A method for improving the resistance of citrus to citrus canker by using the CsSERK1 gene

Abstract

The present invention relates to the field of agricultural biological gene technology, and discloses a method for improving the resistance of citrus to citrus canker by regulating the expression level of CsSERK1 protein in citrus plants. Specifically, it includes the following steps: (1) cloning the CsSERK1 gene sequence of citrus; (2) constructing an overexpression vector; (3) transforming citrus with the overexpression vector to obtain transgenic plants with up-regulated expression level of CsSERK1 gene. By cloning the coding sequence of the citrus CsSERK1 gene, constructing an overexpression vector, and then transforming citrus, the incidence of citrus canker in the obtained CsSERK1 overexpression transgenic plants can be reduced to 51.74% of that of existing citrus at most, which can effectively and significantly reduce the incidence of citrus canker, reduce the lesion area, and does not affect the phenotype of transgenic plants. It has great application value for citrus canker resistance breeding and can be used as a candidate gene for citrus canker resistance breeding with multiple canker-resistant and -susceptible genes.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biological gene technology. Specifically, it relates to a method for improving the resistance of citrus to citrus canker by using the CsSERK1 gene. Background Art

[0002] Citrus is the main economic pillar in the southern mountainous areas. In recent years, the planting area of citrus has been expanding annually. However, with the development of the industry, citrus is also vulnerable to diseases. One of the common diseases is citrus canker (Citrus Bacteria Canker, CBC). Citrus canker is the main bacterial disease in citrus production areas, which is caused by the plant pathogenic bacterium Xanthomonas citri subsp. citri ( Xanthomonas citri subsp. Citri, Xcc ). Xcc It can infect above-ground parts such as leaves, fruits, branches, and sepals; the infected Xcc fruits may show chlorosis and abscission. The premature dropping and discoloration of fruits will cause huge economic losses. Studies have found that different citrus varieties have different resistances to citrus canker. Sour oranges and sweet oranges are the most severely infected, followed by lemons, pomelos, and grapefruit, and kumquats have the strongest disease resistance.

[0003] So far, there is no radical cure for citrus canker. Mainly, physical control, chemical control, and integrated control methods are adopted to prevent the occurrence of canker. However, the extensive use of chemical agents will cause irreversible pollution to the environment. Strict epidemic prevention systems can prevent the spread of the pathogen, but they cannot completely eliminate diseased trees. Therefore, in citrus canker epidemic areas, new disease-resistant varieties can be cultivated and planted to enhance the ability of citrus to resist canker, thereby achieving the control effect. The long breeding cycle of cross-breeding makes the breeding efficiency low. With the rise of molecular biology, people have started to study the pathogen itself and the disease-resistant defense response of plants from the direction of disease-resistant genetic engineering. With the continuous discovery of disease-resistant genes, new ideas have been provided for citrus molecular breeding. Overexpression of CsBZIP40 affects the production of salicylic acid and the expression of genes related to its signaling pathway. Defense genes can be activated through the SA signaling pathway, which plays an important role in improving the resistance of citrus to citrus canker. After overexpression or interfering with the expression of transcription factors such as CitMYB20, CsWRKY61, CsAP2-09, and CsLOB1 in citrus, the resistance of transgenic citrus to canker changes, indicating that these transcription factors are related to canker. Genome editing of CsWRKY22 mediated by CRISPR / Cas9 and interference mutation of CsDMR6 significantly reduce the susceptibility to citrus canker.

[0004] Somatic embryogenesis receptor kinases (SERKs) are members of the LRR-RLKs subfamily II and were initially discovered in carrots. They have been found to have a wider range of functions in plant growth, development, and defense responses. For example, in Arabidopsis thaliana, AtSERKs interact with ERf to coordinate the development of female gametophytes and the surrounding sporophytes; AtSERK4 in Arabidopsis thaliana plays a negative regulatory role during leaf senescence; in cotton, GhSERK positively regulates the GRF7-mediated innate immune response and improves the resistance of plants to Verticillium wilt infection. Currently, there is no research or application on using SERKs to improve the resistance of citrus to citrus canker.

