An SNP marker related to the plant type of upland cotton and its application
By developing the SNP marker D05:14762561, which is highly linked to the length and short traits of upland cotton fruit foliage, the problem of difficulty in screening short fruit foliage varieties in traditional breeding is solved, and rapid and accurate breeding screening is achieved, and breeding efficiency and accuracy are improved.
Patent Information
- Application Number
- CN202510174228.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-18
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-02-18
AI Technical Summary
During the traditional upland cotton breeding process, it is difficult to effectively screen and breed varieties with short fruit node traits, resulting in low breeding efficiency and accuracy.
A SNP marker D05:14762561, which is highly linked to the length and short traits of the upland cotton fruit node, is developed. This marker is located at the 14762561 base of the chromosome 18 of the upland cotton genome. By detecting the genotype of the SNP marker, the plant type characteristics of the upland cotton germplasm can be quickly and accurately judged.
By detecting the genotype of the SNP marker, individuals carrying the target gene can be screened out at the early gene level, and unsatisfactory plants can be eliminated in advance, reducing breeding costs, and improving breeding accuracy and efficiency.
Smart Images

Figure CN119639957B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular marker-assisted breeding, and specifically relates to an SNP marker related to the plant type of upland cotton and its application. Background Art
[0002] The plant type of upland cotton is an important factor affecting mechanization and yield. Therefore, during the breeding process of upland cotton, a compact plant type is one of the important breeding goals. The length of the fruiting nodes of upland cotton refers to the distance between the bolls on the fruiting branches of the plant and between the bolls and the main stem of the plant. Shorter fruiting nodes can make the plant more compact, help improve the planting density, increase the photosynthesis efficiency, and thus increase the biomass and yield of the crop. A compact plant type and shorter fruiting nodes also contribute to adapting to mechanized operations because the space between plants is smaller, which is more suitable for mechanical operation. Therefore, the development of short fruiting node genes and related molecular markers has important research value and production significance.
[0003] Using traditional breeding methods such as cross-breeding, it is necessary to carry out multiple generations of self-crossing and screening to obtain an upland cotton variety with a stable short fruiting node trait, which consumes a large amount of manpower and material resources. Moreover, traditional breeding relies on the genetic variation of existing varieties, and the available parental resources are relatively limited. The selection of varieties depends on the experience of breeders and the observation of phenotypes to select excellent traits, lacking precise operation and control at the gene level, which also leads to greater blindness and unpredictability in the breeding process.
[0004] Molecular marker-assisted breeding (MAS) is a method that uses molecular markers tightly linked to target traits to assist traditional breeding. Its core principle is to identify and select plant varieties with the desired genetic characteristics through molecular marker technology. SNP markers are a type of molecular marker, which refer to the DNA sequence polymorphisms caused by single-base variations in the genomic DNA sequence. SNPs are widely distributed and have a large number in the genome. SNPs can reflect the differences in nucleotide sequences at the DNA level and are not affected by the developmental stage, environmental factors, or whether the gene is expressed. They can be stably manifested and inherited in the organism's genome. Using SNPs tightly linked to the genes affecting target traits as molecular markers can track the target genes, more efficiently conduct assisted selection and multi-gene polymerization, screen individuals carrying the target genes, and thus significantly improve the breeding efficiency and accuracy. Summary of the Invention
[0005] In view of the problems existing in the traditional breeding process, the present invention provides an SNP marker D05:14762561, which is highly linked to the trait of the length of the fruiting node of upland cotton. It is a biallelic SNP with a polymorphic genotype of G / T. Upland cotton germplasm with the TT genotype has shorter fruiting nodes than that with the GG genotype. The shorter the fruiting node length, the more compact the plant type of the upland cotton, specifically manifested as a tower shape. The longer the fruiting branch fruiting node length, the looser the plant type of the upland cotton, specifically manifested as a cylindrical shape. Therefore, using this SNP marker for assisted breeding of varieties with short fruiting nodes can screen out individuals carrying the target gene at the early gene level, eliminate undesirable plants in advance, without waiting for phenotypic identification at the adult stage, reducing the breeding cost and improving the accuracy and efficiency of breeding.
