Mena antisense oligonucleotide and application thereof

Abstract

The invention provides a Mena antisense oligonucleotide and a preparation method of the Mena antisense oligonucleotide. The antisense oligonucleotide is antisense oligonucleotide targeting a Mena gene core sequence, five antisense nucleic acids are analyzed in a wisdom gene database, and it is found that no sequence identical to the antisense nucleic acid target sequence exists, so that the four antisense nucleic acids do not generate an off-target effect. The ASO-Mena can be used for effectively inhibiting the scratch healing speed of lung cancer cells. The ASO-Mena1, 2 can inhibit lung cancer cell metastasis, and almost has no toxic influence on normal cells.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a Mena antisense oligonucleotide and application thereof. Background Art

[0002] Mena, as a mammalian enabling protein, is a member of the enabling / vasodilator-stimulated phosphoprotein (Ena / VASP) protein family. Its function is to directly or indirectly participate in the regulation of actin physiological processes such as neuronal axon guidance and platelet aggregation. However, studies in recent years have shown that Mena protein overexpression has been found in most highly metastatic tumors, and downregulating Mena protein expression can inhibit tumor growth. In addition to the above effects, Mena may also regulate the invasion and metastasis ability of cancer cells by affecting the polymerization and depolymerization of actin, and play an important role in controlling the formation and extension of cell pseudopodia. These existing studies are sufficient to show that Mena plays an important role in the occurrence and development of tumors, especially in tumor metastasis.

[0003] There are two forms of small nucleic acid drugs: the first is to degrade the mRNA of the target gene and promote the enzymatic reaction of related RNA; the second is to regulate the pre-mRNA splicing of the target gene. The small nucleic acid industry has been around for 20 years, and many small nucleic acid drugs have been approved and have achieved certain commercial success, such as the first Mipomersen and the second Nusinersen. ASO drugs have the advantages of relatively small size, low hydrophilicity, high biosafety, strong specificity and the ability to enter cells directly through endocytosis, making them a research hotspot. The good efficacy and commercial success of the ASO drug Nusinersen have promoted the research on the second form of antisense nucleic acid drugs. Therefore, the application research of ASO drugs in many solid tumors mainly focuses on the mechanism of degrading mRNA. Since the expression of these mRNAs is crucial to normal physiological activities, this method may affect the normal physiological activities of patients to a certain extent. Summary of the invention

[0004] The main purpose of the present invention is to provide a Mena antisense oligonucleotide, which is an antisense oligonucleotide designed according to the Mena gene.

[0005] Another object of the present invention is to provide the application of the above antisense oligonucleotide.

[0006] A Mena antisense oligonucleotide, which is at least one of:

[0007] ASO-Mena-1, whose nucleotide sequence is AAGGGGAAAACCATTGAAA;

[0008] ASO-Mena-2, whose nucleotide sequence is AAAGAAAAAAAAATCTCCCT;

[0009] ASO-Mena-3: Its nucleotide sequence is CTGGAGATAACAGGTGACTT;

[0010] ASO-Mena-4: Its nucleotide sequence is TCAGGGTGTTAGATGTTAAA;

[0011] Or ASO-Mena-1, ASO-Mena-2, ASO-Mena-3, ASO-Mena-4 analogs obtained by base insertion, deletion, or substitution still have the ability to inhibit lung cancer cell migration and invasion.

[0012] The application of the Mena antisense oligonucleotide in regulating the expression of the Mena gene.

[0013] The use of the Mena antisense oligonucleotide in the preparation of a Mena protein expression inhibitor.

[0014] The application of the Mena antisense oligonucleotide in inhibiting the invasion and migration of lung cancer cells.

[0015] The lung cancer cells are 95D cells.

[0016] The use of the Mena antisense oligonucleotide in the preparation of anti-tumor and / or anti-tumor metastasis drugs.

[0017] The tumor is lung cancer.

[0018] A drug for inhibiting the migration and invasion ability of lung cancer cells, comprising the above-mentioned Mena antisense oligonucleotide.

[0019] The medicine also includes pharmaceutically acceptable excipients.

[0020] Compared with the prior art, the present invention has the following advantages and effects:

[0021] 1. The inventors used the BLAST program on the NCBI official website to perform BLASTN analysis on the five antisense nucleic acids in the Homo sapiens gene database and found that there was no sequence that was exactly the same as the antisense nucleic acid target sequence, so the four antisense nucleic acids would not produce off-target effects.

[0022] 2. The inventors previously analyzed the TCGA and HuManProteinAtlas databases and found that the mRNA and protein expressions of Mena in lung samples were significantly upregulated, and its upregulated expression indicated a poor prognosis for lung cancer patients. Therefore, the research and design of small nucleic acid drugs targeting Mena is of great significance for the treatment of metastatic lung cancer.

