Molecular marker associated with different growth traits of sheep at different stages and application thereof

By sequencing and detecting molecular markers of the sheep XPNPEP2 gene, polymorphic sites were screened, which solved the problem of unclear associations of growth traits in sheep and enabled the breeding screening of fast-growing sheep and the improvement of meat production.

CN119662841BActive Publication Date: 2026-02-06GANSU AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411807624.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-10
Publication Date
2026-02-06
Estimated Expiration
2044-12-10

AI Technical Summary

Technical Problem

In the existing technology, the association of the XPNPEP2 gene with sheep growth traits is unclear, making it difficult to select sheep breeds with rapid weight gain and high meat yield.

Method used

By sequencing the XPNPEP2 gene in sheep, polymorphic sites were screened, and specific primer pairs and kits were designed to establish a molecular marker detection method for identifying TT genotype sheep individuals and screening for fast-growing, high-quality meat sheep.

Benefits of technology

It enables effective identification of sheep growth traits, allowing for the selection of sheep with significantly higher chest and cannon bone circumference during the breeding process, thereby increasing meat production and optimizing livestock production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005179696210000081
    Figure BDA0005179696210000081
  • Figure HDA0005179696220000011
    Figure HDA0005179696220000011
  • Figure HDA0005179696220000012
    Figure HDA0005179696220000012
Patent Text Reader

Abstract

The application provides a molecular marker related to different stage growth traits of sheep and application thereof, the molecular marker is obtained by designing a primer for a XPNPEP2 gene sequence, extracting DNA from sheep blood, amplifying by PCR, DNA sequencing and sequence analysis, finding that a C / T polymorphism site exists at the 95th position of the amplified fragment as shown in SEQ ID NO.1, further detecting the polymorphism site of 740 sheep by using AQP primer, establishing a least square model, and performing correlation analysis on the genotypes and growth traits of chest circumference and pipe circumference, and determining that the Y of the 95bp of SEQ ID NO.1 is a C / T polymorphism site, which can be used as a molecular marker of different stage growth traits of sheep. The molecular marker can be used for screening a new variety of fast growth type high-quality meat sheep, and can be used for screening assisted breeding, cultivating fast growth type sheep, and is helpful to increase economic benefits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker screening and application technology, specifically relating to a molecular marker related to growth traits of sheep at different stages and its application. Background Technology

[0002] Sheep have been one of humanity's most important domestic animals since ancient times, providing abundant products such as wool and mutton. Wool can be used to make clothing, blankets, and other textiles, while mutton is a delicious dish on people's tables. Mutton is flavorful and nutritious, making it popular with consumers. The development of the mutton industry has driven the development of animal husbandry, providing farmers with a stable source of income. To maximize the economic value of the mutton industry, selecting sheep that can gain weight rapidly is crucial. Chest circumference and cannon bone circumference are important body size traits for measuring sheep's growth, development, and production performance, and as indicators of muscle development, they influence meat yield and quality.

[0003] XPNPEP2 (X-prolyl peptidase 2) is a protein-coding gene and a hydrolase specific for N-terminal imine acyl bonds, commonly found in several collagen degradation products, neuropeptides, vasoactive peptides, and cytokines. Structurally, this enzyme is a member of the "pita fold" family and exists in mammalian tissues in a soluble and GPI-anchored membrane-bound form with varying tissue distributions. It is also a membrane-bound metalloproteinase that catalyzes the removal of the penultimate prolyl residue from the N-terminus of peptides, such as Arg-Pro-Pro. It may play a role in the metabolism of the vasodilator bradykinin. Membrane-bound XPNPEP2 is a highly glycosylated glycosylphosphatidylinositol-anchored protein composed of 673 amino acids encoded by the XPNPEP2 gene on human Xq 25. Several bioactive peptides, including collagen (Cols), hormones, growth factors, and cytokines, contain N-terminal Xaa-Pro sequences, making them potential substrates for XPNPEP2. Furthermore, because Col contains a high proportion of this "triad," XPNPEP2 has the potential to degrade Col fibrils intracellularly (lysosomes). Given the potential role of the XPNPEP2 gene in animal growth performance, but with limited research in livestock, selecting individuals with well-performing genotypes could significantly improve livestock growth efficiency and optimize livestock production. However, the specific relationship between the XPNPEP2 gene and sheep traits remains unclear.

