A safe recombinant bacillus subtilis for synthesizing lactyl-n-neotetraose and a construction method and application thereof

Abstract

The application belongs to the technical field of genetic engineering, and discloses a kind of synthetic lactosyl-N-neotetraose and safe recombinant bacillus subtilis and its construction method and application, the recombinant bacillus subtilis is obtained by transforming plasmid containing beta-1,3-N-acetylglucosamine transferase, beta-1,4-galactosyltransferase gene and lactose permease gene in bacillus subtilis 168.The application aims at the huge demand of lactosyl-N-neotetraose in the market in prior art, and the lactosyl-N-neotetraose produced by most existing engineering bacteria is not safe, provides an engineering bacteria for producing lactosyl-N-neotetraose and application, to meet the demand of lactosyl-N-tetraose in the market.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to a safe recombinant bacillus subtilis for synthesizing lacto-N-neotetraose as well as a construction method and application thereof. BACKGROUND

[0002] Human milk is a natural nourishing agent for infants and has a very significant effect on their growth and development, and has many health-promoting functions that cow's milk does not have. Human milk mainly contains two types of carbohydrates: lactose and human milk oligosaccharides (HMOs). Lactose is one of the main nutritional components of human milk and has a very high nutritional value. Human milk oligosaccharides are the third most abundant component in human milk, next only to lactose and lipids, and are a complex mixture of more than 200 non-digestible and non-nutritive carbohydrates. Lacto-N-neotetraose is the most abundant representative of the non-fucosylated neutral human milk oligosaccharide class in breast milk. Lacto-N-neotetraose plays a crucial role in the health and development of infants, including prebiotic effects, anti-adhesion antibiotics, antiviral protection and immunomodulators. In the study of the differences between various components of human milk and cow's milk, it was found that one of the main differences is the presence of human milk oligosaccharides in human milk, and there are almost none in cow's milk and infant formula on the market. Although non-human milk oligosaccharides, such as galactooligosaccharides (GOS) and fructooligosaccharides (FOS), are added to infant formula as prebiotics, their complexity and specificity cannot match that of human milk oligosaccharides; an example is lacto-N-neotetraose, which is designed for developing infants. In addition, the U.S. Food and Drug Administration (FDA) has designated lacto-N-neotetraose as "generally recognized as safe", and lacto-N-neotetraose can be used as an additive for infant formula. Due to its unique nutritional applications, lacto-N-neotetraose has considerable economic benefits. However, the supply of lacto-N-neotetraose isolated from breast milk is limited, which hinders its use in the food and medical fields. Therefore, the most feasible option is to artificially synthesize lacto-N-neotetraose.

[0003] There are four main methods for the production of lacto-N-neotetraose: chemical hydrolysis, enzymatic conversion, chemical-enzymatic synthesis and microbial fermentation. Although great progress has been made in the synthesis of lacto-N-neotetraose by chemical synthesis, the use of large amounts of organic solvents, harsh reaction conditions, long reaction series and other factors make its production cost expensive. The presence of toxic reagents also limits the wide application of lacto-N-neotetraose in the food field. Although enzymatic synthesis has a good product yield, it is not easy to obtain the necessary enzymes, and sugar nucleotides are required as acceptors for glycosyltransferase catalysis. The high cost and unavailability of the acceptors, as well as the inherent properties of the enzyme such as stability, catalytic efficiency, substrate and acceptor tolerance, all affect the process and make it difficult to produce on a large scale. Chemical-enzymatic synthesis has good stereoselectivity and regioselectivity, high conversion rate, easy separation and purification, but the source of enzymes is insufficient and the substrate adaptability is strict. Compared with the first three methods, microbial fermentation has many advantages such as safety, green, sustainability, high production intensity, short fermentation time, easy operation, low cost, low equipment requirements, low environmental pollution, unlimited production of raw materials, and easy separation of fermentation products. Therefore, the construction of genetically engineered bacteria with high efficiency for the production of lacto-N-neotetraose can effectively solve many problems caused by traditional production methods, and bring great economic benefits to social production development. In recent years, with the continuous development of metabolic engineering and synthetic biology technology, the metabolic pathways of host microorganisms can be artificially designed and modified by engineering techniques. Therefore, it has broad prospects to obtain high production intensity, high conversion rate and high yield of engineering strains for industrial lacto-N-neotetraose production by metabolic engineering and synthetic biology means.

[0004] At present, most of the engineering strains for the production of lacto-N-neotetraose by microbial fermentation use Escherichia coli. However, E. coli is a non-food safety level strain, and the endotoxin secreted by it makes the lacto-N-neotetraose produced by it unsafe for application in food, medicine and other fields. Compared with many other microorganisms in nature, the genetic background of Bacillus subtilis 168 is clear, the genetic manipulation tools are mature, there is no obvious codon bias, and the extracellular protein secretion ability is strong. Compared with E. coli, it does not secrete endotoxin and has been certified by the US Food and Drug Administration as a safe microorganism (Generally Recognized As Safe, GRAS), which can be used as a food safety level strain. Its own metabolic pathway contains the synthesis pathways of uridine diphosphate galactose and uridine diphosphate acetylglucosamine, which can be used as substrates for the synthesis of lacto-N-neotetraose.

[0005] At present, the research on LNnT in Bacillus subtilis is still less, and the yield is low, therefore, how to utilize Bacillus subtilis, ferment and synthesize food safety level lactosyl-N-neotetraose through metabolic engineering modification is a problem to be solved by those skilled in the art. SUMMARY

[0006] The present application aims to overcome the deficiencies in the prior art, and provide a safe recombinant Bacillus subtilis for synthesizing lactosyl-N-neotetraose and a construction method and application thereof.

[0007] The technical scheme adopted by the present application to solve its technical problems is:

[0008] A safe recombinant Bacillus subtilis for synthesizing lactosyl-N-neotetraose, wherein the recombinant Bacillus subtilis is obtained by transforming a plasmid containing a beta-1,3-N-acetylglucosaminyltransferase gene, a beta-1,4-galactosyltransferase gene and a lactose permease gene into Bacillus subtilis 168.

[0009] The sequence of the beta-1,4-galactosyltransferase gene is SEQ ID NO. 1, the sequence of the beta-1,3-N-acetylglucosaminyltransferase is SEQ ID NO. 2, and the sequence of the lactose permease gene is SEQ ID NO. 3.

[0010] Further, the plasmid is pHT01.

[0011] Alternatively, the beta-1,3-N-acetylglucosaminyltransferase is derived from Neisseria meningitidis, the beta-1,4-galactosyltransferase gene is derived from A. actinomycetemcomitans NUM4039, and the lactose permease gene is derived from Escherichia coli.

[0012] Further, the recombinant Bacillus subtilis is obtained by further using a strong promoter P c2up on the glmS encoding glucosamine-6-phosphate synthase in Bacillus subtilis 168, introducing a trp terminator to effectively release the feedback inhibition of the glmS ribozyme, and transforming a plasmid containing a beta-1,3-N-acetylglucosaminyltransferase gene, a beta-1,4-galactosyltransferase gene and a lactose permease gene.

[0013] The construction method of the recombinant Bacillus subtilis as described above comprises the following steps:

[0014] The recombinant plasmid pHT01-Aa-β-1,4-galT-lgt A-lacY was transformed into Bacillus subtilis 168 using the Bacillus subtilis chemical competent cell preparation and transformation method, 10 μg / mL chloramphenicol resistant plate was coated, and 37°C culture was performed for 12 h. The transformants were picked and subjected to colony PCR. A 3573 bp band appeared, and the construction of the recombinant Bacillus subtilis was verified to be successful.

[0015] Further, the construction method of the recombinant plasmid pHT01-Aa-β-1,4-galT-lgt A-lacY comprises the following steps:

[0016] According to the β-1,4-galactosyltransferase gene (BAS48030.1) in A. actinomycetemcomitans NUM4039 published on NCBI, the gene sequence shown as SEQ ID NO. 1 was synthesized after optimization of the Bacillus subtilis preferred codon;

[0017] Using primers Aa-β-1,4-galT-F and Aa-β-1,4-galT-R, the Aa-β-1,4-galT fragment was amplified using the β-1,4-galactosyltransferase gene of SEQ ID NO. 1 as the template, and the sequence fragment of the gene Aa-β-1,4-galT was cloned into the vector pHT01 to construct the plasmid pHT01-Aa-β-1,4-galT;

[0018] According to the β-1,3-N-acetylglucosaminyltransferase gene (Gene ID: 904226) in Neisseria meningitidis MC58 published on NCBI, the gene sequence shown as SEQ ID NO. 2 was synthesized after optimization of the Bacillus subtilis preferred codon;

[0019] Using primers lgtA-F and lgtA-R, the lgtA fragment was amplified using the β-1,3-N-acetylglucosaminyltransferase gene of SEQ ID NO. 2 as the template, and the sequence fragment of the gene lgtA was cloned into the vector pHT01-Aa-β-1,4-galT to construct the plasmid pHT01-Aa-β-1,4-galT-lgtA;

[0020] According to the lactose permease gene (Gene ID: 949083) in Escherichia coli K12 published on NCBI, the gene sequence shown as SEQ ID NO. 3 was synthesized after optimization of the Bacillus subtilis preferred codon;

[0021] Using primers lacY-F and lacY-R, the lacY fragment was amplified using the synthesized lactose permease gene with the gene sequence SEQ ID NO.3 as a template. The sequence fragment of the lacY gene was cloned into the vector pHT01-Aα-β-1,4-galT-lgtA to construct the plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY.

[0022] The application of recombinant Bacillus subtilis in the synthesis of lactoyl-N-neotetrasaccharides, as described above.

[0023] The method for producing lactyl-N-neotetrasaccharide by fermentation of recombinant Bacillus subtilis as described above includes the following steps:

[0024] Select a single colony of the recombinant Bacillus subtilis that has grown and inoculate it into LB liquid medium. Incubate at 37°C and 200 r / min for 12 h.

[0025] The bacterial culture was inoculated into the fermentation medium at an inoculum rate of 2-5%, and cultured at 37°C and a rotation speed of 200 r / min for 48 h. The yield of lactyl-N-neotetrasaccharide was then measured, and it was found to be 2.1 g / L.