[0023] 3. Compared with ASO-Mena-3, ASO-Mena-4, and ASO-Scramble, ASO-Mena-1 and ASO-Mena-2 can more effectively inhibit the migration speed and invasion ability of lung cancer cells.

[0024] 4. ASO-Mena-1~4 have almost no toxic effect on cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a graph showing the matching results of antisense nucleic acid analysis using BLASTN.

[0026] Figure 2 This is a graph showing the results of CCK-8 testing of the cytotoxicity of antisense nucleic acids at various concentrations.

[0027] Figure 3 The results of the cell scratch test to detect the effect of the optimal concentration of ASO-Mena-1 and ASO-Mena-2 on cell migration ability; among them: the upper figure: 48h scratch healing; the lower figure: quantitative analysis of the scratch healing rate; in the bar graph of the lower figure, from left to right are control, ASO-Scramble, ASO-Mena-3, ASO-Mena-4, ASO-Mena-1, ASO-Mena-2; the data are expressed as mean ± SD (N = 3), and the Tukey test of one-way ANOVA is used to determine the statistical significance between groups. "*" represents P < 0.05 compared with 0nM, and "**" represents P < 0.01 compared with 0nM. The data are expressed as mean ± SD (N = 3), the magnification of the figure is 100×, and the scale length is 200μm.

[0028] Figure 4 This is a diagram of the Transwell cell migration experiment results in Example 4.

[0029] Figure 5 This is a diagram showing the results of the Transwell cell invasion experiment in Example 4. DETAILED DESCRIPTION

[0030] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0031] If no specific experimental conditions are specified in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally followed. The materials and reagents used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0032] Example 1 Design of the action sequence of Mena antisense oligonucleotides

[0033] 1.1 Design of Mena antisense oligonucleotide sequences

[0034] Our previous research found that Mena expression increases in lung cancer. Some studies have shown that this gene is related to the invasion and metastasis of lung cancer. In order to inhibit the expression of this gene, antisense oligonucleotides were designed targeting key sites upstream and downstream of the gene that affect its expression and splicing, so as to inhibit the invasion and migration of lung cancer cells.

[0035] ASO-Mena-1:AAGGGGAAAACCATTGAAA;

[0036] ASO-Mena-2:AAAGAAAAAAAAATCTCCCT;

[0037] ASO-Mena-3:CTGGAGATAACAGGTGACTT;

[0038] ASO-Mena-4:TCAGGGTGTTAGATGTTAAA;

[0039] ASO-scramble:TAACACGTCTATACGCCCA.

[0040] ASO-Mena-1~4 are antisense oligonucleotides designed according to the key expression sites of the gene, and ASO-scramble selects a random scrambled sequence as a negative control group.

[0041] 1.2 Sequence matching analysis

[0042] The BLAST program on the NCBI official website was used to perform BLASTN analysis on the five antisense nucleic acids in the Homo sapiens gene database.

[0043] Example 2 Oligonucleotide Cell Transfection and Antisense Nucleic Acid Cytotoxicity Experiment

[0044] 2.1 Preparation of Mena antisense oligonucleotide transfection reagent

[0045] (1) The antisense nucleic acid sequence designed in Example 1 was sent to Qingke Biotechnology Co., Ltd. to synthesize antisense nucleic acid dry powder, which was prepared into 100 μM powder with RNase-free water and then divided into portions for use;

[0046] (2) Inoculate 8×10 4 95D cells were cultured until the cells covered 80% of the bottom;

[0047] (3) Remove the original culture medium in the 24-well plate and replace it with 500 μl of fresh RPMI 1640 culture medium;

[0048] (4) Prepare the antisense nucleic acid transfection complexes at various concentrations according to the table below and incubate at room temperature for 5 min;

[0049] Table 1 Antisense nucleic acid transfection reagents

[0050]

[0051] (5) Add the antisense nucleic acid-liposome mixture for incubation, mix slowly, and culture for 48 hours to obtain ASO-Mena storage solutions of different concentrations.

[0052] 2.2 Cell culture and transfection toxicity assay

[0053] (1) 3×10 3 95D cells were cultured overnight.

[0054] (2) Remove the original 1640 medium in the 96-well plate, replace it with 100 μL of fresh 1640 medium, and add the prepared antisense nucleic acid transfection complexes of various concentrations into the 96-well plate and culture for 48 h;

[0055]

[0056] (3) Remove the original culture medium, wash three times with PBS, and then add 100 μL of 1640 culture medium containing 10% CCK-8 reagent.

[0057] (4) Incubate in a 37°C incubator for 1.5 h.

[0058] (5) Place the sample 96-well plate on the microplate reader and measure the absorbance at a wavelength of 450 nm.