[0004] This invention identifies SNPs by sequencing and analyzing the XPNPEP2 gene, and explores the association between different genotypes and sheep growth traits. The aim is to provide a reference for the selection of superior sheep breeds and to provide genetic engineering methods for breeding excellent sheep breeds. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker associated with growth traits at different stages of sheep growth and its application. The molecular marker of this invention is amplified from the sheep XPNPEP2 gene, and its specific nucleotide sequence is shown in SEQ ID NO.1. By amplifying and sequencing the DNA sequence of the sheep XPNPEP2 gene, and screening for polymorphic sites in the XPNPEP2 gene, a method for detecting molecular markers associated with growth traits at different stages of sheep can be established, and this molecular marker can be applied to the breeding of fast-growing, high-quality meat sheep breeds.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A molecular marker associated with growth traits at different stages of sheep, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein the Y at the 95th bp is C or T, and this mutation leads to C / T polymorphism of the molecular marker.

[0008] As described above, the application of molecular markers in screening fast-growing sheep showed that sheep individuals with the TT genotype at the polymorphic locus had significantly higher chest circumference and cannon bone circumference at 80-180 days of age than sheep individuals with the CC genotype.

[0009] The application of a primer pair for detecting the molecular markers associated with growth traits at different stages of sheep in screening fast-growing sheep, preferably, the nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0010] The application of an AQP primer for detecting the molecular markers associated with growth traits at different stages of sheep in screening fast-growing sheep, preferably, the nucleotide sequences of the AQP primer are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.

[0011] The application of a kit for detecting the above-mentioned molecular markers related to growth traits at different stages of sheep in screening fast-growing sheep, preferably, the kit includes ordinary PCR primer pairs or AQP sequence pairs, the nucleotide sequences of the ordinary PCR primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequences of the AQP primers are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.

[0012] A method for detecting the aforementioned molecular markers associated with growth traits at different stages of sheep includes the following steps:

[0013] 1) Amplify sheep blood genomic DNA using the above-mentioned ordinary PCR primer pairs, AQP primer pairs, or kits containing the above primer pairs;

[0014] 2) The polymorphic sites of the amplification products obtained in step 1) are identified by typing.

[0015] In step 2), the above-mentioned typing and identification methods include, but are not limited to, direct sequencing, fluorescent probe method, gene chip method, and high-resolution melting curve method.

[0016] Furthermore, preferably, when using ordinary PCR primer pairs for amplification, the polymorphic sites of the amplification products are identified by direct sequencing.

[0017] Furthermore, preferably, when using AQP primer pairs for amplification, the genotyping results are viewed by detecting the fluorescence signal.

[0018] The above-described method, when applied to the screening of fast-growing sheep, allows for the determination of chest circumference and cannon bone circumference at different growth stages by analyzing the types of polymorphic sites. This enables the screening of sheep with higher chest circumference and cannon bone circumference. The Y at position 95 bp of the amplified product, as shown in SEQ IN NO.1, represents either C or T, indicating a T / C polymorphism in the molecular marker. Sheep carrying the TT genotype exhibit significantly higher chest circumference and cannon bone circumference at 80-180 days of age compared to those carrying the CC genotype; larger chest circumference and cannon bone circumference correlate with higher meat yield.

[0019] The application of molecular markers, PCR primer pairs for detecting molecular markers, AQP primers, or kits in sheep breeding, as described above, involves amplifying and detecting the genomic DNA of sheep using the aforementioned primer pairs or kits to determine the genotype of the molecular markers in the sheep to be tested. This allows for the selection of fast-growing sheep breeds with high meat production. Sheep carrying the TT genotype should be screened for breeding.