[0006] To achieve the above object, the present invention specifically adopts the following technical solutions:
[0007] In the first aspect of the present invention, an SNP marker related to the plant type of upland cotton is provided. The SNP marker is located at the 14,762,561st base of D05 on chromosome 18 of the upland cotton genome. Among them, in upland cotton plants with a compact plant type, the nucleotide type of the SNP marker is T, and in upland cotton plants with a loose plant type, the nucleotide type of the SNP marker is G.
[0008] As a further illustration of the present invention, the upland cotton plants with a compact plant type are specifically in a tower shape, and the upland cotton plants with a loose plant type are specifically in a cylindrical shape.
[0009] As a further illustration of the present invention, in upland cotton plants with short fruiting branch fruiting nodes, the nucleotide type of the SNP marker is T, and in upland cotton plants with long fruiting branch fruiting nodes, the nucleotide type of the SNP marker is G.
[0010] As a further illustration of the present invention, the SNP marker is located within the 2000bp promoter region upstream of the gene Ghi_D05G08181.
[0011] As a further illustration of the present invention, the nucleotide sequence of the 2000bp promoter upstream of the gene Ghi_D05G08181 is as shown in SEQ ID NO.1.
[0012] As a further illustration of the present invention, the nucleotide sequence of the gene Ghi_D05G08181 is as shown in SEQ ID NO.2.
[0013] In a second aspect of the present invention, a detection primer for detecting the SNP marker described in any one of the above is provided. The detection primer comprises two upstream primers and one downstream primer. Among them, the nucleotide sequences of the two upstream primers are shown in SEQ ID NO. 3 and SEQ ID NO. 4 respectively; the nucleotide sequence of one downstream primer is shown in SEQ ID NO. 5.
[0014] In a third aspect of the present invention, a kit for detecting the plant type of upland cotton is provided. The kit includes the above detection primer and PCR amplification reagent.
[0015] In a fourth aspect of the present invention, the application of the above SNP marker, the above detection primer or the above kit in the detection of the plant type of upland cotton is provided.
[0016] In a fifth aspect of the present invention, a method for detecting the plant type of upland cotton is provided, including the following steps:
[0017] Step 1: Extract the DNA of the upland cotton sample to be tested;
[0018] Step 2: Perform PCR amplification based on the KASP technology on the DNA of the upland cotton sample to be tested using the above detection primer to obtain a PCR amplification product;
[0019] Step 3: Perform fluorescence detection and analysis on the PCR amplification product. When FAM fluorescence is generated, it indicates that the genotype of the upland cotton sample at the above SNP marker is GG. When HEX fluorescence is generated, it indicates that the genotype of the upland cotton sample at the above SNP marker is TT; among them, the GG genotype is an upland cotton variety with a loose plant type, and the TT genotype is an upland cotton variety with a compact plant type.
[0020] Compared with the prior art, the present invention has the following beneficial technical effects:
[0021] The present invention provides a SNP marker related to plant type of upland cotton (closely associated with fruit node length): D05:14762561. The SNP is closely related to the fruit node length trait of upland cotton. The fruit node length of the fruit branch of the variety with genotype TT is significantly shorter than that of the variety with genotype GG. And it shows extremely significant differences in three environments, indicating that the SNP is relatively reliable and stable, and can be used as a molecular marker highly linked to the plant type (fruit node length) of upland cotton for molecular assisted breeding, and breeding materials with compact plant type (shorter fruit node length). By detecting the genotype of the SNP marker, the plant type (fruit node length) of the upland cotton germplasm to be tested can be quickly and accurately determined. Specifically, when the genotype of the upland cotton germplasm to be tested at the SNP is GG, it is determined to be a variety with a loose plant type (longer fruit node), and when the genotype of the upland cotton germplasm to be tested at the SNP is TT, it is determined to be a variety with a compact plant type (shorter fruit node). The present invention can quickly and reliably distinguish or identify varieties with short fruit nodes from the gene level, and is not affected by the environment and the growth and development period, which greatly accelerates the breeding process and improves the accuracy and efficiency of short fruit node variety selection. In addition, the SNP variation site provided by the present invention can be used as a target for genetic engineering breeding, and the GG genotype can be mutated into the TT genotype by mutation, editing, etc., which can provide a new, fast and effective way for the genetic improvement of upland cotton fruit node traits.