[0005] In view of this, the present application is specifically proposed. Summary of the Invention

[0006] The present invention provides a method for improving the resistance of citrus to citrus canker by using the CsSERK1 gene. By integrating the overexpression vector of the CsSERK1 gene of somatic embryogenesis receptor kinase in citrus, it promotes the accumulation of CsSERK1 protein in citrus, can significantly improve the resistance of citrus to citrus canker, and does not affect the phenotype of transgenic plants. It has great application value in citrus breeding for resistance to citrus canker and can be used as a candidate gene for breeding for resistance and susceptibility to citrus canker with multiple genes.

[0007] The present invention is achieved through the following technical solutions:

[0008] In the first aspect, the present invention provides a method for improving the resistance of citrus to citrus canker by regulating the expression level of the CsSERK1 gene in citrus plants, thereby improving the resistance of citrus plants to citrus canker. The nucleotide sequence of the CsSERK1 gene is as shown in SEQ ID NO: 1.

[0009] In a specific embodiment, the specific method for regulating the expression level of the CsSERK1 gene is: up-regulating the expression level of the CsSERK1 gene in citrus plants.

[0010] In a specific embodiment, the way to up-regulate the expression level of the CsSERK1 gene in citrus plants is: using an overexpression vector to up-regulate the expression level of the CsSERK1 gene in citrus cells.

[0011] In a specific embodiment, a method for improving the resistance of citrus to citrus canker by using the CsSERK1 gene includes the following steps:

[0012] (1) Clone the coding sequence of the citrus CsSERK1 gene;

[0013] (2) Construct an overexpression vector of the CsSERK1 gene;

[0014] (3) The overexpression vector of the CsSERK1 gene was transformed into citrus to obtain transgenic plants with improved resistance to citrus canker.

[0015] In a specific embodiment, in step (1), the cloning method of the citrus CsSERK1 gene coding sequence was as follows: extracting the total RNA of citrus, then reverse-transcribing it into cDNA, and finally amplifying the CsSERK1 gene coding sequence DNA fragment by PCR.

[0016] In a specific embodiment, in step (1), the primers used for PCR amplification were OE-CsSERK1-F and OE-CsSERK1-R, and their nucleotide sequences were SEQ ID NO: 2 and SEQ ID NO: 3 respectively.

[0017] In a specific embodiment, in step (2), the construction method of the CsSERK1 overexpression vector was as follows: the CsSERK1 coding sequence DNA fragment recovered by digestion with KpnⅠ and SalI was ligated to the pLGNe vector recovered by digestion with KpnⅠ and SalI to construct the overexpression vector pLGNe-CsSERK1.

[0018] In a specific embodiment, in step (3), the method for transforming the CsSERK1 overexpression vector into citrus was as follows: the overexpression vector pLGNe-CsSERK1 was transformed into Agrobacterium tumefaciens by electroporation, and then the Agrobacterium tumefaciens-mediated transformation of citrus explants was carried out. After the genetically transformed explant cells were identified by GUS staining, micrografted, grafted onto the ground, identified by PCR, and the expression level of CsSERK1 was analyzed by qRT-PCR, transgenic plants were obtained.

[0019] In a specific embodiment, when verifying the transgenic plants by PCR, the primers used were ID-CsSERK1-F and ID-CsSERK1-R, and their nucleotide sequences were SEQ ID NO: 4 and SEQ ID NO: 5 respectively.

[0020] In a specific embodiment, when detecting the expression level of the CsSERK1 gene by qRT-PCR, the primers used were RT-CsSERK1-F and RT-CsSERK1-R, and their nucleotide sequences were SEQ ID NO: 6 and SEQ ID NO: 7 respectively.

[0021] In a specific embodiment, after obtaining the transgenic plants, the transgenic plants were evaluated for resistance, and it was determined that the overexpression of CsSERK1 improved the resistance of citrus to citrus canker.

[0022] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0023] 1. A method for improving the resistance of citrus to citrus canker by using the CsSERK1 gene. By cloning the coding sequence of the citrus CsSERK1 gene, constructing an overexpression vector, and then transforming the citrus epicotyl by Agrobacterium tumefaciens-mediated method, the incidence of citrus canker in the obtained CsSERK1 overexpressing transgenic plants can be reduced to 51.74% of that of existing citrus at most, effectively and significantly reducing the incidence of citrus canker and decreasing the lesion area.