[0026] The method for constructing recombinant Bacillus subtilis as described above includes the following steps:

[0027] Using CRISPR-Cas9 technology, the synthesized sequence, SEQ ID NO.4 strong promoter P, was synthesized without scarring before the glms site. c2up The sequence is SEQ ID NO.5trp terminator;

[0028] Using primers glms-UP-F, glms-UP-R, glms-DN-F, and glms-DN-R, and with Bacillus subtilis 168 as a template, the upper and lower homologous arms were amplified. P c2up -F、P c2up -R primers amplify the strong promoter P c2up The fragment includes the upper and lower homologous arms and the strong promoter P. c2up The sequence fragment of the fragment was cloned into the vector PJOE8999 to construct the knock-in plasmid pJOE8999;

[0029] The successfully constructed glms knock-in plasmid is transformed into B. subtilis 168, which is plated on LB plates containing 5 μg / mL kanamycin and 0.2% (mass percentage) mannose to induce the cas9 gene under the control of the mannose-inducible promoter P, and is cultured in a 30°C incubator until single colonies grow; then, the grown colonies are spotted on LB plates without kana using toothpicks, and are cultured at 37°C; the next day, the colonies are streaked on LB plates to obtain more single colonies at 42°C; finally, the colonies are spotted on LB plates containing 5 μg / mL kana and LB plates without kana using toothpicks, and transformants that grow on the LB plates but not on the resistant plates are screened; PCR verification is performed using primers glms-F and glms-R, and a 1935 bp band appears, indicating that the glms knock-in strain is successfully constructed; the recombinant plasmid pHT01-Aα-β-1, 4-galT-lgtA-lacY is transformed into the above glms knock-in strain, and is plated on 10 μg / mL chloramphenicol resistant plates and cultured at 37°C for 12 h; colony PCR is performed on the transformants, and a 3573 bp band appears, indicating that the recombinant B. subtilis BA03 is successfully constructed.

[0030] Use of the recombinant B. subtilis as described above in the synthesis of lactyl-N-neotetraose.

[0031] A method for fermentatively producing lactyl-N-neotetraose using the recombinant B. subtilis as described above, comprising the following steps:

[0032] The grown recombinant B. subtilis BA03 single colonies are inoculated into LB liquid medium, and are cultured at 37°C at a rotation speed of 200 r / min for 12 h;

[0033] The bacterial solution is inoculated into fermentation medium at an inoculation amount of 2-5%, and is cultured at 37°C at a rotation speed of 200 r / min for 48 h; lactyl-N-neotetraose is detected, and the yield is 3.5 g / L;

[0034] Alternatively, the method comprises the following steps:

[0035] The feed batch fermentation is carried out in each 5L bioreactor, a single colony of the grown recombinant bacillus subtilis BA03 is inoculated into LB liquid medium, 37 DEG C, rotation speed 200r / min, and cultured for 12h; the recombinant strain BA03 is cultured in a 1L flask containing 150mL LB medium at a 10% inoculation amount for 8h, and the seed liquid is transferred into a bioreactor with a working volume of 3L; 6mL of isopropyl-beta-D-thiogalactopyranoside (1M IPTG) is added to induce the expression of the heterologous gene; during the whole culture process, the pH value of the fermentation broth is adjusted to 6.8 by automatically adding 28% (v / v, volume percentage) NH40H, the culture temperature is 37 DEG C, the aeration rate is 6VVM, and the rotation speed is 400rpm; 80% of glucose is flowed into the bioreactor at a constant rate of 35mL / h for 12h, 80% of glucose is flowed into the bioreactor at a constant rate of 15mL / h for 24h, and 10-20g / L of lactose is supplemented, and the carbon source is stopped after 48h, and the fermentation is carried out for 72h to obtain the fermentation broth;

[0036] The preparation of isopropyl-beta-D-thiogalactopyranoside (1M IPTG) is as follows: 238.3g of isopropyl-beta-D-thiogalactopyranoside is taken, dissolved in 1L, completely dissolved with distilled water, filtered with a filter in a clean bench into a sterile 2mL EP tube, and stored in a-20 DEG C refrigerator for standby use.

[0037] The application has the advantages and positive effects that:

[0038] 1. The application aims at the huge demand for lactosyl-N-neotetraose in the market in the prior art, and the lactosyl-N-neotetraose produced by most of the existing engineering bacteria is not safe, and provides an engineering bacterium for producing lactosyl-N-neotetraose and application, to meet the demand for lactosyl-N-neotetraose in the market.

[0039] 2. The strain transformed with the plasmid containing the beta-1,3-N-acetylglucosamine transferase gene, the beta-1,4-galactosyltransferase gene and the lactose permease gene is subjected to fermentation analysis, the yield of lactosyl-N-neotetraose is determined by HPLC-RID-UV, and 2.1g / L is obtained in a flask. The yield of LNnT in the bacillus subtilis is increased to 2 times in the patent CN 108410787 A a bacillus subtilis for synthesizing lactosyl-N-neotetraose and a construction method and application thereof.

[0040] 3、The application uses strong promoter Pc2up to improve the expression of the gene encoding glucosamine-6 phosphate synthase glmS, and introduces trp terminator to effectively remove the feedback inhibition of GlmS ribozyme. The yield of lactyl-N-neotetraose is determined by HPLC-RID-UV, which is 3.5g / L in a shake flask and 9.6g / L in a 5L fermenter. The application improves the yield of lactyl-N-neotetraose produced by the existing Bacillus subtilis.

[0041] 4、The application provides a new method for detecting lactyl-N-neotetraose, which uses high performance liquid chromatograph and differential refractometer detector to detect the yield of lactose, lactyl-N-triose II and lactyl-N-neotetraose, and the mode is HPLC-RID-UV, and Sugar-D (250*4.6mm) is used. The method has the advantages of sensitivity and rapidness.

[0042] 5、The strain of the application is a food safety level engineering strain Bacillus subtilis 168 used for producing lactyl-N-neotetraose. The application constructs a plasmid for combined overexpression of beta-1,3-N-acetylglucosaminyltransferase, beta-1,4-galactosyltransferase and lactose permease, and the application uses strong promoter Pc2up to improve the expression of the gene encoding glucosamine-6 phosphate synthase glmS, and introduces trp terminator to effectively remove the feedback inhibition of GlmS ribozyme. The recombinant Bacillus subtilis constructed by the application synthesizes lactyl-N-neotetraose, and the yield thereof in a shake flask can reach 3.5g / L, and the yield thereof in a 5L fermenter can reach 9.6g / L, so that the yield of lactyl-N-neotetraose synthesized by the existing Bacillus subtilis is improved. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 It is a metabolic process schematic diagram of the recombinant Bacillus subtilis for producing lactyl-N-neotetraose in the application;

[0044] Figure 2 It is a map of the recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY constructed in the application;

[0045] Figure 3 It is a PCR verification diagram of the recombinant Bacillus subtilis in the application; wherein, M: DNA Marker; 1: negative control; 2: positive control recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY, 3573bp; 3, 4: verification BA01, BA03 transformants, 3573bp;

[0046] Figure 4High performance liquid chromatogram of lacto-N-neotetraose synthesized by the recombinant Bacillus subtilis in the application; wherein, A: LNnT standard; B: wild type B. subtilis 168; C: recombinant Bacillus subtilis BA03.

[0047] Figure 5 The diagram of the glms knock-in plasmid constructed in the application;

[0048] Figure 6 The PCR verification diagram of the glms knock-in plasmid inserted into Bacillus subtilis 168 in the application; wherein, M: DNA Marker; 1: negative control; 2: positive control glms knock-in plasmid, 1935bp; 3: glms knock-in plasmid inserted into Bacillus subtilis 168, 1935bp. DETAILED DESCRIPTION

[0049] The application is further described below in conjunction with examples, which are descriptive rather than limiting, and cannot be used to limit the protection scope of the application.

[0050] The various experimental operations involved in the specific embodiments are all conventional techniques in the art, and the parts not specifically annotated in the text can be implemented by referring to various commonly used tool books, scientific and technical literature or related instructions, manuals, etc. before the application date.

[0051] The technical scheme adopted by the application to solve its technical problems is:

[0052] A safe recombinant Bacillus subtilis for synthesizing lacto-N-neotetraose, which is obtained by transforming a plasmid containing a beta-1, 3-N-acetylglucosaminyltransferase gene, a beta-1, 4-galactosyltransferase gene and a lactose permease gene into Bacillus subtilis 168;

[0053] The sequence of the beta-1, 4-galactosyltransferase gene is SEQ ID NO. 1, the sequence of the beta-1, 3-N-acetylglucosaminyltransferase is SEQ ID NO. 2, and the sequence of the lactose permease gene is SEQ ID NO. 3.

[0054] More preferably, the plasmid is pHT01.

[0055] Alternatively, the beta-1, 3-N-acetylglucosaminyltransferase is derived from Neisseria meningitidis, the beta-1, 4-galactosyltransferase gene is derived from A. actinomycetemcomitans NUM4039, and the lactose permease gene is derived from Escherichia coli.

[0056] Further, the recombinant Bacillus subtilis is further to glmS encoding glucosamine-6-phosphate synthase using a strong promoter P c2up and importing trp terminator to effectively release the glmS ribozyme feedback inhibition, and transforming the plasmid containing β-1, 3-N-acetylglucosamine transferase, β-1, 4-galactosyltransferase gene and lactose permease gene.

[0057] The construction method of the recombinant Bacillus subtilis as described above comprises the following steps:

[0058] Using Bacillus subtilis chemical competent cell preparation and transformation method, the recombinant plasmid pHT01-Aa-β-1, 4-galT-lgt A-lacY is transformed into Bacillus subtilis 168, coated with 10 μg / mL chloramphenicol resistance plate, 37℃ incubated for 12h, picked the transformants for colony PCR, 3573bp band appeared, verified the construction of recombinant Bacillus subtilis is successful.

[0059] Preferably, the construction method of the recombinant plasmid pHT01-Aα-β-1, 4-galT-lgtA-lacY comprises the following steps:

[0060] According to the β-1, 4-galactosyltransferase gene (BAS48030.1) in A. actinomycetemcomitans NUM4039 published on NCBI, the gene sequence as shown in SEQ ID NO. 1 is synthesized after optimization by Bacillus subtilis preferred codon;

[0061] Using primers Aα-β-1, 4-galT-F and Aα-β-1, 4-galT-R, the β-1, 4-galactosyltransferase gene of SEQ ID NO. 1 is used as a template to amplify Aα-β-1, 4-galT fragment, and the sequence fragment of the gene Aα-β-1, 4-galT is cloned into the vector pHT01 to construct the plasmid pHT01-Aα-β-1, 4-galT;

[0062] According to the β-1, 3-N-acetylglucosamine transferase gene (Gene ID: 904226) in Neisseria meningitidis MC58 published on NCBI, the gene sequence as shown in SEQ ID NO. 2 is synthesized after optimization by Bacillus subtilis preferred codon;

[0063] The lgtA fragment is amplified using primers lgtA-F and lgtA-R, with the synthetic gene sequence of SEQ ID NO. 2 as the template for the β-1, 3-N-acetylglucosaminyltransferase gene, and the sequence fragment of the gene lgtA is cloned into the vector pHT01-Aα-β-1, 4-galT to construct the plasmid pHT01-Aα-β-1, 4-galT-lgtA;

[0064] According to the lactose permease gene (GeneID: 949083) in Escherichia coli K12 published on NCBI, the gene sequence as shown in SEQ ID NO. 3 is synthesized after being optimized by Bacillus subtilis preferred codons;

[0065] The lacY fragment is amplified using primers lacY-F and lacY-R, with the synthetic gene sequence of SEQ ID NO. 3 as the template for the lactose permease gene, and the sequence fragment of the gene lacY is cloned into the vector pHT01-Aα-β-1, 4-galT-lgtA to construct the plasmid pHT01-Aα-β-1, 4-galT-lgtA-lacY.