[0022] Other features and advantages of the technical solution will be described in the subsequent description, and partly become apparent from the description, or understood by implementing the technical solution. The purpose and other advantages of the technical solution can be achieved and obtained through the structures specifically pointed out in the written description and the drawings.
[0023] The technical solution of the present technical solution is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] The accompanying drawings are used to provide a further understanding of the technical solution and constitute a part of the specification. Together with the embodiments of the technical solution, they are used to explain the technical solution and do not constitute a limitation of the technical solution. In the accompanying drawings:
[0025] Figure 1 This is a box plot of the correlation between 343 materials and upland cotton plant type. In the figure, 23_XJ, 24_AY, and 24_XJ represent Bortala Prefecture, Xinjiang in 2023, Anyang, Henan in 2024, and Bortala Prefecture, Xinjiang in 2024, respectively; BLUE represents the best linear unbiased prediction (BLUE) value of the three environments; LJJ1 represents the distance between the first boll on the third fruit branch and the main stem.
[0026] Figure 2It is the structural diagram of gene Ghi_D05G08181 and SNP: D05:14762561.
[0027] Figure 3 It is the KASP genotyping map of 343 materials. The red color represents the GG homozygous genotype (237 materials), the blue color represents the TT homozygous genotype (106 materials), and the black color is water (control).
[0028] Figure 4 It is the result of comparing the lengths of fruiting branches intercepted from upland cotton germplasms with GG and TT genotypes respectively. Only 20 are shown in the figure.
[0029] Figure 5 It is the result of comparing the plant types of upland cotton germplasms with GG and TT genotypes. Detailed implementation manners
[0030] The following describes the preferred embodiments of the technical solution with reference to the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the technical solution, and are not used to limit the technical solution.
[0031] 1. Obtaining SNP marker loci related to the plant type of upland cotton.
[0032] 1. Material sources and investigation methods
[0033] The present invention uses 343 upland cotton core germplasms for phenotypic investigation and genotyping. The materials are provided by the National Mid-term Genebank of Upland Cotton Germplasm Resources, Institute of Cotton Research, Chinese Academy of Agricultural Sciences. These materials mainly come from abroad and the Yangtze River Basin, Yellow River Basin, Liaohe River Basin, etc. in China. They have a wide range of sources and a long time span, which is conducive to analyzing the genetic diversity of upland cotton germplasm resources at the whole genome level.
[0034] Since the fruit branch node lengths in the middle part (3 - 5) of cotton are closer to the average level of the whole plant, have a higher correlation with the average value of the whole plant, and have a smaller coefficient of variation in node length, they are relatively stable. The inventors investigated the lengths of the third fruit branch nodes of 343 materials in two years in Bole, Xinjiang and Anyang, Henan, with a total of 3 environments: Bole, Xinjiang in 2023; Anyang, Henan in 2024; and Bole, Xinjiang in 2024, which are abbreviated as 23_XJ, 24_AY, and 24_XJ respectively. Two replicates were set up in each environment, and within each replicate, 5 consecutive normal-growing plants except the first one in the border rows were selected for measurement. The measurement methods were: the distance between the first boll on the third fruit branch and the main stem, and the distance between the second boll and the first boll on the third fruit branch. The average value of the 5 plants was taken as the phenotypic value of the variety under this replicate, and the average value of the 3 replicates was taken as the phenotypic value of the variety under this environment. And the best linear unbiased prediction (BLUE) value was calculated. The analysis was based on lme4 (Bates et al., 2015) and the emmeans package (Lenth, 2020) in the R language environment.