[0024] 2. A method for improving the resistance of citrus to citrus canker by using the CsSERK1 gene. By integrating the overexpression vector of the CsSERK1 gene of citrus somatic embryogenesis receptor kinase into citrus, promoting the accumulation of CsSERK1 protein in citrus, the resistance of citrus to citrus canker can be significantly improved without affecting the phenotype of transgenic plants.

[0025] 3. A method for improving the resistance of citrus to citrus canker by using the CsSERK1 gene. By overexpressing the CsSERK1 gene, the resistance of transgenic plants to citrus canker can be greatly improved, which has great application value in citrus canker resistance breeding and can be used as a candidate gene for citrus canker resistance breeding with multiple citrus canker resistant and susceptible genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can be obtained based on these drawings without creative efforts.

[0027] Figure 1 The bioinformatics characteristics of the citrus CsSERK1 gene in the embodiments of the present invention: A is the chromosomal localization of the citrus CsSERK1 gene, and bp represents base; B is the gene structure of citrus CsSERK1; C is the conserved domain of the citrus CsSERK1 gene, and aa represents amino acid.

[0028] Figure 2 The PCR amplification electrophoresis map of the citrus CsSERK1 gene cloning in the embodiments of the present invention: CDS represents the CsSERK1 coding sequence; M represents the DNA molecular weight standard, and the same applies hereinafter.

[0029] Figure 3 The structure diagram of the overexpression vector of the citrus CsSERK1 gene in the embodiments of the present invention: GUS represents the β-glucuronidase gene; NPTII represents the neomycin phosphotransferase gene; 35S represents the plant constitutive promoter derived from cauliflower mosaic virus; NOS represents the terminator of the nopaline synthase gene.

[0030] Figure 4 This is the flow chart of citrus genetic transformation in the embodiment of the present invention.

[0031] Figure 5 This is the GUS staining map of transgenic plants in the embodiment of the present invention: OE-SERK-1, OE-SERK-2, and OE-SERK-3 respectively represent transgenic plants, and WT represents wild-type late Jincheng orange plants. The same applies hereinafter.

[0032] Figure 6 This is the PCR identification map of transgenic plants in the embodiment of the present invention.

[0033] Figure 7 This is the analysis map of CsSERK1 expression level in transgenic plants in the embodiment of the present invention: * indicates a significant difference compared with WT (P<0.05), ** indicates a highly significant difference compared with WT (P<0.01), *** indicates an extremely significant difference compared with WT (P<0.001), and **** indicates an extremely highly significant difference compared with WT (P<0.0001). The same applies hereinafter.

[0034] Figure 8 This is the symptom map of transgenic plant leaves inoculated with Xanthomonas citri subsp. citri after 10 days in the embodiment of the present invention.

[0035] Figure 9 This is the statistical chart of lesion size of transgenic plant leaves inoculated with Xanthomonas citri subsp. citri after 10 days in the embodiment of the present invention.

[0036] Figure 10 This is the statistical chart of disease index of transgenic plant leaves inoculated with Xanthomonas citri subsp. citri after 10 days in the embodiment of the present invention. Detailed implementation manners

[0037] To make the objectives, technical solutions, and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in combination with embodiments and drawings. The illustrative embodiments of the present invention and their descriptions are only used to explain the present invention and are not intended to limit the present invention.

[0038] In the following description, a large number of specific details are set forth in order to provide a thorough understanding of the present invention. However, it is obvious to those of ordinary skill in the art that the present invention does not have to be implemented with these specific details. In other embodiments, well-known structures, materials, or methods are not specifically described in order to avoid obscuring the present invention.

[0039] Throughout the specification, references to "one embodiment", "an embodiment", "an example" or "an example" mean that a particular feature, structure, or characteristic described in connection with the embodiment or example is included in at least one embodiment of the present invention. Thus, the phrases "one embodiment", "an embodiment", "an example" or "an example" appearing throughout the specification do not necessarily all refer to the same embodiment or example. Furthermore, the particular features, structures, or characteristics may be combined in any suitable combination and / or sub-combination in one or more embodiments or examples. In addition, those of ordinary skill in the art should understand that the diagrams provided herein are for illustrative purposes only and are not necessarily drawn to scale. The term "and / or" used herein includes any and all combinations of one or more of the associated listed items.