[0066] The application of the recombinant Bacillus subtilis as described above in the synthesis of lactyl-N-neotetraose.

[0067] The method for producing lactyl-N-neotetraose by fermentation using the recombinant Bacillus subtilis as described above, comprising the following steps:

[0068] Pick the single colony of the recombinant Bacillus subtilis that grows and inoculate it into LB liquid medium, and culture at 37°C, 200r / min for 12h;

[0069] Inoculate the bacterial solution into the fermentation medium at an inoculation amount of 2-5%, and culture at 37°C, 200r / min for 48h, and detect lactyl-N-neotetraose, and the yield is 2.1g / L.

[0070] The construction method of the recombinant Bacillus subtilis as described above, comprising the following steps:

[0071] Using CRISPR-Cas9 technology, a strong promoter P c2up with the sequence of SEQ ID NO. 5 trp terminator is knocked in at the glms site without trace;

[0072] The upper and lower homologous arms are amplified using Bacillus subtilis 168 as the template, using primers glms-UP-F, glms-UP-R, glms-DN-F, and glms-DN-R, and the P c2up -F, P c2up-R primer amplified strong promoter P c2up fragment, the upper and lower homology arms, strong promoter P c2up The sequence fragment was cloned into the vector pJOE8999 to construct a knock-in plasmid pJOE8999;

[0073] The successfully constructed glms knock-in plasmid was transformed into Bacillus subtilis 168, and was plated on an LB plate containing 5 μg / mL kanamycin and 0.2% (mass percentage) mannose to induce the cas9 gene under the control of the mannose-inducible promoter P, and was cultured in a 30°C incubator until single colonies were grown; then, the grown colonies were dotted on an LB plate without kana and were cultured at 37°C; the next day, the colonies were streaked on an LB plate to obtain more single colonies at 42°C; finally, the colonies were dotted on an LB plate containing 5 μg / mL kana and an LB plate without kana, and transformants that grew on the LB plate but not on the resistant plate were screened; PCR verification was performed using primers glms-F and glms-R, and a 1935 bp band appeared, indicating that the glms knock-in strain was successfully constructed; the recombinant plasmid pHT01-Aα-β-1, 4-galT-lgtA-lacY was transformed into the above glms knock-in strain, and was plated on a 10 μg / mL chloramphenicol-resistant plate and was cultured at 37°C for 12 h; colony PCR was performed on the transformants, and a 3573 bp band appeared, indicating that the recombinant Bacillus subtilis BA03 was successfully constructed.

[0074] Use of the recombinant Bacillus subtilis as described above in the synthesis of lactyl-N-neotetraose.

[0075] A method for fermentatively producing lactyl-N-neotetraose using the recombinant Bacillus subtilis as described above, comprising the following steps:

[0076] The grown recombinant Bacillus subtilis BA03 single colonies were inoculated into LB liquid medium, and were cultured at 37°C at a rotation speed of 200 r / min for 12 h;

[0077] The bacterial solution was inoculated into fermentation medium at an inoculation amount of 2-5%, and was cultured at 37°C at a rotation speed of 200 r / min for 48 h; lactyl-N-neotetraose was detected, and the yield was 3.5 g / L;

[0078] Alternatively, the method comprises the following steps:

[0079] The feed batch fermentation was carried out in each 5L bioreactor, and the single colony of the grown recombinant Bacillus subtilis BA03 was inoculated into LB liquid medium, 37°C, 200r / min, and cultured for 12h; the recombinant strain BA03 was cultured in a 1L flask containing 150mL LB medium at 10% inoculation amount for 8h, and the seed liquid was transferred into a bioreactor with a working volume of 3L; 6mL of isopropyl-β-D-thiogalactopyranoside (1M IPTG) was added to induce the expression of the heterologous gene; during the whole culture process, the pH value of the fermentation broth was adjusted to 6.8 by automatically adding 28% (v / v) NH40H, the culture temperature was 37°C, the aeration rate was 6VVM, and the rotation speed was 400rpm; 80% glucose was flowed into the bioreactor at a constant rate of 35mL / h for 12h, 80% glucose was flowed into the bioreactor at a constant rate of 15mL / h for 24h, and 10-20g / L lactose was supplemented, and the carbon source was stopped after 48h, and the fermentation was carried out for 72h to obtain the fermentation broth;

[0080] The preparation of isopropyl-β-D-thiogalactopyranoside (1M IPTG) is as follows: 238.3g of isopropyl-β-D-thiogalactopyranoside was weighed, dissolved in 1L, completely dissolved with distilled water, filtered with a filter in a clean bench into a sterile 2mL EP tube, and stored in a-20°C refrigerator for standby.

[0081] Specifically, the preparation and detection are as follows:

[0082] A recombinant Bacillus subtilis for synthesizing lacto-N-neotetraose, which is obtained by transforming a plasmid containing a β-1,3-N-acetylglucosaminyltransferase gene, a β-1,4-galactosyltransferase gene and a lactose permease gene into Bacillus subtilis 168.

[0083] A recombinant Bacillus subtilis for increasing the yield of lacto-N-neotetraose, which is obtained by further using a strong promoter P c2up on glmS encoding glucosamine-6-phosphate synthase and introducing a trp terminator to effectively release the feedback inhibition of the glmS ribozyme.

[0084] As shown in the metabolic process diagram of the recombinant Bacillus subtilis for producing lacto-N-neotetraose. Figure 1

[0085] Example 1 Construction of recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY ​

[0086] According to the β-1, 4-galactosyltransferase gene (BAS48030.1) in A. actinomycetemcomitans NUM4039 published on NCBI, the gene sequence shown as SEQ ID NO. 1 was synthesized after optimization by Bacillus subtilis preferred codon;

[0087] Using primers Aα-β-1, 4-galT-F and Aα-β-1, 4-galT-R, the Aα-β-1, 4-galT fragment was amplified using the synthesized β-1, 4-galactosyltransferase gene (SEQ ID NO. 1) as a template, and the sequence fragment of the gene Aα-β-1, 4-galT was cloned into the vector pHT01 to construct the plasmid pHT01-Aα-β-1, 4-galT;

[0088] According to the β-1, 3-N-acetylglucosaminyltransferase gene (Gene ID: 904226) in Neisseria meningitidis MC58 published on NCBI, the gene sequence shown as SEQ ID NO. 2 was synthesized after optimization by Bacillus subtilis preferred codon;

[0089] Using primers lgtA-F and lgtA-R, the lgtA fragment was amplified using the synthesized β-1, 3-N-acetylglucosaminyltransferase gene (SEQ ID NO. 2) as a template, and the sequence fragment of the gene lgtA was cloned into the vector pHT01-Aα-β-1, 4-galT to construct the plasmid pHT01-Aα-β-1, 4-galT-lgtA;

[0090] According to the lactose permease gene (Gene ID: 949083) in Escherichia coli K12 published on NCBI, the gene sequence shown as SEQ ID NO. 3 was synthesized after optimization by Bacillus subtilis preferred codon;

[0091] Design using primers lacY-F and lacY-R, the lacY fragment was amplified using the synthesized lactose permease gene (SEQ ID NO. 3) as a template, and the sequence fragment of the gene lacY was cloned into the vector pHT01-Aα-β-1, 4-galT-lgtA to construct the plasmid pHT01-Aα-β-1, 4-galT-lgtA-lacY. As shown in Figure 2 the plasmid map of pHT01-Aα-β-1, 4-galT-lgtA-lacY.

[0092] Example 2 Construction of recombinant Bacillus subtilis BA01.

[0093] The recombinant plasmid pHT01-Aα-β-1, 4-galT-lg tA-lacY was transformed into Bacillus subtilis 168 using the preparation and transformation method of Bacillus subtilis chemical competent cells, and was coated on a chloramphenicol resistance plate at 10 μg / mL and cultured at 37°C for 12 h. An appropriate amount of transformants were picked for colony PCR, and a 3573 bp band appeared, verifying that the recombinant Bacillus subtilis BA01 was successfully constructed. Figure 3 As shown in the figure, lane 2 is the positive control of the recombinant plasmid, and lane 3 verifies the BA01 transformant, proving that the recombinant Bacillus subtilis BA01 is successfully constructed.

[0094] Example 3. Production of lactosyl-N-neotetraose by shake flask fermentation of the recombinant Bacillus BA01.

[0095] The strain was taken out from a -80°C refrigerator, streaked on LB solid medium, and cultured at 37°C for 12 h.

[0096] The grown single colony was picked and inoculated into a test tube containing LB liquid medium, and cultured at 37°C at a speed of 200 r / min for 12 h.

[0097] The bacterial solution was inoculated into a 250 mL conical flask containing 50 mL of fermentation medium at an inoculation amount of 2-5%, and cultured at 37°C at a speed of 200 r / min for 48 h.

[0098] The LB medium is as follows: tryptone 10.0 g / L, yeast extract 5.0 g / L, NaCl 10.0 g / L, dissolved in deionized water, and then diluted to 1.0 L, and the pH is adjusted to 7.0-7.2. The solid medium is added with 1.5% agar powder. Sterilization is performed at 121°C for 20 min.

[0099] The fermentation medium is as follows: glucose 20-60 g / L, lactose 5-25 g / L, yeast extract 6-12 g / L, tryptone 3-6 g / L, (NH4)2SO4 4 g / L, K2HPO4 8.5 g / L, KH2PO4 2.5 g / L, MgSO4·7H2O 3 g / L, CaCl2 0.15 g / L, and the trace element solution is prepared according to the ratio of mg / L: MnSO4 1.7 mg / L, FeSO4·7H2O 56 mg / L, ZnCl2 7.0 mg / L, and the solvent is water.

[0100] Example 4. Establishment of a method for detecting lactosyl-N-neotetraose in fermentation broth.

[0101] The fermentation broth taken during the fermentation process is centrifuged, boiled for 5 min, centrifuged again to obtain supernatant, and the fermentation broth is filtered to a liquid phase vial by using a filter membrane with a pore size of 0.22 μm, and the obtained to-be-tested liquid is detected by using a high performance liquid chromatograph with a differential refractometer detector to detect the contents of lactose, lactosyl-N-tetrasaccharide II and lactosyl-N-neotetraose. The chromatographic conditions are as follows: the mode is HPLC-RID-UV, the column used is Sugar-D (250x4.6 mm), the mobile phase A is 65% acetonitrile, the mobile phase B is 35% water, UV 195 nm, the flow rate is 1 mL / min, the sampling amount is 10 μL, the time is 15 min, the column temperature is 25 °C, and the RID is 30 °C-35 °C.