[0059] (6) Calculate cell viability according to the following formula:

[0060] Cell viability value = [OD (drug group) - OD (blank group)] / [OD (0 concentration drug group) - OD (blank group)] × 100%

[0061] OD (drug group): absorbance value of the wells to which cells, desired drug solution, CCK-8 solution, and culture medium were added;

[0062] OD (blank group): absorbance value of the wells without cells and drugs but with culture medium and CCK-8 solution;

[0063] OD (drug concentration 0 group): absorbance value of a well containing cells, CCK-8 solution and culture medium but without adding drug solution of any concentration.

[0064] The experimental results are as follows Figure 2 As shown, the antisense nucleic acid transfection complexes at various concentrations showed no cytotoxicity.

[0065] Example 3 Scratch assay to detect the effect of antisense nucleic acid on the scratch healing ability of tumor cells

[0066] (1) According to 6×10 5 95D cells were seeded at a density of cells / well in a 6-well plate and cultured in a constant temperature incubator to a confluence of 60-70%. ASO-Mena was transfected into 95D cells using the prepared 50 nM ASO-Mena stock solution according to the method in 2.2, and cultured until the cells covered 95% of the bottom of the six-well plate. Three replicate wells were set for each group of cells.

[0067] (2) Remove the original culture medium, wash the cells three times with PBS, add 1 ml of PBS, and use a 200 μL pipette to scratch the bottom of the 6-well plate in a straight line. Then, gently wash with PBS three times to remove the scraped cells.

[0068] (3) Add 2 mL of 1640 medium (without serum) to each well, observe under a microscope at 100× magnification and record the width W(0h) of the corresponding scratch in each well at 0h, and then culture normally in an incubator;

[0069] (4) After 48 h, observe and record the width W(48h) of the corresponding scratch of each well at 48 h under a microscope at 100× magnification, and calculate the experimental results using the following formula.

[0070] Scratch healing rate = W(0h)-W(48h) / W(0h)

[0071] Example 4 Transwell cell migration and invasion assay to detect the effect of antisense nucleic acid on cell activity

[0072] 4.1 Transwell cell invasion assay

[0073] (1) According to 6×10 5 95D cells were seeded at a density of cells / well in a 6-well plate and cultured in a constant temperature incubator to a confluence of 60-70%. ASO-Mena was transfected into 95D cells according to the method in 2.2 and cultured until the cells covered 95% of the bottom of the 6-well plate. Three replicate wells were set for each group of cells.

[0074] (2) Matrigel was prepared by mixing culture medium and basement membrane matrix (Matrigal) at a ratio of 8:1, and then 70 μL of the mixed Matrigel was added to each Transwell chamber, and the Transwell chamber was placed in a cell culture incubator for 2 h. After the Matrigel was completely solidified, 100 μL of culture medium was added to the upper chamber of the Transwell, and 500 μL of culture medium was added to the lower chamber of the Transwell, and the Transwell chamber was placed in a cell culture incubator for overnight equilibrium.

[0075] (3) Use DMEM medium (without serum) to resuspend 95D cells of different groups, take 200 μL of cell suspension (a total of 5×10 4 cells) were added to the upper chamber of the Transwell, and 500 μL of 1640 medium containing 10% FBS was added to the lower chamber;

[0076] (4) After 48 h of normal culture, the Transwell chamber was removed, and the matrix gel in the Transwell chamber and the cells in the upper membrane (not permeable) were gently wiped off with a medical cotton swab, and then the upper membrane was washed three times with PBS.

[0077] (5) Add 200 μL of 4% paraformaldehyde into the Transwell chamber and fix the cells for 10 min at room temperature. Then wash them three times with PBS, each time for 10 min.

[0078] (6) Add 500 μL of 5% crystal violet solution into the Transwell chamber and stain for 30 min, then wash three times with PBS, 10 min each time.

[0079] (7) Observe the cells under the membrane of the Transwell chamber at 100× magnification under a fluorescence microscope and use ImageJ software to count the number of cells in each field of view.

[0080] 4.2 Transwell cell migration assay

[0081] The experiment was carried out according to the method in 4.1, except that the preparation and addition of matrix gel was omitted in step (2), and culture medium was directly added.

[0082] After the culture was completed, staining and photography were performed in the same manner. Figure 4 shown.

[0083] Example 5 Results and Discussion

[0084] Conclusion 1: ASO-Mena-1~4 do not have sequences that are completely identical to the antisense nucleic acid target sequence, and the control antisense nucleic acid will not affect the gene expression of lung cancer cells. Therefore, none of the four antisense nucleic acids will produce off-target effects.

[0085] like Figure 1As shown, the BLASTN analysis results of Example 1 show that ASO-Mena-1 to 4 match the key sites that affect the expression and shearing of the Mena gene upstream and downstream, and the E values ​​are 0.006, 0.002, 0.002, and 0.002, respectively, which are all among the sequences with the smallest E values. The E values ​​of other target sequences are 0.4, 0.08, 0.13, and 0.53, respectively, which are quite different from the E values ​​of the target sequences. The blastn analysis results of the control antisense nucleic acid ASO-Scramble show that the E values ​​are all very large, which does not meet the specific binding conditions.