[0035] 2. Sequencing and Genotyping
[0036] Based on the detection data of 380 upland cotton germplasms using the CottonSNP80K chip in this study, after the following criteria: call rate > 0.99, MAF > 0.2, heterozygosity < 0.05, distribution density 400 kb / SNP, 4857 candidate extended sites were screened out. Added to these were 3948 sites screened from the CottonSNP63K chip after the following criteria: polymorphism (DDfre) > 0.05, call rate > 0.95, signal value DD R meDn value ≥ 0.4, BB meDn value ≥ 0.4, LD screening r2 ≥ 0.8 (500 kb), and 257 GWAS sites related to yield, quality, plant type, and growth period that have been publicly reported were summarized. Finally, a set of 8347 sites with a wide range of sources and more comprehensive information was obtained. The 8347 SNP sites covered a total of 1,934,654,758 bp of the genome, with an average marker density of detecting 1 variation per 231,778 base pairs.
[0037] 3. GWAS Analysis
[0038] The phenotypic values of the third fruiting branch segment length of 343 upland cotton materials in 3 environments and the best linear unbiased prediction (BLUE) of the three environments were combined with 7,779 SNP loci covering the whole genome of upland cotton for GWAS analysis. There are three analysis software used: GAPIT, rMVP, and gemma. The model used is MLM (Mixed Linear Model), and the threshold line is set to 1 / the number of markers. To ensure the stability of the model and SNP loci, the GWAS results were screened, and stable SNPs that could be detected in at least two software and at least in 2 environments were selected. The results showed that SNP: D05:14762561 was closely related to the phenotypic values and the best linear unbiased prediction (BLUE) values of the first segment of the third fruiting branch of 343 materials in three environments, with the same trend, and there were significant differences among different genotypes of the SNP. In plants with shorter first segments of the fruiting branch, the nucleotide of this SNP variation is T (represented as 1), and in plants with longer first segments of the fruiting branch, the nucleotide of this SNP variation is G (represented as 0) (as Figure 1 shown).
[0039] This SNP is located at the 14,762,561st base of chromosome 18 (D05) of upland cotton, at the 1505th position in the 2000bp upstream promoter of gene Ghi_D05G08181 (as Figure 2 shown, the position of the SNP is marked in red). The 14,762,561st base is replaced by T from G, represented as G / T (reference genome: Gossypium hirsutum (AD1)'TM-1' genome WHU_v1). It is a two-locus polymorphic SNP locus. Among them, the nucleotide sequence of the 2000bp upstream promoter of gene Ghi_D05G08181 is as shown in SEQ ID NO.1, and the full-length nucleotide sequence of gene Ghi_D05G08181 is as shown in SEQ ID NO.2.
[0040] II. Genotyping based on the Kompetitive AlleleSpecific PCR (KASP) technology.
[0041] 1. KSAP primer design
[0042] Extract the sequences of 100bp upstream and downstream (excluding this SNP) of this SNP: D05:14762561, that is, the 14,762,561st base of chromosome D05, and organize them into the following format:
[0043] > D05:14762561
[0044] TTATCATTATACCAAACAAAATTTCATTGACACCAAAAACAAAATGTTATGCGAAATCATCATGGGATTTTCACCACATCTTCCAAATGATAAAATGTTA[G / T]ATCATACAAACAAAAAGATGAGCAACAAGGCTTTATTAACTTGAACCTATCTTTCTCTCTAAGTATAGACTGTTGACCTCTGAACAAAAGGAACTCAAAT, where [G / T] is the polymorphic genotype of this SNP. Submit and design primers in the SNP marker primer design tool - SNPWay. There are two forward primers (upstream primers), with adapter sequences at the 5' end, as shown in SEQ ID NO.3 and SEQ ID NO.4. The 3' ends are respectively the polymorphic genotypes G or T of SNP: D05:14762561, as shown in SEQ ID NO.3 and SEQ ID NO.4. There is one reverse universal primer (downstream primer), as shown in SEQ ID NO.5.
[0045] 2. Genotype 343 materials using this primer combination, including the following steps:
[0046] (1) Extract DNA from 343 upland cotton materials used for KSAP genotyping.