[0102] Example 5 Construction of glms knock-in plasmid

[0103] The present application uses the promoter Pc2up to enhance the expression of the glucosamine-6-phosphate synthase glmS gene, and in order to prevent the synthesis of the GlcNAc precursor GlcN6P from causing feedback inhibition of glmS activity by the GlmS ribozyme due to overexpression, the trp terminator is introduced to effectively release the feedback inhibition of the GlmS ribozyme.

[0104] The present application uses the CRISPR-Cas9 gene editing technology to insert the trp terminator and the Pc2up promoter gene in front of the B. subtilis 168 glmS gene. The Cas9 endonuclease is targeted to a specific site by a 20-nucleotide guide RNA (gRNA), and homologous recombination using a repair template can achieve chromosomal repair and cell survival, and the gRNA and the repair template can be introduced together on a single plasmid system, such as the plasmid pJOE8999.

[0105] The plasmid used is pJOE8999, and the amino acid sequence of glmS is selected and compared with the predicted N20 sequence through the website http: / / chopchop.cbu.uib.no / . The N20 fragment is obtained by denaturation at 95 °C and continuous renaturation after cooling, and the pJOE8999 plasmid is subjected to Bas1 enzyme digestion, and the N20 fragment is connected.

[0106] Next, the repair template (upstream homologous arm-trp terminator-promoter P c2up -downstream homologous arm) is introduced into the plasmid connected with the N20 fragment at the sal1 enzyme digestion site to achieve chromosomal repair by homologous recombination, and the trp terminator and the Pc2up promoter gene are inserted in front of the B. subtilis 168 glmS gene. The upper and lower homologous arms are obtained by PCR amplification technology using the B. subtilis 168 as a template with the primers glms-UP-F, glms-UP-R, glms-DN-F and glms-DN-R. c2upThe fragment was amplified by PCR with primers P c2up -F, P c2up -R primers. The trp terminator was amplified by PCR with primers glms-UP-R, P c2up -F, P c2up -DN-R. The glms knock-in plasmid was successfully constructed (as shown in the glms knock-in plasmid map). c2up Figure 5

[0107] Example 6 Construction of the glms overexpressing strain BA03.

[0108] The successfully constructed glms knock-in plasmid was transformed into B. subtilis 168. The transformants were plated on LB plates containing 5 μg / mL kanamycin and 0.2% (mass concentration) mannose to induce the cas9 gene under the control of the mannose-inducible promoter P. The plates were incubated at 30 °C until single colonies appeared. Then, the single colonies were picked with toothpicks and plated on LB plates without kanamycin and incubated at 37 °C. The next day, the colonies were streaked on LB plates and incubated at 37 °C to obtain more single colonies. Finally, the colonies were picked with toothpicks and plated on LB plates with and without kanamycin (5 μg / mL). The transformants that grew on the LB plates but not on the resistant plates were selected. PCR was performed using primers glms-F and glms-R, and a 1935 bp band appeared, as shown in Figure 6 Example 7 Shake flask fermentation of recombinant B. subtilis BA03 for production of lactosyl-N-neotetraose. Figure 3

[0109] Example 7 Shake flask fermentation of recombinant B. subtilis BA03 for production of lactosyl-N-neotetraose.

[0110] The strain was taken out from the -80 °C freezer and streaked on LB solid medium and incubated at 37 °C for 12 h.

[0111] ​​​The single colony growing was picked and inoculated into a test tube containing LB liquid medium, 37℃, 200r / min, for 12h.

[0112] The bacterial liquid was inoculated into a 250mL conical flask containing 50mL fermentation medium at an inoculation amount of 2-5%, 37℃, 200r / min, for 48h.

[0113] The LB medium was prepared by dissolving 10.0g / L tryptone, 5.0g / L yeast extract and 10.0g / L NaCl in deionized water, and then adding deionized water to 1.0L, adjusting pH to 7.0-7.2, and adding 1.5% agar powder to the solid medium. The medium was sterilized at 121℃ for 20min.

[0114] The fermentation medium was prepared by dissolving 20-60g / L glucose, 5-25g / L lactose, 6-12g / L yeast extract, 3-6g / L tryptone, 4g / L (NH4)2SO4, 8.5g / L K2HPO4, 2.5g / L KH2PO4, 3g / L MgSO4·7H2O and 0.15g / L CaCl2 in deionized water, and then adding deionized water to 1.0L. The trace element solution was prepared by dissolving 1.7mg / L MnSO4, 56mg / L FeSO4·7H2O and 7.0mg / L ZnCl2 in deionized water.

[0115] Example 8: Establishment of a method for detecting lactosyl-N-neotetraose in fermentation broth.

[0116] The fermentation broth taken during the fermentation process was centrifuged, boiled for 5min, centrifuged again, and the supernatant was obtained. The fermentation broth was filtered through a filter membrane with a pore size of 0.22μm into a liquid phase vial, and the filtrate was obtained by filtering twice. The contents of lactose, lactosyl-N-triose II and lactosyl-N-neotetraose were detected by a high performance liquid chromatograph with a differential refractometer detector. The chromatographic conditions were as follows: mode: HPLC-RID-UV, column: Sugar-D (250×4.6mm), mobile phase A: 65% acetonitrile, mobile phase B: 35% water, UV 195nm, flow rate 1mL / min, sample volume 10μL, time 15min, column temperature 25℃, RID 30℃-35℃.

[0117] More specific implementation details are as follows:

[0118] Specific embodiment 1: Construction of recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY.

[0119] The gene sequence shown as SEQ ID NO. 1 was synthesized according to the β-1, 4-galactosyltransferase gene (BAS48030.1) in A. actinomycetemcomitans NUM4039 published on NCBI, and optimized by the preferred codon of Bacillus subtilis.

[0120] The primer Aα-β-1, 4-galT-F and Aα-β-1, 4-galT-R were used to amplify the Aα-β-1, 4-galT fragment with the synthesized β-1, 4-galactosyltransferase gene as the template.

[0121] The sequences of Aα-β-1, 4-galT-F and Aα-β-1, 4-galT-R are as follows:

[0122] Aα-β-1, 4-galT-F: ATTA AAGGAGGAAGGGATCCATGAACAGCACAGAAAAC

[0123] Aα-β-1, 4-galT-R: GACGTCGACTCTAGATTAGTGTTTTCTTTTTTCATATTTTAAG

[0124] The PCR reaction system was as follows: 2x Phanta Max Buffer 25 μL, dNTP Mix (10 mM) 1 μL, upstream primer Aα-β-1, 4-galT-F and downstream primer Aα-β-1, 4-galT-R (10 μM) 2 μL each, template 0.5 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, and sterile water to a final volume of 50 μL.

[0125] The PCR reaction conditions were as follows: 95 °C pre-denaturation for 3 min, 95 °C denaturation for 15 s, 57 °C annealing for 15 s, 72 °C extension for 50 s, 30 cycles of reaction, and 70 °C post-extension for 5 min.

[0126] After the PCR, the complete nucleotide sequence of the target fragment was obtained, and the band was observed by agarose gel electrophoresis, which was 772 bp. The band was recovered by an agarose gel electrophoresis recovery box. After the plasmid pHT01 was treated with BamHI enzyme, the band was observed by agarose gel electrophoresis, which was 7956 bp. The band was recovered by an agarose gel electrophoresis recovery box. The recovered Aα-β-1, 4-galT fragment and the pHT01 fragment were subjected to ligation treatment, the ligation product was transformed into E. coli JM109 competent cells, and the cells were uniformly plated on LB plates with ampicillin resistance (100 μg / mL) and cultured at 37 °C overnight.

[0127] Connection system: carrier 50-200 ng, fragment 10-200 ng, 5 x CE II Buffer 4 μL, Exnase II 2 μL, ddH2O to 20 μL.

[0128] Enzymatic digestion system: BamHI enzyme 5 μL, plasmid 0.5 μL, 10 x Buffer 10 μL, add sterile water to a final volume of 20 μL, 37°C / 30 min.

[0129] Chemical transformation of E. coli and detection of clones:

[0130] 1) Take E. coli competent cells stored at -80°C and place on ice for 5 min;

[0131] 2) Add the enzyme digestion product or recombination product to the competent cells under sterile conditions (20 μL / 100 μL), mix well with a gun;

[0132] 3) Place the mixture on ice for 30 min;

[0133] 4) Heat shock at 42°C for 90 s, quickly place on ice for 5 min;

[0134] 5) Add 900 μL of LB liquid medium, shake at 37°C for 45 min;

[0135] 6) Centrifuge at 5000 rpm and 4°C for 5 min, discard the supernatant, resuspend the bacterial cells with about 100 μL of supernatant, evenly spread the resuspension on LB solid plates containing 100 μg / mL Amp, and incubate at 37°C overnight.

[0136] Pick single colonies for colony PCR verification:

[0137] Use pHT01-F and pHT01-R primers to pick single colonies for colony PCR verification.

[0138] Observe the band by agarose gel electrophoresis, which is 1159 bp, extract the plasmid from the correct colonies, and sequence the successfully digested plasmid to verify that the recombinant plasmid pHT01-Aα-β-1,4-galT is successfully constructed.

[0139] The sequences of the pHT01-F and pHT01-R primers are:

[0140] pHT01-F: GATGACCTCGTTTCCACC

[0141] pHT01-R: GAGCTTCGTCCAAAATATACTG

[0142] Colony PCR verification system: Taq DNA polymerase 50 μL, template 0.5 μL, pHT01-F and pHT01-R 4 μL each, add sterile water to a final volume of 100 μL.

[0143] The PCR reaction conditions are: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 24 s, 72°C extension for 18 s, 30 cycles of reaction, and 5 min of post-extension at 70°C.

[0144] According to the β-1, 3-N-acetylglucosaminyltransferase gene (Gene ID: 904226) in Neisseria meningitidis MC58 published on NCBI, the gene sequence shown as SEQ ID NO. 2 was synthesized after optimization of the preferred codon of Bacillus subtilis.

[0145] Using primers lgtA-F and lgtA-R, the lgtA fragment was amplified with the synthesized β-1, 3-N-acetylglucosaminyltransferase gene as the template, and the band was observed by agarose gel electrophoresis, with a size of 1099 bp.

[0146] After XbaI enzyme treatment of the plasmid pHT01-Aα-β-1, 4-galT, the band was observed by agarose gel electrophoresis, with a size of 8592 bp. The fragment was recovered by agarose gel electrophoresis recovery box, and the recovered lgtA fragment and pHT01-Aα-β-1, 4-galT vector were subjected to ligation treatment. The ligation product was transformed into E. coli JM109 competent cells, and uniformly coated on LB plates with ampicillin resistance (100 μg / mL), and cultured at 37°C overnight.

