A recombinant CLEC9A gene and its application in improving the immunity and disease resistance of animals

By expressing the recombinant CLEC9A gene in porcine dendritic cells, the problem of lack of CLEC9A expression in pig tissues was solved, the pig's immunity and disease resistance were significantly improved, and a new strategy for improving the disease resistance of pigs was provided.

CN119661686BActive Publication Date: 2025-09-30CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411386945.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-30
Publication Date
2025-09-30
Estimated Expiration
2044-09-30

AI Technical Summary

Technical Problem

Existing technologies have not found the expression of CLEC9A in relevant tissues of pigs, resulting in weakened disease resistance of pigs and affecting the efficiency of genetic improvement and healthy development of pigs.

Method used

Construct a recombinant CLEC9A gene and express it in porcine dendritic cells to improve antigen processing and presentation capabilities, thereby enhancing the pig's immunity and disease resistance.

Benefits of technology

Significantly improve the immunity and disease resistance of pig cells, enhance the pig's antigen processing and presentation capabilities, and enhance its disease resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119661686B_ABST
    Figure CN119661686B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of animal husbandry technology, and in particular to a recombinant CLEC9A gene and its use in improving the immunity and disease resistance of animals. The recombinant CLEC9A protein comprises the amino acid sequence shown in SEQ ID NO.1; the recombinant CLEC9A gene comprises the nucleotide sequence shown in SEQ ID NO.2; and the use includes: improving the immunity and disease resistance of animals. The present invention modifies the porcine CLEC9A gene to obtain a recombinant CLEC9A gene, which can be expressed normally and, when overexpressed in porcine BMDC cells, can significantly increase the expression of genes related to antigen processing and presentation, while also improving their survival and proliferation ability in an LPS-induced environment. This is of great significance in the field of animal husbandry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of animal breeding, and in particular to a recombinant CLEC9A gene and its application in improving the immunity and disease resistance of animals. Background Art

[0002] Currently, in the pursuit of economic benefits in pig farming, researchers often focus excessively on selecting for yield-related traits while neglecting disease resistance. However, with increasing stocking density and reduced animal activity, pigs' disease resistance is gradually weakening. Furthermore, overreliance on antibiotics in farming has led to a growing problem of bacterial resistance. These issues severely restrict the efficiency of pig genetic improvement and pose a threat to the healthy development of the pig industry. With the advancement of biotechnology and molecular genetics research, breeding new pig breeds with greater disease resistance has become a key focus. This not only ensures the healthy growth of pigs but also ensures the safety of pork products. Against this backdrop, animal genetic modification technologies, particularly transgenic and gene editing, demonstrate enormous potential and promising applications. These technologies allow for the convenient and efficient genetic modification of animals, conferring inherited traits such as enhanced disease and stress resistance.

[0003] Cell death is an inevitable physiological response during the body's natural and physiological processes, such as embryonic development and tissue renewal, as well as when exposed to extreme physical and chemical factors or severe pathological stimuli. For example, after viral infection, host cell metabolism is severely disrupted due to viral self-replication and other activities, resulting in damage to organelles and ultimately cell necrosis. C-type lectin 9 family A member (CLEC9A) plays a key role in animal immune recognition. As an activatable type II transmembrane receptor, it is highly expressed on dendritic cells, capable of recognizing cell death signals and promoting cross-presentation of antigens from dying cells to activated cytotoxic T lymphocytes, thereby initiating the body's clearance of dead cells. However, existing studies have not found expression of CLEC9A in relevant pig tissues. Summary of the Invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a recombinant CLEC9A gene and its application in improving the immunity and disease resistance of animals.

[0005] Prior art has not found CLEC9A expression in relevant porcine tissues, likely due to the inability of the porcine CLEC9A gene to express normally. The present invention modifies the porcine CLEC9A gene to generate a recombinant CLEC9A gene. Expressing the recombinant CLEC9A gene in porcine dendritic cells effectively upregulates the expression of genes involved in antigen processing and presentation pathways, demonstrating that the recombinant CLEC9A gene can be used to enhance pig immunity and disease resistance, and potentially for disease-resistant pig breeding.

[0006] In a first aspect, the present invention provides a recombinant CLEC9A protein comprising any one of the following amino acid sequences:

[0007] (1) the amino acid sequence shown in SEQ ID NO. 1;

[0008] (2) The amino acid sequence of a protein with the same function as the amino acid sequence shown in SEQ ID NO. 1 obtained by replacing, inserting or deleting one or more amino acids.