[0047] (1-1) Put a single dehulled upland cotton seed into a 2 ml centrifuge tube, add 2 4 mm steel beads, and grind until it becomes powdery.
[0048] (1-2) Add 800 μl of pre-warmed SDS extraction buffer (1% SDS, 0.01% EDTA, 0.705 mol / L NaCl, 0.05 mol / L Tris-HCl, 0.5% sorbitol, 1% PVP, 1% β-mercaptoethanol) to the centrifuge tube. After vortexing and mixing evenly, incubate in a water bath at 65 °C for 30 min, and invert and mix evenly every 10 min.
[0049] (1-3) Add 800 μl of a mixture of phenol, chloroform and isoamyl alcohol (volume ratio 25:24:1) to the centrifuge tube, invert and mix evenly until there is no layering, and centrifuge at 12000 rpm for 10 min.
[0050] (1-4) Pipette 650 μl of the supernatant into a new centrifuge tube, add an equal volume of a mixture of chloroform and isoamyl alcohol (volume ratio 24:1), invert and mix evenly until there is no layering, and centrifuge at 12000 rpm for 10 min.
[0051] (1-5) Pipette 500 μl of the supernatant into a new centrifuge tube, add 0.7 times the volume of isopropanol, mix gently until the DNA precipitates as a mass, and let it stand at room temperature for 30 min.
[0052] (1-6) Wash the DNA pellet twice with 70% ethanol and once with absolute ethanol.
[0053] (1-7) Air-dry the ethanol in the centrifuge tube, add 100 μl of ddH2O to dissolve the DNA completely, and set aside.
[0054] (2) Perform PCR amplification of the DNA using specific KASP primers based on the KASP technology.
[0055] Add 2X Master Mix for ASPCR V1 and specific KASP primers (the above forward primer and universal reverse primer) to the DNA template of the 343 material extracted in step (1) for PCR amplification.
[0056] The above 2X Master Mix for ASPCR V1 contains the following components: FAM fluorescent probe, HEX fluorescent probe, ROX internal reference dye, Taq DNA polymerase, dNTP, and MgC1 2 。
[0057] The above PCR reaction system is shown in Table 1 below:
[0058] Table 1 PCR reaction system
[0059]
[0060] The water bath PCR reaction conditions are: 95°C for 10 minutes; 95°C for 20 seconds, 61 - 55°C for 40 seconds (decreasing 0.6°C per cycle), 10 cycles; 95°C for 20 seconds, 55°C for 40 seconds, 30 cycles.
[0061] (3) Perform fluorescence detection and analysis on the PCR amplification products.
[0062] The designed KSAP primers were used to identify the genotypes of 343 upland cotton materials at the base position of SNP: D05:14762561. The 5' ends of the two upstream primers carried different linker sequences, the 5' end of upstream primer one carried a FAM tag sequence, and the 5' end of upstream primer two carried a HEX tag sequence. The last base at the 3' end of the two upstream primers carries SNP: G or T of the D05:14762561 variation. The two forward primers denature and melt the DNA template at 95° based on the competitive allele-specific polymerase chain reaction (KASP) technology. At a specific annealing temperature, the upland cotton germplasm carrying the GG genotype combines with the upstream primers and extends. The FAM group in the PCR system separates from the quenching group and combines with the FAM tag sequence of the DNA amplification fragment to generate FAM fluorescence (red) and is detected, indicating that the genotype of the material at the 14762561th base of D05 is GG. Similarly, the upland cotton germplasm with the TT genotype combines with the upstream primer 2 and extends. The HEX group in the PCR system separates from the quenching group and combines with the HEX tag sequence of the DNA amplification fragment to produce HEX fluorescence (blue), which is detected, indicating that the genotype of the material at the 14762561st base of D05 is TT. If green light is detected as a mixture of red and blue, it means that the genotype of the material at this site is a GT heterozygous genotype. The KSAP typing results of the above 343 materials are as follows: Figure 3 As shown in the figure, after using KASP to detect the genotype of 343 materials at the SNP, the results showed that the genotype of 237 materials was GG, and the genotype of 106 materials was TT. By comparing with the typing results of SNP: D05: 14762561 in the sequencing data of 343 materials, the KSAP typing results were consistent with the sequencing typing results, proving the reliability of the KASP typing results of 343 materials. Therefore, the genotype of the tested upland cotton germplasm at the SNP: D05: 14762561 mutation can be accurately and intuitively determined by detecting the fluorescence value of the PCR product, providing technical support for molecular marker-assisted upland cotton breeding.