[0147] The lgtA-F and lgtA-R primer sequences are as follows:

[0148] lgtA-F: CTGTGGAGAAAATAATCTAGAGGAGGTATTAATA ATGCCGTCAGAAGCAT TTAG

[0149] lgtA-R: CCCGGGGACGTCGAC TTATCTATTTTTCAGCAGTCTATGCAG

[0150] The PCR reaction system is: 2×PhantaMax Buffer 25 μL, dNTP Mix (10 mM) 1 μL, upstream primer lgtA-F and downstream primer lgtA-R (10 μM) 2 μL each, template 0.5 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, add sterile water to a final volume of 50 μL.

[0151] PCR reaction conditions: 95℃ pre-denaturation 3 min, 95℃ denaturation 15 s, 57℃ annealing 15 s, 72℃ extension 50 s, 30 cycles of reaction, 70℃ post-extension 5 min.

[0152] Ligation system: carrier 50-200 ng, fragment 10-200 ng, 5x CE II Buffer 4 μL, Exnase II 2 μL, ddH2O to 20 μL.

[0153] Enzymatic digestion system: XbaI enzyme 5 μL, plasmid 0.5 μL, 10x Buffer 10 μL, sterile water to a final volume of 20 μL, 37℃ / 30 min.

[0154] Detection of heat chemical transformation of E. coli and cloning of E. coli

[0155] 1) Take E. coli competent cells stored at -80℃ and place on ice for 5 min;

[0156] 2) Add the enzyme-digested ligation product or recombination ligation product to the competent cells under sterile conditions (20 μL / 100 μL), mix well with a gun;

[0157] 3) Place the mixture on ice for 30 min;

[0158] 4) Heat shock at 42℃ metal bath for 90 s, quickly place on ice for 5 min;

[0159] 5) Add 900 μL of LB liquid medium, shake on a shaker at 37℃ for 45 min;

[0160] 6) Centrifuge at 5000 rpm, 4℃ for 5 min, discard the supernatant, resuspend the bacterial cells with about 100 μL of supernatant, evenly spread the resuspension on LB solid plates containing 100 μg / mL Amp, and incubate at 37℃ overnight.

[0161] Pick single colonies for colony PCR verification

[0162] Use pHT01-F and pHT01-R primers to pick single colonies for colony PCR verification

[0163] Observe the band by agarose gel electrophoresis, which is 2222 bp, extract the plasmid from the correct colonies, and sequence the successfully enzyme-digested plasmid, through sequencing, verify that the recombinant plasmid pHT01-Aα-β-1,4-galT--lgtA is successfully constructed.

[0164] The sequences of the pHT01-F and pHT01-R primers are as follows:

[0165] pHT01-F: GATGACCTCGTTTCCACC

[0166] pHT01-R: GAGCTTCGTCCAAAATATACTG

[0167] Colony PCR verification system: Taq DNA polymerase 50 μL, template 0.5 μL, pHT01-F and pHT01-R 4 μL each, add sterile water to a final volume of 100 μL.

[0168] The PCR reaction conditions are: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 24 s, 72°C extension for 18 s, 30 cycles of reaction, and 5 min of post-extension at 70°C.

[0169] According to the lactose permease gene (GeneID: 949083) in Escherichia coli K12 published on NCBI, the gene sequence shown in SEQ ID NO. 3 is synthesized after optimization by Bacillus subtilis preferred codon.

[0170] Using the above primers lacY-F and lacY-R, the lacY fragment with a size of 1324 bp is amplified using the synthesized lactose permease gene as a template.

[0171] After SmaI enzyme treatment of the plasmid pHT01-Aα-β-1, 4-galT-lgtA, the band is observed by agarose gel electrophoresis, which is 9751 bp.

[0172] Wherein the sequences of the lacY-F and lacY-R primers are

[0173] lacY-F: AAAATAGATAAGTCGACGTCACTAGTAGAAGGAGGATTATTA ATGTATTA TCTGAAAAATACAAATTTTTGG

[0174] lacY-R: CCGCTCATTAGGCGGGCTGCCCCGGGGA TTATGCAACTTCATTAACTTGTC TTC

[0175] The PCR reaction system is: 2x Phanta Max Buffer 25 μL, dNTP Mix (10 mM) 1 μL, upstream primer lacY-F and downstream primer lacY-R (10 μM) 2 μL each, template 0.5 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, add sterile water to a final volume of 50 μL.

[0176] PCR reaction conditions: 95°C pre-denaturation 3 min, 95°C denaturation 15 s, 57°C annealing 15 s, 72°C extension 50 s, 30 cycles, 70°C post-extension 5 min.

[0177] The recovered fragment and the enzyme-digested vector were recovered by agarose gel electrophoresis. The recovered lacY fragment and the pHT01-Aa-β-1, 4-galT-lgtA fragment were subjected to ligation treatment, and the ligation product was transformed into E. coli JM109 competent cells and uniformly coated on LB plates with ampicillin resistance (100 μg / mL) and cultured at 37°C overnight.

[0178] Ligation system: 50-200 ng of vector, 10-200 ng of fragment, 4 μL of 5x CE II Buffer, 2 μL of Exnase II, and ddH2O to 20 μL.

[0179] Enzyme digestion system: 5 μL of Smal enzyme, 0.5 μL of plasmid, 10 μL of 10x Buffer, and sterile water to a final volume of 20 μL, 37°C / 30 min.

[0180] Chemical transformation of E. coli and detection of clones:

[0181] 1) Take E. coli competent cells stored at -80°C and place on ice for 5 min;

[0182] 2) Add the enzyme-digested ligation product or the recombined ligation product to the competent cells under sterile conditions (20 μL / 100 μL), and mix uniformly with a gun;

[0183] 3) Place the mixture on ice for 30 min;

[0184] 4) Heat shock at 42°C for 90 s, and quickly place on ice for 5 min;

[0185] 5) Add 900 μL of LB liquid medium, and recover at 37°C for 45 min;

[0186] 6) Centrifuge at 5000 rpm and 4°C for 5 min, discard the supernatant, resuspend the bacterial cells with about 100 μL of supernatant, and uniformly coat the resuspension on LB solid plates containing 100 μg / mL Amp, and culture at 37°C overnight.

[0187] Pick single colonies for colony PCR verification:

[0188] Use pHT01-F and pHT01-R primers to pick single colonies for colony PCR verification.

[0189] The transformant was verified using primers pHT01-F and pHT01-R, with a size of 3500 bp. Through sequencing, it was verified that the recombinant plasmid pHT01-Aa-β-1, 4-galT-lgtA-lacY was successfully constructed. As shown in the plasmid map of pHT01-Aa-β-1, 4-galT-lgtA-lacY. Figure 2

[0190] The primer sequences of pHT01-F and pHT01-R are as follows:

[0191] pHT01-F: GATGACCTCGTTTCCACC

[0192] pHT01-R: GAGCTTCGTCCAAAATATACTG

[0193] Colony PCR verification system: Taq DNA polymerase 50 μL, template 0.5 μL, pHT01-F and pHT01-R each 4 μL, add sterile water to a final volume of 100 μL.

[0194] The PCR reaction conditions are as follows: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 24 s, 72°C extension for 18 s, 30 cycles of reaction, and 5 min of post-extension at 70°C.

[0195] Specific embodiment 2: Construction of recombinant Bacillus subtilis BA01.

[0196] The recombinant plasmid pHT01-Aa-β-1, 4-galT-lgtA-lacY was transformed into Bacillus subtilis 168, and the specific Bacillus subtilis chemically competent cell preparation and transformation method was as follows:

[0197] (1) The strain Bacillus subtilis 168 was streaked on LB plates and incubated at 37°C overnight;

[0198] (2) In a sterile test tube, add 4 mL of LB, pick a single colony, and incubate at 37°C, 200 r / min on a shaker overnight;

[0199] (3) Add 2.5 mL of SPI medium to the test tube, and transfer 100 μL of the above bacterial solution to the test tube. Incubate at 37°C for 2.5 h, and measure the OD 600 to be 1.1-1.3;

[0200] (4) Add 2 mL of SPII medium to the test tube, and transfer 200 μL of the bacterial solution to the test tube. Incubate at 37°C for 1.5 h;

[0201] (5) Add 20 μL of 10 mM EGTA, and incubate at 37°C on a shaker at 100 r / min for 1.5 h; ​

[0202] (6) Add plasmid pHT01-Aα-β-1, 4-galT-lgtA-lacY, 37°C, 100r / min, cultivate for 1h;

[0203] (7) Adjust the rotation speed to 220r / min, cultivate for 1.5h;

[0204] (8) Take 100μL bacterial solution, and plate on LB plate containing chloramphenicol resistance (10μg / mL);

[0205] (9) Place the plate in a 37°C incubator and cultivate overnight.

[0206] Pick the right amount of transformants for colony PCR verification, use primers pHT01-F and pHT01-R, the correct transformant band is 3500bp, verify the construction of recombinant B. subtilis BA01. As shown in lane 2, the recombinant plasmid positive control, lane 3 verifies the BA01 transformant, proving the successful construction of recombinant B. subtilis BA01 Figure 3

[0207] Sp medium: weigh 18.34g / L K2HPO4, 6g / L KH2PO4, 2g / L (NH4)2SO4, 0.2g / L MgSO4·7H2O, 1g / L sodium citrate, solvent is water. 121℃ sterilization for 20min.

[0208] Single configuration: 50g / L casein hydrolysate, 100g / L yeast extract, 500g / L glucose, 106.2g / L MgCl2·6H2O, 147g / L CaCl2, solvent is water. 121℃ sterilization for 20min. Used in subsequent experiments.

[0209] SpI medium: under sterile conditions in a clean bench, 100mL Sp medium was taken out 2.4mL, 400μL casein hydrolysate, 1mL yeast extract, 1mL glucose was added.

[0210] SpII medium: under sterile conditions in a clean bench, 100mL SpI medium was taken out 1mL, 500μL MgCl2·6H2O, 500μL CaCl2 was added. After preparation, SpI medium and SpII medium were placed in 4℃ refrigerator for standby.

[0211] Ethylene glycol bis-tetraacetic acid (EGTA solution): each weighing 3.80g, dissolved in 1L, completely dissolved with distilled water, adjusted to pH 8.0 with NaOH, filtered with filter in a sterile 2mL EP tube in a clean bench, stored in -20℃ refrigerator for standby.

[0212] ​Example 3 Fermentation of recombinant Bacillus subtilis BA01 to produce lactosyl-N- neotetraose.

[0213] The seed liquid of Example 2 was inoculated into 250 mL conical flask containing 50 mL fermentation medium at 2-5% inoculation amount, and incubated at 37°C with 200 r / min for 3.5 h, then 100 μL of isopropyl-β-D-thiogalactoside (1M IPTG) was added to induce the expression of heterologous genes. The fermentation was carried out for 48 h. 2 mL of fermentation broth was taken every 12 h to measure the cell density and yield. The fermentation broth was centrifuged at 4°C, 12000 r / min for 10 min, and the supernatant was kept in a refrigerator at -20°C. The cell density was expressed as the absorbance at 600 nm, and the sample was diluted to control the absorbance of the diluted solution between 0.2 and 0.8. The yield of the strain was determined by high performance liquid chromatography with a refractive index detector, and the yield of lactosyl-N-neotetraose produced by recombinant Bacillus subtilis BA01 was calculated to be 2.1 g / L.