[0009] In a second aspect, the present invention provides a recombinant CLEC9A gene comprising any one of the following nucleotide sequences:

[0010] (1) the nucleotide sequence shown in SEQ ID NO. 2;

[0011] (2) A nucleotide sequence encoding a protein with the same function obtained by replacing, deleting or inserting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO. 2;

[0012] (3) A nucleotide sequence that can hybridize with the nucleotide sequence shown in SEQ ID NO. 2 under stringent conditions.

[0013] The present invention further provides a biological material comprising the recombinant CLEC9A gene; the biological material is an expression cassette, a vector or a cell.

[0014] Furthermore, the cells do not have the ability to develop into a complete plant individual or a complete animal individual.

[0015] The present invention further provides a kit comprising the recombinant CLEC9A protein, the recombinant CLEC9A gene, or the biological material.

[0016] In a third aspect, the present invention provides use of the recombinant CLEC9A protein, or the recombinant CLEC9A gene, or the biomaterial, or the kit in improving the immunity and disease resistance of animals, or improving the activity of animal cells.

[0017] The present invention further provides use of the recombinant CLEC9A protein, or the recombinant CLEC9A gene, or the biomaterial, or the kit in the preparation of a drug for improving the immunity and disease resistance of an animal, or improving the activity of animal cells.

[0018] Furthermore, the improving the immunity and disease resistance of animals includes: improving the antigen processing and presentation ability of animals, or improving the anti-inflammatory ability of animals.

[0019] Furthermore, by increasing the expression level of the recombinant CLEC9A gene, the immunity and disease resistance of animals are improved;

[0020] The recombinant CLEC9A gene includes the nucleotide sequence shown in SEQ ID NO.2.

[0021] Furthermore, the expression level of the recombinant CLEC9A gene is increased by the following method:

[0022] The recombinant CLEC9A gene is constructed on a vector to obtain a recombinant plasmid;

[0023] The recombinant plasmid is transduced into an animal.

[0024] Furthermore, the animal is a pig.

[0025] The present invention has the following beneficial effects:

[0026] This invention innovatively constructs a recombinant CLEC9A gene, derived from the porcine CLEC9A gene through multiple editing methods. Expression of the recombinant CLEC9A gene provided by this invention significantly enhances the immune and disease resistance of pig cells, providing a new strategy for improving pig immunity and new material for research on disease-resistant pig breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction is given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0028] Figure 1 This is the plasmid map of the recombinant CLEC9A plasmid provided in Example 1 of the present invention.

[0029] Figure 2The embodiment 2 of the present invention provides the method of using fluorescence quantitative PCR (qPCR) to detect the mRNA expression of the recombinant CLEC9A gene in pig BMDC cells (HL) expressing the recombinant CLEC9A gene and wild-type pig BMDC cells (NC).

[0030] Figure 3 The immunofluorescence technique provided in Example 2 of the present invention is used to detect the expression of recombinant CLEC9A protein in 293T cells (HL-Flag) expressing the recombinant CLEC9A gene and 293T cells (NC) transfected with an empty vector.

[0031] Figure 4 This is the pathway situation of significantly enriched differentially expressed genes detected by RNA-seq between pig BMDC cells (HL) expressing the recombinant CLEC9A gene and pig BMDC cells (NC) transfected with an empty vector, as provided in Example 3 of the present invention.

[0032] Figure 5 The present invention provides Example 3, which uses CCK-8 to detect the cell activity of pig BMDC cells (HL) expressing the recombinant CLEC9A gene and pig BMDC cells (NC) transfected with an empty vector in an LPS stimulation environment. DETAILED DESCRIPTION

[0033] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0034] Unless otherwise specified, the experimental methods involved in the following examples are all conventional methods in the art. For example, reference can be made to experimental manuals in the art, or the conditions recommended by the manufacturer's instructions.

[0035] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources, for example:

[0036] Example 1

[0037] The present invention provides a construction process for a recombinant CLEC9A gene plasmid, comprising the following steps:

[0038] The present invention first downloaded the porcine CLEC9A gene (accession number: XM_021091240.1) from the NCBI database (http: / / www.ncbi.nlm.nih.gov / ). The porcine CLEC9A gene lacks exon 3, and its CDS region is missing a base at positions 268 and 544 of exons 4 and 6, respectively. This also results in a stop codon at positions 436-438 of exon 5 and 505-507 of exon 6, leading to a frameshift mutation that prevents pigs from expressing the conserved CLEC9A functional protein across species.