[0063] 3. Detection of fruit node length and plant shape.
[0064] The length of the third fruit node of each material was tested. The testing method was as follows: the length of the first fruit node of the third fruit branch on the main stem of each material was selected as the investigation object, and the length from the first boll to the main stem was measured with a ruler. Five replicates were investigated for each variety, and the average value was taken as the fruit node length value for each material. The following results were obtained, as shown in Table 2.
[0065] Table 2 Test results of upland cotton genotype and fruit node length (only 20 samples are shown)
[0066]
[0067] The results showed that the fruit node length of the variety carrying the GG genotype was significantly longer than that of the variety carrying the TT genotype, as shown in Table 2 and Figure 4 as follows. Moreover, the plant type of the variety carrying the GG genotype was relatively loose, showing a cylindrical shape (the same width from top to bottom), while the variety carrying the TT genotype showed a pyramidal shape (wider at the bottom and narrower at the top), as Figure 5 shown. Genotype analysis indicated that this SNP was a molecular marker related to the fruit node length of upland cotton. In practical applications, the fruit node length of the plant to be tested could be determined by detecting the genotype of the plant to be tested: upland cotton with the GG genotype was long-fruit-node upland cotton, and upland cotton with the TT genotype was short-fruit-node upland cotton. The shorter the fruit node length, the more compact the plant type of the upland cotton, specifically showing a pyramidal shape; the longer the fruit node length, the looser the plant type of the upland cotton, specifically showing a cylindrical shape. Further, the fruit node situations of two upland cottons to be tested could be compared: the fruit node length of upland cotton with the GG genotype was longer than that of upland cotton with the TT genotype, and there was no significant difference in the fruit node length among upland cottons with the same genotype.
[0068] In summary, the present invention also provides the following method for detecting the plant type of upland cotton, which specifically includes the following steps:
[0069] Step 1: Extract the DNA of the upland cotton sample to be tested. The specific extraction process can refer to the process of extracting DNA from 343 upland cotton materials used for KSAP genotyping above.
[0070] Step 2: Use the detection primers (two forward primers and one reverse universal primer) in the above genotyping experiment to perform PCR amplification on the DNA of the upland cotton sample to be tested based on the KASP technology to obtain a PCR amplification product. The specific PCR reaction system refers to the PCR reaction system in the above KASP genotyping experiment process;
[0071] Step 3: Perform fluorescence detection and analysis on the PCR amplification product (the specific fluorescence detection and analysis process can refer to the fluorescence detection in the above KASP genotyping experiment process). When FAM fluorescence is generated, it indicates that the genotype of the upland cotton sample at the above SNP marker is GG; when HEX fluorescence is generated, it indicates that the genotype of the upland cotton sample at the above SNP marker is TT. Among them, upland cotton with the GG genotype is long-fruit-node upland cotton, and upland cotton with the TT genotype is short-fruit-node upland cotton. The shorter the fruit node length, the more compact the plant type of the upland cotton, specifically showing a pyramidal shape; the longer the fruit node length, the looser the plant type of the upland cotton, specifically showing a cylindrical shape.