[0214] Preparation of isopropyl-β-D-thiogalactoside (1M IPTG): 238.3 g of isopropyl-β-D- thiogalactoside was weighed and dissolved in 1 L of distilled water. After complete dissolution, the solution was filtered with a filter in a clean bench into sterile 2 mL EP tubes, and stored in a refrigerator at -20°C for standby use.

[0215] Example 4 Method for detecting lactosyl-N-neotetraose in fermentation broth.

[0216] The fermentation broth taken during fermentation was centrifuged, boiled for 5 min, centrifuged again to obtain the supernatant, and then filtered into a liquid phase vial with a filter membrane with a pore size of 0.22 μm. The fermentation broth was filtered twice to obtain the test solution, and the contents of lactose, lactosyl-N-triose II, and lactosyl-N-neotetraose were determined by high performance liquid chromatography with a refractive index detector. The chromatographic conditions were as follows: mode: HPLC-RID-UV, column: Sugar-D (250 x 4.6 mm), mobile phase A: 65% acetonitrile, mobile phase B: 35% water, UV 195 nm, flow rate 1 mL / min, sample volume 10 μL, time 15 min, column temperature 25°C, RID 30°C-35°C.

[0217] Example 5 Construction of knock-in plasmid pJOE8999

[0218] The present application uses the promoter Pc2up to enhance the expression of the glmS gene encoding glucosamine-6-phosphate synthase, and in order to prevent the feedback inhibition of GlcN6P precursor GlcNAc caused by overexpression of the GlmS ribozyme, the trp terminator is introduced to effectively release the feedback inhibition of the GlmS ribozyme.

[0219] The present application uses CRISPR-Cas9 gene editing technology to insert trp terminator and Pc2up promoter genes in front of the B. subtilis 168 glmS gene (sequence is the field known B. subtilis 168 itself gene). Cas9 endonuclease is targeted to a specific site by 20 nucleotide guide RNA (gRNA), and using a cloning repair template for homologous recombination can achieve chromosome repair and cell survival, gRNA and repair template can be introduced together on a single plasmid system, such as plasmid pJOE8999.

[0220] The use of plasmid is pJOE8999, the amino acid sequence of glmS is selected, and the predicted N20 sequence is compared through the website http: / / chopchop.cbu.uib.no / . The N20 fragment (sequence is the field known and can be searched on the website, and the sequence is underlined in the primer) is obtained by denaturation at 95°C and continuous renaturation after cooling, pJOE8999 plasmid is subjected to Bas1 enzyme cutting, and the N20 fragment is connected.

[0221] Next, the repair template (upstream homologous arm-trp terminator-promoter P c2up -downstream homologous arm) is introduced into the plasmid connected with the N20 fragment at the sal1 enzyme cutting site, and when homologous recombination is carried out to achieve chromosome repair, the trp terminator (sequence is SEQ ID NO. 5) and Pc2up (sequence is SEQ ID NO. 4) promoter genes are inserted in front of the B. subtilis 168 glmS gene. The upstream and downstream homologous arms are obtained by PCR amplification technology using B. subtilis 168 as a template with primers glms-UP-F, glms-UP-R, glms-DN-F and glms-DN-R. c2up The strong promoter P c2up -F and P c2up -R primers by PCR amplification technology, wherein the trp terminator is amplified by primers glms-UP-R and P c2up -F (the trp terminator is provided with a terminal base by two primers, and according to the primers, the upstream homologous arm and P c2up The fragment is obtained when the connection is made, and the method is known in the art. c2up The strong promoter P c2up -downstream homologous arm is obtained by overlapping PCR homologous recombination with primers glms-UP-F and glms-DN-R. The plasmid connected with the N20 fragment is subjected to sal1 enzyme cutting, and the upstream homologous arm-trp terminator-promoter P c2up- downstream homology arm ligation, successful construction of glms knock-in plasmid (as shown in glms knock-in plasmid map) Figure 5

[0222] glms (N20-F) and glms (N20-R), glms-UP-F, glms-UP-R, glms-DN-F, glms-DN-R, P c2up -F, P c2up -R primer sequences are as follows:

[0223] glms (N20-F): TACG TCTCCTTTTACAATCTTAGG

[0224] glms (N20-R): AAAC CCTAAGATTGTAAAAGGAGA

[0225] glms-UP-F: TAATACGACTCACTATAGGGTCGACGAAGTTGAAAAAGAAATGAACG G

[0226] glms-UP-R: AAAGCTGCCAATGACGGCAGCTTTTTTTCCACT AAGATTGTAAAAGGAGACGAAG

[0227] glms-DN-F: AACATGTTATACTATAATAGAGGAGGAAGAAAAATATGTGTG

[0228] glms-DN-R: GGCCCGGGCCTCGTTGGCCGTCGACCCATTTCTTTATCCATCAGCTC

[0229] P c2up -F: AGCTGCCGTCATTGGCAGCTTTTTTTATATCCT TGAGAATTCCTAACAACTAA ATCAC

[0230] P c2up -R: ACACATATTTTTCTTCCTCCTCTATTATAGTATAACATGTTAAACGATAG

[0231] The PCR reaction system is as follows: 2x Phanta Max Buffer 25 μL, dNTP Mix (10 mM) 1 μL, upstream primer and downstream primer (10 μM) 2 μL each, template 0.5 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, and sterile water to a final volume of 50 μL.

[0232] ​PCR reaction conditions: 95°C pre-denaturation 3 min, 95°C denaturation 15 s, 55°C annealing 15 s, 72°C extension 50 s, 30 cycles, 70°C post-extension 5 min.

[0233] After PCR, the complete nucleotide sequence of the target fragment was obtained, and the band was observed by agarose gel electrophoresis. The length of the upstream homologous arm-trp terminator-promoter P c2up The fragment lengths were 638 bp, 694 bp, and 162 bp, respectively. The fragments were recovered by agarose gel electrophoresis. The upstream homologous arm-trp terminator-promoter P c2up The downstream homologous arm was obtained by overlapping PCR technology using primers glms-UP-F and glms-DN-R. After PCR, the complete nucleotide sequence of the target fragment was obtained, and the band was observed by agarose gel electrophoresis. The length was 1431 bp. The fragments were recovered by agarose gel electrophoresis. After SalI enzyme treatment of the plasmid pJOE8999, the band was observed by agarose gel electrophoresis, which was 7405 bp. The fragments were recovered by agarose gel electrophoresis. The recovered upstream homologous arm-trp terminator-promoter P c2up The downstream homologous arm fragment and the pJOE8999 vector were connected, and the connection product was transformed into E. coli JM109 competent cells, and uniformly coated on LB plates with kanamycin resistance (5 μg / mL), and cultured at 37°C overnight.

[0234] Connection system: carrier 50-200 ng, fragment 10-200 ng, 5×CE II Buffer 4 μL, Exnase II 2 μL, ddH2O to 20 μL.

[0235] Enzyme digestion system: SalI enzyme 5 μL, plasmid 0.5 μL, 10×Buffer 10 μL, sterile water to a final volume of 20 μL, 37°C / 30 min.

[0236] Chemical transformation of E. coli and detection of cloned E. coli

[0237] 1) Take the E. coli competent cells stored at -80°C and place on ice for 5 min;

[0238] 2) Add the enzyme-digested or recombined connection product to the competent cells under sterile conditions (20 μL / 100 μL), and mix well with a gun;

[0239] 3) Place the mixture on ice for 30 min;

[0240] 4) Heat shock at 42°C metal bath for 90 s, and quickly place on ice for 5 min;

[0241] 5) Add 900 μL LB liquid medium, 37°C shaking table recovery 45 min;

[0242] 6) 5000 rpm, 4°C low temperature centrifugation 5 min, pour off the supernatant, reserve about 100 μL supernatant to resuspend the bacteria, evenly spread the resuspension on LB solid plate containing kanamycin resistance (5 μg / mL), 37°C overnight culture.

[0243] Pick single colonies for colony PCR verification:

[0244] Use PJF and PJR primers to pick single colonies for colony PCR verification;

[0245] Observe the band by agarose gel electrophoresis, which is 1878 bp, extract the plasmid from the correct colony, and perform sequencing on the successfully enzyme-digested plasmid. Through sequencing, it is verified that the knock-in plasmid pJOE8999 is successfully constructed.

[0246] The sequences of the primers PJF and PJR are as follows:

[0247] PJF: CCCCTATGTTTTCTCCCC

[0248] PJR: CTGGTCTTTATGAAACACGC

[0249] Colony PCR verification system: Taq DNA polymerase 50 μL, template 0.5 μL, PJF and PJR each 4 μL, add sterile water to a final volume of 100 μL.

[0250] The PCR reaction conditions are as follows: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 24 s, 72°C extension for 18 s, 30 cycles of reaction, and 70°C post-extension for 5 min.

[0251] Specific embodiment 6 Construction of glms gene overexpressing strain BA03.

[0252] Successfully constructed glms knock-in plasmid was transformed into B. subtilis 168, which was plated on LB plates containing 5 μg / mL kanamycin and 0.2% (mass fraction) mannose, and the cas9 gene was induced under the control of the mannose inducible promoter P, and cultured in a 30°C incubator until single colonies grew. Then, the grown colonies were picked with a toothpick on LB plates without kana, and cultured at 37°C; the next day, the colonies were streaked on LB plates at 42°C to obtain more single colonies. Finally, the colonies were picked with a toothpick on LB plates containing kana (5 μg / mL) and LB plates without kana, and the transformants that grew on the LB plates but not on the resistant plates were selected. PCR verification was performed using primers glms-F and glms-R, and a 1935 bp band appeared, as shown inFigure 6 As shown in FIG. 6, the glms knock-in strain was successfully constructed. The recombinant plasmid pHT01-Aa-β-1, 4-galT-lgtA-lacY was transformed into the above-mentioned glms knock-in strain, and 10 μg / mL chloramphenicol-resistant plates were coated and cultured at 37°C for 12 h. An appropriate amount of transformants was picked for colony PCR, and a 3573 bp band appeared, verifying that the recombinant B. subtilis BA03 was successfully constructed. As shown in FIG. 7, lane 2 is the positive control of the recombinant plasmid, and lane 4 verifies the BA03 transformant, proving that the recombinant B. subtilis BA03 was successfully constructed. Figure 3

[0253] The sequences of the glms-F and glms-R primers are as follows:

[0254] glms-F: CTACAATGGGGACTTCCC

[0255] glms-R: CATGTAGTGAGGGTACGTG

[0256] Specific Embodiment 7. Shake flask fermentation of recombinant B. subtilis BA03 for production of lactosyl-N-tetrasaccharide.