[0020] The beneficial effects of this invention are as follows:

[0021] This invention, through PCR amplification and sequencing of the sheep XPNPEP2 gene, discovered a C / T polymorphism site at position 95 of the amplified fragment shown in SEQ ID NO.1. By detecting the polymorphism in 740 Hu sheep and establishing a least-squares model, a molecular marker associated with growth traits at different stages of sheep was identified. The nucleotide sequence of this molecular marker is shown in SEQ ID NO.1, where Y at position 95 bp is either C or T. This mutation leads to the C / T polymorphism of the molecular marker. When sheep individuals with the TT genotype at the polymorphic site are present, their chest circumference and cannon bone circumference at 80-180 days of age are significantly higher than those with the CC genotype. In breeding, sheep with the TT homozygous gene are selected as breeding stock to cultivate fast-growing, high-meat-yielding, high-quality meat sheep. This provides genetic material for the genetic improvement of sheep growth traits and has significant practical application value.

[0022] The molecular markers and their C / T polymorphic sites associated with growth traits at different stages of sheep provided by this invention can effectively identify whether a sheep has rapid growth in chest girth and cannon bone circumference by detecting the genotype of the polymorphic site, thus providing an effective detection method for the breeding of fast-growing sheep. Attached Figure Description

[0023] Figure 1 This is a gel electrophoresis image of the amplified LGALS3 gene fragment in sheep; lane M: DL 3000Plus Marker, lanes 1-10: amplification results of genomic DNA from the blood of ten sheep.

[0024] Figure 2 The sequencing results are for the sheep XPNPEP2 gene mutation site in this invention.

[0025] Figure 3 The results of AQPTM typing of the g.113699247C> mutation site in the sheep XPNPEP2 gene in this invention are shown. Among them, the blue dot near the left represents the CC genotype, the green dot near the middle represents the CT genotype, and the orange dot near the right represents the TT genotype. Detailed Implementation

[0026] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0027] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and unless otherwise specified, all reagents used in the embodiments are analytical grade or higher.

[0028] Example 1: Amplification of the XPNPEP2 gene

[0029] 1) Primer design

[0030] Using sheep XPNPEP2 gene DNA (GenBank accession number: NC_056080.1) as a template, a pair of primers, upstream primer F and downstream primer R, were designed using Oligo 7.0 software. The primer sequences are as follows:

[0031] Upstream primer F (SEQ ID NO.2): 5'-TTGGGCTCAATTATGGTCAC-3', Downstream primer R (SEQ ID NO.3): 5'-GGCTCTGGCTATTATTTCTCTG-3'

[0032] 2) Amplification and sequencing of the XPNPEP2 gene

[0033] Genomic DNA was extracted from the blood of 10 sheep as templates. The PCR reaction system was 35 μL, which included: 17.5 μL of 2×PCR Master Mix, 1 μL of upstream primer F with a concentration of 10 μmol / L, 1 μL of downstream primer R with a concentration of 10 μmol / L, 1.5 μL of DNA template, and 14 μL of ddH2O.

[0034] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 52.5℃ annealing for 30 s, 72℃ extension for 60 s, for 35 cycles, and a final extension at 72℃ for 10 min.

[0035] The PCR product was detected by 1.5% agarose gel electrophoresis, and the results showed a specific amplified fragment, such as... Figure 1 As shown. The amplified PCR fragment was sequenced, and the sequencing results showed that the specific nucleotide sequence of the amplified fragment was as shown in SEQ ID NO.1. A polymorphic site, Y (represented by C or T), was present at position 95 bp of this sequence. That is, the amplified XPNPEP2 gene fragment, as shown in SEQ ID NO.1, exhibits C / T polymorphism at position 95 bp. The results of the amplified XPNPEP2 gene fragments from 10 sheep were compared using SeqMan software, and the results were found to be... Figure 2 As shown.