[0072] In summary, the present invention provides an SNP marker related to the plant type of upland cotton (closely related to the length of fruiting nodes): D05:14762561. This SNP is closely related to the trait of the length of fruiting nodes in upland cotton. The variety with the genotype TT has a significantly shorter fruiting node length than the variety with the genotype GG. And extremely significant differences are shown in all three environments, indicating that this SNP is relatively reliable and stable. It can be used as a molecular marker highly linked to the plant type (length of fruiting nodes) of upland cotton for molecular-assisted breeding to select materials with a compact plant type (shorter fruiting node length). By detecting the genotype of this SNP marker, the plant type (length of fruiting nodes) of the tested upland cotton germplasm can be quickly and accurately judged. Specifically, when the genotype of the tested upland cotton germplasm at this SNP is GG, it is determined as a variety with a loose plant type (longer fruiting nodes), and when the genotype of the tested upland cotton germplasm at this SNP is TT, it is determined as a variety with a compact plant type (shorter fruiting nodes). The present invention can quickly and reliably distinguish or identify varieties with short fruiting nodes at the gene level, and is not affected by the environment and growth and development stages, greatly accelerating the breeding process and improving the accuracy and efficiency of breeding short-fruiting-node varieties. In addition, the SNP variation site provided by the present invention can be used as a target for genetic engineering breeding. By means of mutation, editing, etc., the GG genotype can be mutated into the TT genotype, providing a new, rapid and effective way for the genetic improvement of the fruiting node trait of upland cotton.
[0073] Obviously, those skilled in the art can make various changes and modifications to the technical solution without departing from the spirit and scope of the technical solution. Thus, if these modifications and variations of the technical solution fall within the scope of the claims of the technical solution and its equivalent technologies, the technical solution is also intended to include these changes and modifications.
Claims
1. A detection primer for detecting a SNP marker associated with an upland cotton plant type, characterized in that: The SNP marker is located at the 14762561th base of chromosome 18 D05 of the upland cotton genome, wherein in upland cotton plants with compact plant types, the nucleotide type of the SNP marker is T, and in upland cotton plants with loose plant types, the nucleotide type of the SNP marker is G; The SNP marker is located in the promoter region of 2000 bp upstream of the gene Ghi_D05G08181; the nucleotide sequence of the promoter of 2000 bp upstream of the gene Ghi_D05G08181 is shown in SEQ ID NO. 1; The detection primers include two upstream primers and one downstream primer, wherein the nucleotide sequences of the two upstream primers are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively; and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.
5.
2. The detection primer for detecting a SNP marker associated with upland cotton plant type according to claim 1, characterized in that: The nucleotide sequence of the gene Ghi_D05G08181 is shown in SEQ ID NO.
2.
3. A kit for detecting plant type of upland cotton, characterized in that: The kit comprises the detection primers and PCR amplification reagents according to claim 1.
4. Use of the detection primer according to claim 1 or the kit according to claim 3 in detecting plant type of upland cotton, characterized in that: When the genotype of the upland cotton sample at the SNP marker described in claim 1 is GG, it is an upland cotton variety with a loose plant type; when the genotype of the upland cotton sample at the SNP marker described in claim 1 is TT, it is an upland cotton variety with a compact plant type.
5. A method for detecting plant type of upland cotton, characterized in that: The following steps are involved: Step 1: Extract DNA from the upland cotton sample to be tested; Step 2: using the detection primers described in claim 1 to perform PCR amplification based on KASP technology on the DNA of the upland cotton sample to be tested, to obtain a PCR amplification product; wherein the 5' end of the upstream primer with the nucleotide sequence of SEQ ID NO.3 carries a FAM tag sequence, and the 3' end base is G; the 5' end of the upstream primer with the nucleotide sequence of SEQ ID NO.4 carries a HEX tag sequence, and the 3' end base is T; Step 3: Perform fluorescence detection and analysis on the PCR amplification product. When FAM fluorescence is generated, it indicates that the genotype of the upland cotton sample at the SNP marker described in claim 1 is GG. When HEX fluorescence is generated, it indicates that the genotype of the upland cotton sample at the SNP marker described in claim 1 is TT; wherein the GG genotype is an upland cotton variety with a loose plant type, and the TT genotype is an upland cotton variety with a compact plant type.
Citation Information
Patent Citations
SSR molecular marker for identifying upland cotton plant height and application thereof
CN116024377A
Haptype related to upland cotton plant height and application thereof
CN117248069A