[0040] In the description of the present invention, the orientation or positional relationship indicated by terms such as "front", "rear", "left", "right", "upper", "lower", "vertical", "horizontal", "high", "low", "inner", "outer", etc. is based on the orientation or positional relationship shown in the drawings, and is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operate in a specific orientation, and thus should not be construed as limiting the protection scope of the present invention.

[0041] Example 1

[0042] Bioinformatics analysis of the citrus CsSERK1 gene

[0043] As Figure 1 shown, the citrus CsSERK1 gene is located between 26352854 bp and 26354079 bp on chromosome 3 of citrus. The full length of the CsSERK1 gene is 1.23 Kbp, the full length of the CDS sequence is 621 bp, and it can encode 206 amino acids. Analysis of the protein sequence shows that there is an obvious LRRNT_2 structural and functional domain.

[0044] The nucleotide sequence of the CsSERK1 gene SEQ ID NO: 1:

[0045] ATGGCGTCTCAATCTCATTTATATGTTCTGTTTGTGATTGTTGTGGGCGTGGCTGCCTTTGCCGCCCCTGTAAAATGTAATATGGAAGTGGATGCTCTTTATACCTGGAGAACCATGTTGAGTGACCCAAACAATGTTCTCCAAAGCTGGGATCC AACTTTGGTCAATCCATGCACCTGGTTTCACGTTACCTGCAACAGCGAGGACATCGTCGTCAGGGTGGACCTTGGTAATGCCGGATTAAGCGGACCTCTTGTTCCTCAGCTTGGACTTCTGACTAATCTTCAGTATCTGTCTGTTTATAAAAATA ACATAAGTGGATCGATTCCAAGCGAGATTGGTAATTTAAAGAAGCTGATCAGCTTGGGCCTGTTCAACAATCAATTGTCAGGGGCCATTCCAGCATCCATTGGAAACTTGAGATCCTTGAAGTTCATGAGATTGAATAATAACAATCTAACTGGC AGAATACCAAGAGAGGTGATTCAGCTCATTATAAATGGCAGTTTAAGAATCCTGAACGTAGCAAACAATTCACTGCCAGGGACTATGAGGGCCACAAACTCAACGGGATATGCCATCACAAGCGTCATACAAGACCCAAGAGCTCGAAAGTATTAA

[0046] Example 2

[0047] Cloning of the coding sequence of Citrus CsSERK1 gene

[0048] 1. RNA Extraction and cDNA Synthesis

[0049] Total RNA from citrus (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09), the RNA quality was verified by agarose gel electrophoresis, and its concentration was measured using a concentration meter. Reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A) was used to synthesize cDNA for subsequent experiments.

[0050] 2. PCR Amplification of the CsSERK1 Gene Coding Sequence

[0051] The DNA fragment encoding the CsSERK1 sequence was amplified from citrus cDNA using the primers OE-CsSERK1-F (SEQ ID NO: 2), OE-CsSERK1-R (SEQ ID NO: 3) and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q). The length of the fragment was 696 bp (as Figure 2 shown). The amplified DNA fragment was determined to be the coding sequence of the citrus CsSERK1 gene (SEQ ID NO: 1) by sequencing. Under ultraviolet light, the agarose gel block containing the target fragment was cut with a clean blade, and the DNA fragment was recovered using a gel extraction kit (BioFlux, CAT: BSC02M1). Among them, the primer OE-CsSERK1-R (SEQ ID NO: 3) contains a flag tag.

[0052] PCR amplification program: 94°C, 5 min; 94°C, 30 s, 58°C, 30 s, 72°C, 1.5 min, 35 cycles; 72°C extension for 10 min.