[0039] The present invention edits the base sequence of the porcine CLEC9A gene CDS region so that all mutation sites express the same amino acid as the corresponding position in the human CLEC9A gene (accession number: NM_207345.4). A T is inserted at position 268 of the porcine CLEC9A CDS region, resulting in the codon ATC corresponding to ATT isoleucine I at the same position in the human CLEC9A gene. The stop codons at positions 436-438 are changed from TGA to TGG, corresponding to TGG tryptophan W; the stop codons at positions 436-438 are changed from TAG to CAG, corresponding to CAA proline P; and a T is inserted at position 544, resulting in the codon TAC corresponding to TCT serine S. Simultaneously, the human exon 3 sequence is introduced to construct a plasmid similar to the human CLEC9A gene. The resulting recombinant CLEC9A gene has a coding sequence shown in SEQ ID NO. 2, and the protein sequence encoded by the recombinant CLEC9A gene is shown in SEQ ID NO. 1.

[0040] The present invention adds a 3×Flag tag sequence before the last stop codon TGA: GACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAG for subsequent detection. The recombinant sequence was synthesized by a biological company (Beijing Qingke Biotechnology Co., Ltd.) and constructed into the pcDNA3.1 backbone to obtain the target plasmid, named pcDNA3.1-CLEC9A (HL) -Flag (hereinafter also referred to as the recombinant CLEC9A plasmid). The plasmid map is shown in Figure 2. Figure 1 As shown, the sequencing sequence is SEQ ID NO.3.

[0041] Example 2

[0042] This example further transfected the recombinant CLEC9A plasmid constructed in Example 1 and detected the expression level of the recombinant CLEC9A gene, including the following process:

[0043] 1. FLT3L-BMDC cell acquisition and culture

[0044] In the present invention, porcine bone marrow tissue was placed in a 10 cm culture dish containing 10 mL of phosphate-buffered saline (PBS) (Gibco) and dispersed using the rubber tip of a 20 mL syringe plunger. The suspension was passed through a 70 μm diameter filter and collected in a 50 mL centrifuge tube. The cells were repeatedly rinsed with PBS and centrifuged at 1500 rpm for 5 minutes to obtain the final bone marrow cells. The cells were resuspended in 12 mL of DMEM / F12 medium (Gibco), 10% fetal bovine serum, 1% penicillin-streptomycin, and 20 ng / mL of FLT3L protein (from the Institute of Biophysics, Chinese Academy of Sciences) and maintained in a 10 cm culture dish to generate FLT3L-BMDCs (hereinafter referred to as porcine BMDCs).

[0045] 2. Plasmid transfection

[0046] The cells were evenly plated in a 24-well cell culture plate containing DMEM / F12 medium containing 10% fetal bovine serum. When the cell density reached 60%, the cells were incubated with Lipofectamine TM 2000 (Invitrogen) transfection reagent was used. Transfection procedures and detection were performed according to the manufacturer's instructions. Transfection systems are shown in the table below.

[0047]

[0048] 3. qPCR analysis

[0049] Using the porcine HPRT1 gene as an internal reference gene, RNA extraction, reverse transcription, and fluorescence quantitative PCR were performed on porcine BMDC cells transfected with the recombinant CLEC9A plasmid and wild-type porcine BMDC cells to detect the expression of the recombinant CLEC9A gene. The primers are as follows:

[0050]

[0051] The qPCR system is as follows:

[0052]

[0053] Note: ChamQ Universal SYBR qPCR Master Mix is ​​a universal, highly sensitive dye-based quantitative PCR detection kit from Vazyme.

[0054] The qPCR program was as follows: 94°C for 2 min, followed by 94°C for 15 s, 55°C for 15 s, and 72°C for 20 s for 40 cycles. -△△C Methods qPCR data were analyzed.

[0055] The present invention uses qPCR technology to examine the expression level of CLEC9A mRNA in pig BMDC cells transfected with recombinant CLEC9A plasmid. Figure 2 As shown: The recombinant CLEC9A gene can be expressed in porcine BMDCs ( Figure 2 ).

[0056] 4. Use immunofluorescence experiment to detect the expression of recombinant CLEC9A plasmid protein.

[0057] In this study, 293T cells were transfected with the recombinant CLEC9A plasmid as an experimental group, and 293T cells were transfected with pcDNA3.1 as a control group. After reaching approximately 90% confluency, cells were fixed with 4% paraformaldehyde (BeyotimeBio) for 1 hour at room temperature and permeabilized with 0.2% Triton X-100 (BeyotimeBio) for 10 minutes. Cells were then washed twice with PBS and blocked with 10% fetal bovine serum (in PBS) for 20 minutes. Cells were labeled with a primary antibody (Flag, 1:1000) (Abmart) at 4°C overnight. The next day, cells were washed three times with PBS and stained with an Alexa Fluor™ 488 secondary antibody (1:1000) (Solarbio) at room temperature for 1 hour. Cell nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI) (Calbiochem). Fluorescence microscopy (Echo Laboratories) was used for observation.

[0058] The results obtained are as follows Figure 3 Shown: Immunofluorescence experiments demonstrated that the recombinant CLEC9A gene can express the complete CLEC9A protein that is conserved across species.