[0257] The overnight seed liquid was inoculated into a 250 mL conical flask containing 50 mL fermentation medium at an inoculation amount of 2-5%, and cultured at 37°C and a rotation speed of 200 r / min for 3.5 h. Then, 100 μL of isopropyl-β-D-thiogalactoside (1M IPTG) was added to induce expression of the heterologous gene. The culture was incubated for 48 h. Every 12 h, 2 mL of fermentation broth was taken to measure the cell density of the bacteria and the yield. The fermentation broth taken each time was centrifuged at 4°C and a rotation speed of 12000 r / min for 10 min. The supernatant was taken and stored in a refrigerator at -20°C. The cell density of the bacteria was represented by the absorbance at a wavelength of 600 nm. The sample was diluted, and the absorbance of the diluted solution was controlled to be between 0.2 and 0.8. The yield of the strain was detected by high-performance liquid chromatography with a differential refractive index detector (as shown in FIG. 8), and the yield of lactosyl-N-neotetraose produced by the recombinant B. subtilis BA03 was calculated to be 3.5 g / L, which was 66.7% higher than the yield of lactosyl-N-neotetraose produced by the recombinant B. subtilis BA01, and had exceeded the highest yield of lactosyl-N-neotetraose produced by the recombinant B. subtilis reported so far. Figure 4 Preparation of isopropyl-β-D-thiogalactoside (1M IPTG): 238.3 g of isopropyl-β-D-thiogalactoside was weighed and dissolved in 1 L of distilled water. After complete dissolution, the solution was filtered with a filter in a clean bench into a sterile 2 mL EP tube, and stored in a refrigerator at -20°C for standby use.

[0258]

[0259] ​​Example 8. Production of lactosyl-N-neotetraose by recombinant Bacillus subtilis BA035 in a 5 L bioreactor fed-batch fermentation.

[0260] The feed batch fermentation was carried out in a 5 L bioreactor. The recombinant B. subtilis single colony was inoculated into LB liquid medium at 37 °C, 200 r / min, for 12 h. The recombinant strain BA03 was inoculated into a 1 L flask containing 150 mL LB medium at 10% inoculation amount, and cultured for 8 h. The seed liquid was transferred into a 3 L bioreactor. 6 mL of isopropyl-β-D-thiogalactopyranoside (1 M IPTG) was added to induce the expression of heterologous genes. During the whole culture process, the pH value of the fermentation broth was adjusted to 6.8 by automatically adding NH3·H2O, the culture temperature was 37 °C, the aeration rate was 6 VVM, and the rotation speed was 400 rpm. 80% glucose was flowed into the bioreactor at a constant rate of 35 mL / h for 12 h, 80% glucose was flowed into the bioreactor at a constant rate of 15 mL / h for 24 h, and 10-20 g / L lactose was supplemented. The carbon source was stopped after 48 h, and the fermentation was carried out for 72 h to obtain the fermentation broth.

[0261] Example 9. Detection method of lactosyl-N-neotetraose in fermentation broth.

[0262] The fermentation broth taken during the fermentation process was centrifuged, boiled for 5 min, centrifuged again, and the supernatant was obtained. The fermentation broth was filtered into a liquid phase vial by using a filter membrane with a pore size of 0.22 μm, and the filtrate was obtained by filtering twice. The contents of lactose, lactosyl-N-triose II, and lactosyl-N-neotetraose were detected by using a high performance liquid chromatograph with a differential refractometer detector. The chromatographic conditions were as follows: mode HPLC-RID-UV, column Sugar-D (250 x 4.6 mm), mobile phase A: 65% acetonitrile, mobile phase B: 35% water, UV 195 nm, flow rate 1 mL / min, sample amount 10 μL, time 15 min, column temperature 25 °C, RID 30-35 °C.

[0263] According to the detection results, the yield of lactosyl-N-neotetraose of the recombinant B. subtilis BA03 in a 5 L bioreactor was calculated to be 9.6 g / L, which had exceeded the highest yield of lactosyl-N-neotetraose of B. subtilis reported so far.

[0264] At present, the engineering strain for producing lactosyl-N-neotetraose by microbial fermentation method is mostly Escherichia coli. However, E. coli is a non-food safety level strain, and the endotoxin secreted by E. coli causes the lactosyl-N-tetraose produced by E. coli to be unsafe for application in food, medicine and other fields. The present application realizes the production of lactosyl-N-neotetraose in Bacillus subtilis 168, and the advantages are that the metabolic pathway of Bacillus subtilis 168 itself contains the synthesis pathways of uridine diphosphate galactose and uridine diphosphate acetylglucosamine, and the two substances can be used as substrates to participate in the synthesis of lactosyl-N-neotetraose. At the same time, Bacillus subtilis 168 does not secrete endotoxin, and has been certified by the US Food and Drug Administration (FDA) as a safe microorganism (Generally recognized as safe, GRAS), which can be used as a food safety level strain. The food safety level lactosyl-N-neotetraose is synthesized by metabolic engineering modification and fermentation. The strain BA01 containing the plasmid containing the beta-1,3-N-acetylglucosaminyltransferase gene, the beta-1,4-galactosyltransferase gene and the lactose permease gene is fermented for analysis, and the yield of lactosyl-N-neotetraose is determined to be 2.1 g / L. By using the strong promoter P c2up The expression of the gene encoding glucosamine-6-phosphate synthase glmS is improved, and the trp terminator is introduced to effectively release the feedback inhibition of GlmS nuclease. The yield of lactosyl-N-neotetraose is determined by HPLC-RID-UV, and the yield in a shake flask is 3.5 g / L, which is increased by 66.7% compared with the yield of lactosyl-N-neotetraose. The yield in a 5 L fermenter is 9.6 g / L. The yield in a shake flask and the yield in a 5 L fermenter both exceed the highest yield of lactosyl-N-neotetraose in Bacillus subtilis reported at present.

[0265] The sequences used in the present application are as follows:

[0266] SEQ ID NO. 1 A alpha-beta-1,4-galT

[0267] ATGAACAGCACAGAAAACAAAAACTTTGTCATTTCAATAAGCACTGCTGAACAACG

[0268] CCGTAATCATATTATTGAACAGTTCACCCATCAAAATATTCCATTTGAATTTTTTGATGCTT

[0269] TTACACCCTCAGATAAATTAACTGACCACTTGCAGCGTTATCTGCCGAATGTTGCAAACG

[0270] CTGCACAGCTGACGATGGGGGAGAAAGGCTGTCTGATGTCTCATTTTATGCTTTGGAAG

[0271] AAATGCATAGATGAAAATCTCGACTATATTACACTCTTCGAGGATGATATTTTGCTGGGAG

[0272] AAAACGCGAATAAATTTTTGGCAGAAGGCGATTGGCTTAAAGTGAGGTTCAATTTTCAA

[0273] GAAATTTTCGTTCTCCGACTTGAAACGTTTTTAATGCCGGTTCAGCTTGAGAAGCAAAC

[0274] GCAAATTCCGCCTTTTCAGCAAAGAGACATCGATATCCTAACCAGTAAGCATTTCGGAAC

[0275] AGCCGGTTACGTCATCTCTCAAGGCGCCGCAAAATACCTGATAGCTTTGTTTGAAAAGCT

[0276] GACAACAGAAGAAATCAAACCGATTGACGAGATCATGTTTAACCAGCAGATCAATGCCA

[0277] CGGATTATCGCGTGTATCAATTAAATCCTGCGATTTGCGTACAAGAGCTTCAGCTGAATC

[0278] AAGAAGCGTCGCTTCTTGTATCCAATTTAGAGCAGGAGCGGAAGATCAACTTAAAATAT

[0279] GAAAAAAGAAAACACTAA

[0280] SEQ ID NO.2 lgtA

[0281] ATGCCGTCAGAAGCATTTAGAAGACATAGAGCATATAGAGAAAATAAACTGCAACC

[0282] GCTGGTTTCAGTTCTGATTTGCGCATATAATGTTGAAAAATATTTTGCACAATCACTGGCA

[0283] GCAGTTGTTAATCAAACATGGAGAAATCTGGATATTCTGATTGTTGATGATGGCTCAACA

[0284] GATGGCACACTGGCAATTGCACAAAGATTTCAAGAACAAGATGGAAGAATTAGAATTCT

[0285] GGCACAACCGAGAAATAGCGGCCTGATTCCGTCACTGAATATTGGCCTGGATGAACTGG

[0286] CAAAAAGCGGCGGAGGCGGCGAATATATTGCAAGAACAGATGCAGATGATATTGCAGCA

[0287] CCGGATTGGATTGAAAAAATTGTTGGCGAAATGGAAAAAGATAGATCAATTATTGCAATG

[0288] GGCGCGTGGCTGGAGGTTCTGTCAGAAGAAAAAGATGGCAATAGACTGGCAAGACATC

[0289] ATGAACATGGCAAAATTTGGAAAAAACCGACAAGACATGAAGATATTGCAGATTTTTTT

[0290] CCGTTTGGCAATCCGATTCATAATAATACAATGATTATGAGAAGATCAGTTATTGATGGCG

[0291] GCCTGAGATATAATACAGAAAGAGATTGGGCAGAAGATTATCAATTTTGGTATGATGTTT

[0292] CAAAACTGGGCAGACTGGCATATTATCCGGAAGCACTGGTTAAATACAGACTGCATGCA

[0293] AATCAAGTTTCAAGCAAATATAGCATTAGACAACATGAAATTGCACAAGGCATTCAAAA

[0294] AACAGCAAGAAATGATTTTCTGCAATCAATGGGCTTTAAAACAAGATTTGATTCACTGG

[0295] AATATAGACAAATTAAAGCAGTTGCATATGAACTGCTGGAAAAACATCTGCCGGAAGAA

[0296] GATTTTGAAAGAGCAAGAAGATTTCTGTATCAATGCTTTAAAAGAACAGATACACTGCC

[0297] GGCGGGCGCATGGCTGGACTTCGCAGCAGACGGCAGAATGAGAAGACTGTTTACACTG

[0298] AGACAATATTTTGGCATTCTGCATAGACTGCTGAAAAATAGATAA

[0299] SEQ ID NO.3 lacY

[0300] ATGTATTATCTGAAAAATACAAATTTTTGGATGTTTGGCCTGTTTTTTTTCTTCTATTTT

[0301] TTCATTATGGGCGCATATTTTCCGTTTTTTCCGATTTGGCTGCATGATATTAATCATATTTCA

[0302] AAATCAGATACGGGCATTATTTTTGCAGCAATTTCACTGTTTTCACTGCTGTTTCAACCGC

[0303] TGTTTGGCCTGCTGTCAGATAAACTGGGCCTGAGAAAATATCTGCTGTGGATTATTACGG

[0304] GCATGCTGGTTATGTTTGCACCGTTTTTCATTTTTATTTTTGGCCCGCTGCTGCAATATAAT

[0305] ATTCTGGTTGGCTCAATCGTTGGCGGAATTTATCTGGGCTTTTGCTTTAATGCGGGCGCA

[0306] CCGGCAGTTGAAGCATTTATTGAAAAAGTTTCAAGAAGATCAAATTTTGAATTTGGCAG

[0307] AGCAAGAATGTTTGGCTGCGTTGGCTGGGCACTGTGCGCATCAATTGTTGGAATTATGTT

[0308] TACAATTAATAATCAATTTGTTTTTTGGCTGGGCAGCGGCTGCGCACTGATTCTGGCAGT

[0309] TCTGCTGTTTTTTGCAAAAACAGATGCACCGTCATCAGCAACAGTTGCAAATGCAGTTG

[0310] GCGCAAATCATTCAGCATTTTCACTGAAACTGGCACTGGAACTGTTTAGACAACCGAAA

[0311] CTGTGGTTTCTGTCACTGTATGTTATTGGCGTTTCATGCACATATGATGTTTTTGATCAAC

[0312] AATTTGCAAATTTTTTTACATCATTTTTTGCAACGGGCGAACAAGGCACAAGAGTTTTTG

[0313] GCTATGTTACAACAATGGGCGAACTGCTGAATGCATCAATTATGTTTTTTGCACCGCTGAT

[0314] TATTAATAGAATTGGCGGCAAAAATGCACTGCTTCTGGCGGGCACAATTATGTCAGTTAG

[0315] AATTATTGGCTCATCATTTGCAACATCAGCACTGGAAGTTGTTATTCTGAAAACACTGCAT

[0316] ATGTTTGAAGTTCCGTTTCTGCTGGTTGGCTGCTTTAAATATATTACATCACAATTTGAAG

[0317] TTAGATTTTCAGCAACAATTTATCTGGTTTGCTTTTGCTTTTTTAAACAACTGGCAATGAT

[0318] TTTTATGTCAGTTCTGGCGGGCAATATGTATGAATCAATTGGCTTTCAAGGCGCATATCTG

[0319] GTTCTGGGCCTGGTTGCACTGGGCTTTACACTGATTTCAGTTTTTACACTGAGCGGCCCG

[0320] GGCCCGCTGTCACTGCTGAGAAGACAAGTTAATGAAGTTGCATAA

[0321] SEQ ID NO.4 P c2up

[0322] TGAGAATTCCTAACAACTAAATCACGACTATATACCTATACTATTTATTATCATCAATT TGTCGAAAAGGGTAGACAAACTATCGTTTAACATGTTATACTATAATAG

[0323] SEQ ID NO.5 trp terminator

[0324] AGTGGAAAAAAAGCTGCCGTCATTGGCAGCTTTTTTTATATCCT

[0325] Although the embodiments of the present application have been disclosed for illustrative purposes, those skilled in the art can understand that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present application and the appended claims, and therefore the scope of the present application is not limited to the disclosed embodiments.

Claims

1. A safe recombinant Bacillus subtilis for synthesizing lacto-N-neotetraose, characterized by: The recombinant Bacillus subtilis is obtained by transforming a plasmid containing a beta-1,3-N-acetylglucosaminyltransferase gene, a beta-1,4-galactosyltransferase gene and a lactose permease gene into Bacillus subtilis 168; The sequence of the beta-1,4-galactosyltransferase gene is SEQ ID NO. 1, the sequence of the beta-1,3-N-acetylglucosaminyltransferase is SEQ ID NO. 2, and the sequence of the lactose permease gene is SEQ ID NO. 3; The plasmid is pHT01; The β-1,3-N-acetylglucosaminyltransferase is derived from Neisseria meningitidis, the β-1,4-galactosyltransferase gene is derived from A. actinomycetemcomitans NUM4039, the lactose permease gene is derived from Escherichia coli; The recombinant Bacillus subtilis is further mutated from Bacillus subtilis 168 glmS The strong promoter P c2up and the trp terminator is introduced to effectively remove glmS The nucleic acid enzyme is feedback inhibited, and the plasmid containing the β-1, 3-N-acetylglucosamine transferase, β-1, 4-galactosyltransferase gene and lactose permease gene is transformed. The construction method of the recombinant Bacillus subtilis includes the following steps: The recombinant plasmid pHT01-Aa-beta-1,4-galT-lgtA-lacY is transformed into Bacillus subtilis 168 using Bacillus subtilis chemical competent cell preparation and transformation method, 10 µg / mL chloramphenicol resistant plate is coated, 37°C culture for 12 h, the transformants are picked for colony PCR, a 3573 bp band appears, and the construction of the recombinant Bacillus subtilis is verified to be successful; The construction method of the recombinant plasmid pHT01-Aa-beta-1,4-galT-lgtA-lacY includes the following steps: According to the published on NCBI A. actinomycetemcomitans NUM403 9 β-1, 4-galactosyltransferase gene (BAS48030.1) in the, through the Bacillus subtilis preferred codon optimization, synthesis of the gene sequence shown as SEQ ID NO. 1; Aα-β-1,4-galT-F and Aα-β-1,4-galT-R, using the β-1,4-galactosyltransferase gene of the synthetic gene sequence of SEQ ID NO. 1 as a template to amplify Aα -beta-1,4-galT Aα-β-1,4-galT-F and Aα-β-1,4-galT-R, using the β-1,4-galactosyltransferase gene of the synthetic gene sequence of SEQ ID NO. 1 as a template to amplify Aα -beta-1,4-galT Aα-β-1,4-galT-F and Aα-β-1,4-galT-R, using the β-1,4-galactosyltransferase gene of the synthetic gene sequence of SEQ ID NO. 1 as a template to amplify Aα According to the Neisseria meningitidis genome published on NCBI Neisseria meningitidis The β-1, 3-N-acetylglucosaminyltransferase gene (Gene ID: 904226) in MC58 is optimized by B. subtilis preferred codons, and the gene sequence is shown as SEQ ID NO.

2. Using primers lgtA-F and lgtA-R, the β-1, 3-N-acetylglucosaminyltransferase gene having the synthetic gene sequence of SEQ ID NO. 2 as a template was amplified lgtA The sequence fragment of the gene lgtA was cloned into the vector pHT01-Aα-β-1, 4-galT to construct the plasmid pHT01-Aα-β-1, 4-galT-lgtA. According to the lactose permease gene (Gene ID: 949083) in E. coli K12 published on NCBI, the gene sequence shown as SEQ ID NO. 3 is synthesized after optimization by B. subtilis preferred codons. Escherichia coli According to the lactose permease gene (Gene ID: 949083) in E. coli K12 published on NCBI, the gene sequence shown as SEQ ID NO. 3 is synthesized after optimization by B. subtilis preferred codons. The primer lacY-F and lacY-R were used to amplify the lactose permease gene with the synthetic gene sequence of SEQ ID NO. 3 as the template lacY The sequence fragment of the gene lacY was cloned into the vector pHT01-Aα-β-1,4-galT-lgtA to construct the plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY; The construction method of the recombinant Bacillus subtilis includes the following steps: Using CRISPR-Cas9 technology, in glms The synthetic sequence knocked in at the site without a trace is SEQ ID NO. 4 strong promoter P c2up and the sequence is SEQ ID NO. 5 trp terminator; Using plasmid pJOE8999, the amino acid sequence of glmS was selected to predict the N20 sequence by the website http: / / chopchop.cbu.uib.no / ; the N20 fragment was obtained by denaturation at 95°C and continuous renaturation after cooling from the primers glms i.e. N20-F and glms i.e. N20-R, and pJOE8999 plasmid was digested by enzyme and connected with the N20 fragment; Bas1 enzyme digestion, and connection with the N20 fragment; Next, the plasmid with the N20 fragment connected sal1 The enzyme cutting site is introduced into the repair template, i.e. the upstream homologous arm-trp terminator-promoter P c2up The downstream homologous arm is obtained by homologous recombination through overlapping PCR with primers glms-UP-F and glms-DN-R; the trp terminator and the Pc2up promoter gene are inserted into B. subtilis 168 through chromosomal repair glmS The upstream and downstream homologous arms are obtained by PCR amplification with B. subtilis 168 as the template and using primers glms-UP-F, glms-UP-R, glms-DN-F and glms-DN-R; the strong promoter P c2up The fragment is obtained by PCR amplification with primers P c2up -F and P c2up -R; the trp terminator is obtained by PCR amplification with primers glms-UP-R and P c2up -F; the upstream homologous arm-trp terminator-promoter P c2up The downstream homologous arm is obtained by homologous recombination through overlapping PCR with primers glms-UP-F and glms-DN-R; the plasmid with the N20 fragment connected sal1 The enzyme cutting site is introduced into the repair template, i.e. the upstream homologous arm-trp terminator-promoter P c2up The downstream homologous arm is connected, glms The construction of the knock-in plasmid is successful; The constructed glms The constructed cas9 The constructed glms The constructed glms The constructed The yield of recombinant Bacillus subtilis for synthesizing lactosyl-N-neotetraose is 3.5 g / L in a shake flask and 9.6 g / L in a 5 L fermenter.

2. The recombinant Bacillus subtilis of claim 1 in the synthesis of lactosyl-N-neotetraose.

3. The method for the fermentative production of lactyl-N-neotetraose using the recombinant B. subtilis as claimed in claim 1, characterized in that: The method includes the following steps: The recombinant Bacillus subtilis BA03 single colony that grows is inoculated into LB liquid medium, 37°C, 200 r / min, and cultured for 12 h; The bacterial solution is inoculated into fermentation medium at an inoculation amount of 2-5%, 37°C, 200 r / min, and cultured for 48 h, and lactosyl-N-neotetraose is detected, and the yield is 3.5 g / L; Alternatively, the method includes the following steps: The feed batch fermentation was carried out in each 5 L bioreactor, and the single colony of the grown recombinant Bacillus subtilis BA03 was inoculated into LB liquid medium, and cultured at 37℃ and 200 r / min for 12 h; the recombinant strain BA03 was cultured in a 1 L flask containing 150 mL LB medium at a 10% inoculation amount for 8 h, and the seed liquid was transferred into a bioreactor with a working volume of 3 L; 6 mL of isopropyl-β-D-thiogalactoside (1M IPTG) was added to induce the expression of the heterologous gene; during the whole culture process, the pH value of the fermentation broth was adjusted to 6.8 by automatically adding 28% (v / v, volume percentage) NH40H, the culture temperature was 37℃, the aeration rate was 6 VVM, and the rotation speed was 400 rpm; 80% glucose was flowed into the bioreactor at a constant rate of 35 mL / h for 12 h, 80% glucose was flowed into the bioreactor at a constant rate of 15 mL / h for 24 h, and 10-20 g / L lactose was supplemented, and the carbon source was stopped after 48 h, and the fermentation was carried out until 72 h to obtain the fermentation broth; wherein the preparation of isopropyl-β-D-thiogalactoside is as follows: 238.3 g of isopropyl-β-D-thiogalactoside is taken, dissolved in 1 L, completely dissolved with distilled water, filtered with a filter in a super-clean bench into a sterile 2 mL EP tube, and stored in a-20℃ refrigerator for standby.

Images