-10×P5114', and lanes 03-90 are the 88 seeds of the sample to be tested.

[0117] Of the 88 seed samples, 88 were genuine hybrids. Therefore, the purity of this batch of 'THI-P-10×P5114' hybrid seeds is 100%, which meets national standards and is consistent with the results of field surveys.

[0118] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

[0119] sequence list

[0120] Institute of Economic Crops, Hubei Academy of Agricultural Sciences

[0121] InDel-labeled primer set and its application in determining the purity of pepper 'THI-P-10×P5114' seeds

[0122] DNA

[0123] Chili pepper (Capsicum) 1

[0125] ACCCATCTCTCTCTACCACCATTACCACATTTAGAGTATTTGAATTCCAAACATAGGATAAAATTAATTCCCAAATTTGATCCAGGGATTATTATCCTTATACCACGTACAAAACAATTGTGGCAGCAGGTTTGATTATAACAGTT

[0126] DNA

[0127] Chili pepper (Capsicum) 2

[0129] ACCCATCTCTCTCTACCACCATTACCACATTTAGAGTATTTGAATGTTGAAATGGTCTCGGGATTAACTAATAGCTCAATCCAAACATAGGATAAAATTAATTCCCAAATTTGATCCAGGGATTATTATCCTTATACCACGTACAAAACAATTGTGGCAGCAGGTTTGATTATAACAGTT

[0130] DNA

[0131] Chili (Capsicum) 3

[0133] TCTTATGCTCATGACAAGTTGGCTCTTTCTTATAAGTTGGTTTATTATTTAAAGGATAACTCCCAATGAGAGCACGTTTCTCTTTTCTTTTATATTTTTTTTGTCTGTCTCTTG TACATTCCTTTTTAGTATGAGAAAATTTCCTCC AAGCTTCCATCCACACTGTGACTTCAG

[0134] DNA

[0135] Chili (Capsicum) 4

[0137] TCTTATGCTCATGACAAGTTGGCTCTTTCTTATAAGTTGGTTTATTATTTAAAGGATAACTCCCAATGAGAGCACGTTTCTCTTTTCTTTTATATTTTTTTTGTCTGTCTCTTGAAGCTTCCATCCACACTGTGACTTCAG

[0138] DNA

[0139] Chili (Capsicum) 5

[0141] TACTATAACCCACTCGTGGAGAATCGTGGGAAACTTGATCGGATGATCCTCCAGAGGCGAAGTCAGAATTTTAGGTTTGTGGGTTTAGAATTCTAAGATAGAGGATTTTAGGTCTGTGGGTTTGAAATTCTAAGACAAAGAGTAAAAAATAAAAAATACTAGTGGGGTTCGGAC

[0142] DNA

[0143] Chili (Capsicum) 6

[0145] TACTATAACCCACTCGTGGAGAATCGTGGGAAAGCGAAGTCAGAATTTTAGGTTTGTGGGTTTAGAATTCTAAGATAGAGGATTTTAGGTCTGTGGGTTTGAAATTCTAAGACAAAGAGTAAAAAATAAAAAATACTAGTGGGGTTCGGAC

[0146] DNA

[0147] Chili (Capsicum) 7

[0149] TTCAACAAATTGGGCCAAATACTACGCAAAATATTCATCAATATCTGTTGTTCAAACTCTGAATACTTCACTTTGTCATACAAGAAGAAAAATGGCCAACATGAAAATGAAAATCTTCCATCTGATTTTCCTACTATTACA

[0150] DNA

[0151] Chili (Capsicum) 8

[0153] TTCAACAAATTGGGCCAAATACTACGCAAAATATTCATCAATATCTGTTGTTCAAACTCTGAATACTTCACTTTGTCATACAAGAAGAAAAATG AGCCAACAAGAGGTGTTGTCTCAAATGCCTG GCCAACATGAAAATGAAAATCTTCCATCTGATTTTCCTACTATTACA

[0154] DNA

[0155] Chili (Capsicum) 9

[0157] ATTTACCAACTTATATGCTCATCGCCACCACCTTCATGTGAAGACCTCATTCTTTTCGTAAGCCTTTGTGATCATCTTATCTAAACATTTTATAAGCTAGGTTGGACAAGTTCATTTCAT

[0158] DNA

[0159] Capsicum 10

[0161] ATTTACCAACTTATATGCTCATCGCCACCACCTTCATGTGAAGACCTCATTCTTTTCGTAAGCC AAGAC ATCTATTTTCTCTAATACTATGTTAAATT TTTGTGATCATCTTATCTAAACATTTTATAAGCTAGGTTGGACAAGTTCATTTCAT