[0053] The nucleotide sequence of primer OE-CsSERK1-F SEQ ID NO: 2:

[0054] GGTACCATGGCGTCTCAATCTCATTTATATGTTC

[0055] The nucleotide sequence of primer OE-CsSERK1-R SEQ ID NO: 3:

[0056] GTCGACTTACTTATCATCATCATCCTTGTAATCCTTATCATCATCATCCTTGTAATCCTTATCATCATCATCCTTGTAATCATACTTTCGAGCTCTTGGGTCTTG

[0057] Example 3

[0058] Construction of the overexpression vector of the citrus CsSERK1 gene and transformation of Agrobacterium

[0059] 1. Construction of the overexpression vector

[0060] The DNA fragment encoding the CsSERK1 sequence and the overexpression vector pLGNe were double-digested with the restriction enzymes KpnⅠ and SalI (ThermoFisher), and then gel extraction was performed. The ligation was carried out overnight at 16 °C using the T4 DNA Ligase kit (Promega, CAT: M1801). The ligation product was transformed into Escherichia coli DH5α, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the overexpression vector pLGNe-CsSERK1 of CsSERK1 (as Figure 3 shown).

[0061] 2. Transformation of the overexpression vector into Agrobacterium

[0062] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The method is as follows: Take the frozen Agrobacterium competent cells EHA105 (50 μL) and thaw them on ice in advance; add 2 μL of the plasmid of the overexpression vector to the competent cells, mix well by pipetting, and place on ice for 5 min; transfer the mixture to the bottom of the pre-dried electroporation cuvette, place the electroporation cuvette in the card slot and adjust it to the correct position, adjust the electroporation device to the "Agr" file, press the electroporation button, and check the electroporation data to ensure successful electroporation; add 1 mL of LB liquid medium (containing 50 mg / L of the antibiotic kanamycin) to the electroporation cuvette, mix well with a pipette, transfer it to a sterile centrifuge tube, and incubate it on a shaker at 260 r / min and 28 °C for 60 min; centrifuge the bacterial solution at 10000 r / min for 1 min, discard the supernatant (leave about 100 μL of liquid for resuspending the bacteria), resuspend the bacteria and spread them on the LB solid medium, and incubate them in the dark at 28 °C upside down for 2 days; after the bacterial colonies grow, use the primers OE-CsSERK1-F (SEQ ID NO: 2) and OE-CsSERK1-R (SEQ ID NO: 3) to perform PCR verification on the single colonies.

[0063] PCR reaction conditions: 94 °C for 3 min; 94 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s, 30 cycles; 72 °C for 10 min.

[0064] Example 4

[0065] Overexpression of the CsSERK1 gene in transgenic citrus

[0066] The process of citrus genetic transformation was carried out as Figure 4 shown, and the specific operations are as follows:

[0067] 1. Obtaining of the epicotyls of citrus seedlings

[0068] Fresh citrus fruits were washed, surface-sterilized with 70% alcohol, and seeds were taken out under sterile conditions. The seed coats were removed using a sterile scalpel in a laminar flow hood, and the seeds were germinated on a seed medium, cultured in the dark at 28°C for 3 weeks, and then cultured under a 16 h light / 8 h dark condition for 1 week. The epicotyls of the germinated seedlings were cut into 1.5 cm stem segments under sterile conditions for Agrobacterium tumefaciens-mediated genetic transformation.

[0069] 2. Preparation of Agrobacterium tumefaciens suspension

[0070] Before transfection, Agrobacterium tumefaciens (containing the pLGNe-CsSERK1 vector) for transfection was streaked on an LB solid medium containing 50 mg / L kanamycin; single colonies were picked and inoculated into 25 mL of an LB liquid medium containing the same antibiotic, and cultured overnight with shaking at 28°C. First, the bacterial suspension was diluted to OD = 0.1 and then continued to be cultured until OD = 0.5 (measuring the light wavelength at about 600 nm), centrifuged at 5000 r / min for 10 min, the supernatant was discarded, and the pellet was resuspended with an MS liquid medium at pH 5.4 for transfection.

[0071] 3. Transformation of citrus epicotyls

[0072] The citrus epicotyl stem segments were soaked in the Agrobacterium tumefaciens suspension for 13 min and then dried, and the stem segments were transferred to a co-culture medium and cultured in the dark at 26°C for 2 days. After co-culture, the epicotyls were transferred to a selection medium and cultured in the dark at 28°C for 7 days. The epicotyls were cultured at 28°C under a 16 h light / 8 h dark condition and subcultured every two weeks, and then identified by GUS staining.