[0059] Example 3

[0060] The present invention further verifies the function of the recombinant CLEC9A gene described in Example 1, including the following process:

[0061] 1. RNA-seq was used to verify the changes in genes related to antigen processing and presentation after expressing the recombinant CLEC9A gene

[0062] The present invention uses TRIzol ®Total RNA was isolated from cell samples (porcine BMDCs transfected with a recombinant CLEC9A plasmid and porcine BMDCs mock-transfected with pcDNA3.1) using reagents (Tiangen Biochemical Technology (Beijing) Co., Ltd.) according to the manufacturer's instructions. RNA quality and integrity were assessed using a Nanodrop ND-2000 system (Thermo Scientific) and an Agilent Bioanalyzer 4150 system (Agilent Technologies). Paired-end libraries were prepared using the ABclonal mRNA-seq library preparation kit (Abclonal) according to the manufacturer's instructions and sequenced at 150 bp on an Illumina Novaseq 6000 sequencer (Illumina). Sequencing data were quality controlled, filtered, and mapped to the porcine reference genome (Sus scrofa v11.1, GenBank accession number GCF_00003025.6) using HISAT269 v2.1.0. Gene expression was calculated as transcripts per kilobase per million mapped reads (TPM), and differentially expressed genes (DEGs) were analyzed using the R package DESeq270 v1.16.1 with a threshold of p value < 0.05 and |log2FoldChange| ≥ 1. Kyoto Encyclopedia of Genes and Genomes enrichment analysis was performed using the R package ClusterProfiler71 v4.0.

[0063] The results of the top five KEGG pathways and corresponding pathway genes that were significantly enriched for differentially upregulated genes are as follows Figure 4 As shown in the figure, compared to pig BMDCs transfected with the pcDNA3.1 empty vector, the enriched genes with upregulated expression levels in pig BMDCs transfected with the recombinant CLEC9A plasmid were primarily those related to antigen processing and presentation. This indicates that pig BMDCs transfected with the recombinant CLEC9A gene have enhanced antigen processing and presentation capabilities, which are major immune pathways.

[0064] 2. Using CCK-8 detection, it was found that expressing the recombinant CLEC9A gene can significantly enhance the cell activity of pig BMDC cells in LPS culture environment.

[0065] In the present invention, porcine BMDC cells were seeded in 96-well plates and cultured in basal medium. Forty-eight hours after transfection with the recombinant CLEC9A plasmid and the pcDNA3.1 empty vector, the cells were stimulated with lipopolysaccharide (LPS) (BeyotimeBio) for 24 hours, and cell proliferation and activity were detected using the CCK-8 (BeyotimeBio) kit according to the manufacturer's protocol. After incubation for 1 hour, the cells were analyzed using a SpectraMax ® The absorbance at 450 nm was measured using an i3x multi-mode microplate reader (Molecular Devices Corporation).

[0066] The results are as follows Figure 5 As shown in the figure, porcine BMDC cells expressing the recombinant CLEC9A gene showed significantly increased cell viability compared to porcine BMDC cells transfected with an empty vector. Furthermore, in an LPS-induced environment, the cell viability of cells expressing the recombinant CLEC9A gene was significantly increased. This indicates that the recombinant CLEC9A gene can significantly enhance the survival and proliferation of porcine BMDC cells in a bacterially inflammatory environment.

[0067] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A recombinant CLEC9A protein, characterized in that: The amino acid sequence of the recombinant CLEC9A protein is shown in SEQ ID NO.

1.

2. A recombinant CLEC9A gene, characterized in that: The nucleotide sequence of the recombinant CLEC9A gene is shown in SEQ ID NO.

2.

3. A biomaterial, characterized in that The biological material comprises the recombinant CLEC9A gene according to claim 2; the biological material is an expression cassette, a vector or a cell.

4. A kit, characterized in that The kit comprises the recombinant CLEC9A protein according to claim 1, or the recombinant CLEC9A gene according to claim 2, or the biological material according to claim 3.

5. Use of the recombinant CLEC9A protein according to claim 1, or the recombinant CLEC9A gene according to claim 2, or the biomaterial according to claim 3, or the kit according to claim 4 in the preparation of a medicament for improving the anti-inflammatory ability of pigs, wherein the inflammation is caused by bacteria.

6. The use according to claim 5, characterized in that By increasing the expression level of the recombinant CLEC9A gene, the anti-inflammatory ability of pigs is improved.

7. The use according to claim 6, characterized in that The expression level of the recombinant CLEC9A gene was increased by the following method: The recombinant CLEC9A gene is constructed on a vector to obtain a recombinant plasmid; The recombinant plasmid is transduced into an animal.