[0162] DNA

[0163] Capsicum 11

[0165] TTATTTATGTGTCATTATCACTCCATAATCGAGTGTTTGTGAGAAAAAAATAACTAACTTGTCAAATTTTTTTAAAATAAATAATTTATGAAAACTGTTTTTAAAAATTATGACAAATAATTTGATACAGAGGGAGTCCA

[0166] DNA

[0167] Capsicum 12

[0169] TTATTTATGTGTCATTATCACTCCATAATCGAGTGTTTGT AGTTTTCAAGAGCAATTATGTGCTACAAA GATAAAAT GAGAAAAAAATAACTAACTTGTCAAATTTTTTTAAAATAAATAATTTATGAAAACTGTTTTTAAAAATTATGACAAATAATTTGATACAGAGGGAGTCCA

[0170] DNA

[0171] Capsicum 13

[0173] CGAATTTTATATCATTGGAAAGCTGATTCAATTATCTACAATTTGGTAGGTGTTGATATGAAAAATTTCATTAAAGTATACCCTTGTAGAATCAAATATACAACTTTGGGTGAATAAAAGGATCTTAGGTCAATTTGGCTATAA

[0174] DNA

[0175] Chili (Capsicum) 14

[0177] CGAATTTTATATCATTGGAAAGCTGATTCAATTATCTACAATTTGGTAGGTGTTGATATGAAAAATTTCA TGTATATGAAAAGTTATAGACA TTAAAGTATACCCTTGTAGAATCAAATATACAACTTTGGGTGAATAAAAGGATCTTAGGTCAATTTGGCTATAA

[0178] DNA

[0179] Chili (Capsicum) 15

[0181] GGATTTGTTTTAGCGTATTTCTGTTAACTAATGAGAAAATATGTTTGATTTTGTTTGTCTTTAATGTTGGTTGATTTGAAGTATCTTCTTTAATGTTGGTTGATTTGAACTTTCTTTGGATACTATGTTTTTTTTCTCCTCTCTTAAATGTGCTACTTGTTATGTTTCATGAGTTGGTTCA

[0182] DNA

[0183] Chili (Capsicum) 16

[0185] GGATTTGTTTTAGCGTATTTCTGTTAACTAATGAGAAAATATGTTTGATTTTGTTTGTCTTTAATGTTGGTTGATTTGAAGTTTTCTTTGGATACTATGTTTTTTTTCTCCTCTCTTAAATGTGCTACTTGTTATGTTTCATGAGTTGGTTCA。

Claims

1. An InDel-labeled primer set, characterized in that: The primer set consists of 8 pairs of primers, namely: The primers for the molecular marker InDel-PepChr01-1 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.1 and downstream primer as shown in SEQ ID NO.

2. The primers for the molecular marker InDel-Chr04-1 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.3 and downstream primer as shown in SEQ ID NO.

4. The primers for the molecular marker InDel-PepChr04-4 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.5 and downstream primer as shown in SEQ ID NO.

6. The primers for the molecular marker InDel-Chr08-1 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.7 and downstream primer as shown in SEQ ID NO.

8. The primers for the molecular marker InDel-PepChr10-5 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.9 and downstream primer as shown in SEQ ID NO.

10. The primers for the molecular marker InDel-PepChr11-3 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.11 and downstream primer as shown in SEQ ID NO.

12. The primers for the molecular marker InDel-Chr12-2 have the following nucleotide sequences: upstream primer as shown in SEQ ID NO.13 and downstream primer as shown in SEQ ID NO.

14. The primers for the molecular marker InDel-Chr12-3 have the upstream primer nucleotide sequence shown in SEQ ID NO.15 and the downstream primer nucleotide sequence shown in SEQ ID NO.

16.

2. The application of the InDel marker primer set as described in claim 1 in identifying the authenticity of the chili pepper variety 'THI-P-10×P5114'.

3. The application of the InDel-labeled primer set as described in claim 1 in identifying the purity of chili pepper 'THI-P-10×P5114' seeds.