[0086] Conclusion 2: ASO-Mena is non-toxic to cells

[0087] like Figure 2 As shown, in Example 2, six concentrations of antisense nucleic acids, 0 nM, 50 nM, 100 nM, 250 nM, 500 nM, and 1000 nM, were transfected into 95D cells using PEI transfection reagent. 48 hours after transfection, the cytotoxicity of the antisense nucleic acids at each concentration was detected using CCK-8 reagent. The cytotoxicity experiment showed that the antisense nucleic acids at each concentration had no toxic effect on the cells.

[0088] Conclusion 3: ASO-Mena-1 and ASO-Mena-2 can inhibit the migration and invasion ability of lung cancer cells.

[0089] In Example 3, ASO-Mena-1 (50nM), ASO-Mena-2 (50nM), ASO-Mena-3 (50nM), ASO-Mena-4 (50nM), and ASO-Scramble (50nM) were transfected into 95D cells, and the effect of ASO-Mena was preliminarily explored through a scratch healing experiment. The results showed that ASO-Mena-1 and ASO-Mena-2 could inhibit the scratch healing rate of lung cancer cells, but compared with ASO-Mena-3, ASO-Mena-4, and ASO-Scramble, ASO-Mena-1 (50nM) and ASO-Mena-2 (50nM) had the highest inhibition on the efficiency of 95D cell scratch healing at the optimal concentration, while ASO-Mena-1 (50nM) and ASO-Mena-2 (50nM) reduced the speed of scratch healing to 58% and 47% of that of the control group, respectively. Figure 3 ).

[0090] Conclusion 4: The scratch experiment results preliminarily showed that ASO-Mena-1 and ASO-Mena-2 had a stronger inhibitory effect on the scratch healing rate of 95D cells, and ASO-Mena-1 (50nM) had a better inhibitory efficiency than ASO-Mena-2 (50nM).

[0091] Then, in Example 4, ASO-Mena-1 (50nM) and ASO-Scramble (50nM) were transfected into 95D cells. The inhibitory effect of ASO-Mena on the migration and invasion of lung cancer cells was detected by transwell experiment. The results of migration experiment showed that compared with the control group, ASO-Mena-1 (50nM) could inhibit the number of migrating lung cancer cells, and the number of migrating cells decreased by 53% ( Figure 4 ). Therefore, compared with ASO-Scramble at the optimal concentration, ASO-Mena-1 has a stronger function of inhibiting the migration of lung cancer cells. Subsequently, ASO-Mena-1 (50nM) and ASO-Scramble (50nM) were subjected to invasion experiments to detect the effect of ASO-Mena on the invasion ability of lung cancer cells. The results showed that ASO-Mena-1 (50nM) can inhibit the invasion ability of lung cancer cells, and ASO-Mena-1 reduces the number of invading lung cancer cells by 56% ( Figure 5 ).

[0092] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A Mena antisense oligonucleotide, characterized in that At least one of the following: ASO-Mena-1, whose nucleotide sequence is AAGGGGAAAACCATTGAAA; ASO-Mena-2, whose nucleotide sequence is AAAGAAAAAAAAATCTCCCT; ASO-Mena-3: Its nucleotide sequence is CTGGAGATAACAGGTGACTT; ASO-Mena-4: Its nucleotide sequence is TCAGGGTGTTAGATGTTAAA; Or ASO-Mena-1, ASO-Mena-2, ASO-Mena-3, ASO-Mena-4 analogs obtained by base insertion, deletion, or substitution still have the ability to inhibit lung cancer cell migration and invasion.

2. Use of the Mena antisense oligonucleotide according to claim 1 in regulating Mena gene expression.

3. Use of the Mena antisense oligonucleotide according to claim 1 in the preparation of a Mena protein expression inhibitor.

4. Use of the Mena antisense oligonucleotide according to claim 1 in inhibiting scratch healing of lung cancer cells.

5. Use of the Mena antisense oligonucleotide according to claim 1 in the preparation of anti-tumor and / or anti-tumor metastasis drugs.

6. The use according to claim 5, characterized in that: The tumor is lung cancer.

7. Use of the Mena antisense oligonucleotide according to claim 1 in inhibiting the invasion and migration of lung cancer cells.

8. The use according to claim 7, characterized in that: The lung cancer cells are 95D cells.

9. A drug for inhibiting the migration and invasion of lung cancer cells, characterized in that: Comprising the Mena antisense oligonucleotide according to claim 1.

10. The drug according to claim 9, characterized in that: The medicine also includes pharmaceutically acceptable excipients.

Images