[0073] 4. Seedling culture of transformants

[0074] For the seedlings stained positively, when they grew to more than 1 cm, they were cut and grafted onto the seedlings of late Jincheng oranges in sterile test tubes and cultured in a seedling medium. When the seedlings grew to about 5 cm, they were grafted onto the seedlings of trifoliate orange and cultured in a greenhouse at 28°C. The same operation was carried out for the negative seedlings of the same batch as a negative control for subsequent experiments.

[0075] The media used in this example are as follows:

[0076] Seed germination medium: MS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0077] Co-culture medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 1 mg / L 2,4–D + 100 μmol AS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.

[0078] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, PH 5.8.

[0079] Seedling medium: MS+30g / L sucrose, PH 5.8.

[0080] Example 5

[0081] Verification of transgenic plants overexpressing CsSERK1 gene

[0082] 1. GUS staining identification of transgenic plants

[0083] The leaves of the transgenic plants obtained in the initial screening were cut into leaf discs (7 mm in diameter) and subjected to GUS histochemical staining (24 h). The edges of the leaf discs of the positive plants showed blue color, while the leaf discs of the WT plants did not show color (e.g. Figure 5 as shown).

[0084] 2. PCR identification of transgenic plants

[0085] 100 mg of leaves from transgenic plants were used to extract genomic DNA using a DNA extraction kit (Adlai, CAT: DN15), and PCR was used to detect the integration of the CsSERK1 coding sequence in the citrus genome. The detection primers were ID-CsSERK1-F (SEQ ID NO: 4) and ID-CsSERK1-R (SEQ ID NO: 5). A 716 bp amplified fragment was obtained from positive plants, while no amplification was obtained from WT plants (e.g. Figure 6 as shown).

[0086] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0087] 3. qRT-PCR Analysis of Transgenic Plants

[0088] Total RNA (Adelaide, CAT No: RN09) was extracted from the leaves of transgenic plants, and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT No: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsSERK1-F (SEQ ID NO: 6) and RT-CsSERK1-R (SEQ ID NO: 7). -△△CtMethod for calculating the relative expression level of the CsSERK1 gene in transgenic plants: Define the sample treated with water as the reference factor, that is, the expression level of CsSERK1 in it is 1, and then calculate the multiple of the gene expression relative to the reference factor in transgenic citrus 2 -△△Ct , which is its relative expression level. The results showed that the CsSERK1 gene had a high-level expression in transgenic plants compared with wild-type plants (up to more than 421 times that of the control) (as Figure 7 shown).

[0089] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.

[0090] The nucleotide sequence of primer ID-CsSERK1-F SEQ ID NO: 4:

[0091] TTGTGATTGTTGTGGGCGTG

[0092] The nucleotide sequence of primer ID-CsSERK1-R detection-R SEQ ID NO: 5:

[0093] TCATAGGCGTCTCGCATATCTCATT

[0094] The nucleotide sequence of primer RT-CsSERK1-F detection-F SEQ ID NO: 6:

[0095] GTTACCTGCAACAGCGAGGA

[0096] The nucleotide sequence of primer RT-CsSERK1-R detection-R SEQ ID NO: 7:

[0097] TTGAACAGGCCCAAGCTGAT

[0098] Example 6

[0099] Resistance evaluation of transgenic plants overexpressing the CsSERK1 gene

[0100] After washing the mature leaves of transgenic plants, disinfect them with 75% alcohol and rinse with sterile water, and place them in a laminar flow hood; prick the leaves with the veins as the center, and use a pipette to spot the citrus canker pathogen solution, with 1 μL (1 X 10 5 CFU / mL) spotted at each puncture hole; culture in a constant temperature light incubator at 28°C (16 h light / 8 h dark); take pictures 10 days after inoculating the leaves with the pathogen, and use Image J V1.47 software to count the lesion area.