4. A method for identifying the authenticity or seed purity of the chili pepper variety 'THI-P-10×P5114', characterized in that: Includes the following steps: (1) Extract genomic DNA from seed samples of the pepper variety to be tested; (2) Using the extracted genomic DNA of the sample as a template, PCR amplification systems were established using the 8 primer pairs as described in claim 1 as forward and reverse primers, and PCR amplification was performed respectively. (3) The amplification products were detected by agarose gel electrophoresis; (4) If the band pattern of each of the 8 amplification products simultaneously has the band pattern of both the maternal parent THI-P-10 and the paternal parent P5114 of the chili hybrid 'THI-P-10×P5114', then the chili variety to be tested is the chili hybrid 'THI-P-10×P5114'; if the band pattern of any of the 8 amplification products does not simultaneously have the band pattern of both the maternal parent THI-P-10 and the paternal parent P5114 of the chili hybrid 'THI-P-10×P5114', then the chili variety to be tested is not the chili hybrid 'THI-P-10×P5114'. (5) Calculate the seed purity according to the seed purity formula; In step (4), the molecular marker InDel-PepChr01-1 amplified one characteristic band in both the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 146bp and 180bp respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114'. The molecular marker InDel-Chr04-1 amplified one characteristic band in the maternal parent THI-P-10 of 'THI-P-10×P5114'. One characteristic band was amplified in both I-P-10 and 'THI-P-10×P5114' paternal parent P5114, with band sizes of 172bp and 141bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the 'THI-P-10' maternal parent THI-P-10 and 'THI-P-10×P5114' paternal parent P5114. The molecular marker InDel-PepChr04-4 amplified one characteristic band in each of the 'THI-P-10' maternal parent THI-P-10 and 'THI-P-10×P5114' paternal parent P5114, with band sizes of 172bp and 141bp, respectively. The band sizes were 141bp and 172bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The molecular marker InDel-Chr08-1 amplified one characteristic band each in the maternal parent THI-P-10 and the paternal parent P5114, with band sizes of 174bp and 151bp, respectively. Therefore, the 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The 5114' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114 both exhibit two characteristic bands; the molecular marker InDel-PepChr10-5 amplified one characteristic band in each of the 'THI-P-10' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114, with band sizes of 120bp and 154bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the 'THI-P-10' maternal parent THI-P-10 and the 'THI-P-10×P5114' paternal parent P5114.Molecular marker InDel-PepChr11-3 amplified one characteristic band each in the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 140bp and 177bp, respectively. The 'THI-P-10×P5114' variety simultaneously possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. Molecular marker InDel-Chr12-2 amplified one characteristic band each in the maternal parent THI-P-10 and the paternal parent P5114 of 'THI-P-10×P5114', with band sizes of 140bp and 177bp, respectively. The bands 44bp and 166bp indicate that the 'THI-P-10×P5114' variety possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114. The molecular marker InDel-Chr12-3 amplified one characteristic band each in both the maternal parent THI-P-10 and the paternal parent P5114, with band sizes of 181bp and 153bp respectively. Therefore, the 'THI-P-10×P5114' variety possesses two characteristic bands from both the maternal parent THI-P-10 and the paternal parent P5114.

5. The method according to claim 4, characterized in that: In step (1), when identifying the authenticity of the chili pepper variety 'THI-P-10×P5114', genomic DNA is extracted from seed samples of similar chili pepper varieties to be tested. When identifying the purity of chili pepper 'THI-P-10×P5114' seeds, genomic DNA is extracted from seed samples of chili pepper 'THI-P-10×P5114' varieties to be tested.

6. The method according to claim 4, characterized in that: In step (1), genomic DNA was extracted from the chili seeds to be tested using a modified CTAB method.

7. The method according to claim 4, characterized in that: In step (2), the PCR amplification system is as follows: 5 μL of 2×MagicGreen Taq SuperMix, 1.0 μL each of 10 μM forward and reverse primers, 10 ng-100 ng of DNA template, and ddH2O added to 10 μL; the PCR amplification program is as follows: 95℃ for 3 min; 95℃ for 15 s, 52℃ for 15 s, 72℃ for 35 s, for 35 cycles; 72℃ for 10 min.

8. The method according to claim 4, characterized in that: In step (3), the electrophoresis detection includes: using a 3% agarose gel, electrophoresis on a 3% agarose gel for 35 minutes at a constant voltage of 150V / cM, and then taking a photograph using a gel imaging system.

9. The method according to claim 4, characterized in that: In step (5), the seed purity is calculated as follows: the number of 8 amplification products that simultaneously contain the band patterns of the female parent THI-P-10 and the male parent P5114 of the chili hybrid 'THI-P-10×P5114' / the total number of seeds detected × 100%.

Images