[0101] The disease severity was divided into grades 0 - 7 according to the lesion area, with the letter R representing the lesion area. Grade 0 (R ≤ 0.25 mm 2 ), grade 1 (0.25 mm 2 <R ≤ 0.5 mm 2 ), grade 2 (0.5 mm 2 <R ≤ 0.75 mm 2 ), grade 3 (0.75 mm 2 <R ≤ 1 mm 2 ), grade 4 (1.0 mm 2 <R ≤ 1.25 mm 2 ), grade 5 (1.25 mm 2 <R ≤ 1.5 mm 2 ), grade 6 (1.5 mm 2 <R ≤ 1.75 mm 2 ), grade 7 (R > 1.75 mm 2 ); The disease index was calculated according to the formula: DI = 100 X Σ (number of lesions at each grade X corresponding grade value) / (total number of lesions X maximum grade).

[0102] The results showed that 10 days after inoculation with Xanthomonas citri subsp. citri, both the overexpressing plants and the WT plants grafted at the same time showed varying degrees of disease incidence in the inoculated plants, and there were certain differences in the lesion sizes (as Figure 8 shown). After statistics and analysis, it was found that the lesion areas of the transgenic plants were significantly smaller than those of the wild - type controls, being 57.91% - 79.11% of the controls (as Figure 9 shown). The disease index of the transgenic plants was significantly smaller than that of the wild - type controls, being 56.74% - 81.98% of the controls (as Figure 10 shown). Thus, it can be seen that overexpression of CsSERK1 can significantly reduce the lesion area of citrus bacterial canker and alleviate the disease severity of citrus canker.

[0103] Thus, it can be seen that overexpression of CsSERK1 can greatly reduce the lesion area of canker and alleviate the disease severity of canker. This gene can be independently used for disease - resistant molecular breeding, or can be used together with other disease - resistant or disease - susceptible genes for citrus canker - resistant molecular breeding.

[0104] The specific embodiments described above further elaborate on the purpose, technical solutions, and beneficial effects of the present invention. It should be understood that the above - mentioned are only specific embodiments of the present invention and are not used to limit the protection scope of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for improving resistance to citrus canker using the CsSERK1 gene, characterized in that: The resistance of citrus to citrus canker is improved by regulating the expression level of the CsSERK1 gene in citrus. The nucleotide sequence of the CsSERK1 gene is shown in SEQ ID NO:

1.

2. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 1, characterized in that: The specific method for regulating the expression level of the CsSERK1 gene is: upregulating the expression level of the CsSERK1 gene in citrus.

3. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 2, characterized in that: The method for up-regulating the expression level of CsSERK1 gene in citrus is: using an overexpression vector to up-regulate the expression level of CsSERK1 gene in citrus cells.

4. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 3, characterized in that: The following steps are involved: (1) Cloning the coding sequence of the citrus CsSERK1 gene; (2) Construction of CsSERK1 gene overexpression vector; (3) The CsSERK1 gene overexpression vector was used to transform citrus to obtain transgenic plants with improved resistance to ulcer disease.

5. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 4, characterized in that: In step (1), the cloning method of the citrus CsSERK1 gene coding sequence is: extracting citrus total RNA, then reverse transcribing it into cDNA, and finally amplifying the CsSERK1 gene coding sequence DNA fragment by PCR.

6. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 5, characterized in that: In step (1), the primers used for PCR amplification are OE-CsSERK1-F and OE-CsSERK1-R, and their nucleotide sequences are SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

7. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 4, characterized in that: In step (2), the method for constructing the CsSERK1 overexpression vector is as follows: the CsSERK1 coding sequence DNA fragment recovered by digestion with KpnⅠ and SalI is ligated to the pLGNe vector recovered by digestion with KpnⅠ and SalI to construct the overexpression vector pLGNe-CsSERK1.

8. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 7, characterized in that: In step (3), the method for transforming citrus with the CsSERK1 overexpression vector is as follows: the overexpression vector pLGNe-CsSERK1 is transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants are transformed by Agrobacterium tumefaciens mediation, and the transgenic plants are obtained by genetic transformation.

9. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 4, characterized in that: The invention also includes verifying the transgenic plants by PCR, using primers ID-CsSERK1-F and ID-CsSERK1-R, whose nucleotide sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

10. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 4, characterized in that: The method also includes detecting the expression level of CsSERK1 gene by qRT-PCR, using primers RT-CsSERK1-F and RT-CsSERK1-R, whose nucleotide sequences are SEQ ID NO: 6 and SEQ ID NO: 7, respectively.

Images