[0036] SEQ ID NO.1: TTGGGCTCAATTATGGTCACGGGACAGGCCATGGC ATTGGCAACTTCCTATGTGTGCACGAGTGTAGGTATCTCTTTGGCACTCCCCTGCAGTCYCCCCTTATGAGAGAGGCAGAGTATTTCACAGGTATGGAAAGGACTGGGACCCGTGGAGGGGCAGTGACCCAGGCCAGGGGACCCAGCT GGTGGGAAGTTGGTGCTCCACAGGGTAAGTGAGAAATGCTGGCAGTTGGCCACTCCAACTGGCATCCAGGATGGGTCCAGAAAGAAGAGAGGCAGGTCAAGACACAGTGGCTGACTGGCCTAGACCCCAGAGAAATAATAGCCAGAGCC.

[0037] (3) DNA sequence homology retrieval and identification:

[0038] The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 99% homology with a partial sequence of the sheep XPNPEP2 gene DNA (GenBank accession number: NC_056080.1).

[0039] Example 2: Establishment of a genotyping detection method

[0040] (1) Primer sequence design

[0041] AQP was designed targeting the C / T polymorphic sites of the amplified fragment in Example 1. TM Primer pairs, thereby enabling the specific detection of the polymorphic sites, the AQP TM The nucleotide sequences of the primer pair are as follows:

[0042] Forward primer A1 (SEQ ID NO.4) used to detect AlleleT:

[0043] 5′-GAAGGTGACCAAGTTCATGCTTGGCACTCCCCTGCAGTCT-3′;

[0044] Forward primer A2 (SEQ ID NO.5) used to detect AlleleC:

[0045] 5′-GAAGGTCGGAGTCAACGGATTTTGGCACTCCCCTGCAGTCC-3′;

[0046] Universal reverse primer C (SEQ ID NO.6): 5'-CGGGTCCCAGTCCTTTCCAT A-3'.

[0047] The above primers were synthesized by Beijing Sangon Biotech Co., Ltd., and AQP was used. TM Each primer pair was diluted to 100 μmol / L for later use.

[0048] (2) Extracted genomic DNA and subjected to quality control.

[0049] Genomic DNA can be extracted from sheep blood using a DNA extraction kit. The extracted genomic DNA is then subjected to quality testing using 1% agarose gel electrophoresis and Nanodrop 2100. The DNA must meet the following requirements: (1) Agarose gel electrophoresis shows a single DNA band without significant diffusion. (2) Nanodrop 2100 analysis shows A260 / 280 between 1.8 and 2.0; A260 / 230 between 1.8 and 2.0; and no significant light absorption at 270 nm. If these requirements are not met, genomic DNA should be extracted again. (Based on AQP data from Beijing Jiacheng Biotechnology Co., Ltd.) TM The detection technology and genome size calculations determined the DNA usage to be 2–50 ng / sample. The extracted genomic DNA was then diluted to a concentration of 2–50 ng / μL to serve as a DNA template.

[0050] (3) Genotyping

[0051] First, let's look at the above AQP. TM Each primer in the primer pair (100 μmol / L) was mixed with sterile water in a volume ratio of primer A1: primer A2: primer C: sterile water of 12:12:30:46 to prepare a primer mixture for later use.

[0052] Then, using a pipette, add 0.07 μL of primer mixture, 0.5 μL of sterile water, 2.5 μL of HiGeno 2xProbe Mix, and 2 μL of diluted DNA template (2–50 ng / μL) to each well of a 384-well plate. After adding the primer mixture, seal the plate, centrifuge with shaking, and place it on a C1000Touch™ Thermal Cycler instrument for PCR amplification.

[0053] The specific procedure is as follows:

[0054] Pre-denaturation at 95℃ for 10 minutes;

[0055] 95℃, 20 seconds (denaturation) — 61℃-55℃, 40 seconds (annealing & extension), amplification for 10 cycles, with a decrease of 0.6℃ per cycle;

[0056] 95℃, 20 seconds (denaturation) — 55℃, 40 seconds, continue amplification for 34 cycles.

[0057] After amplification, fluorescence signals were detected and genotyping results were examined using a C1000 Touch™ Thermal Cycler instrument at 37°C. Some sample detection results are shown below. Figure 3 As shown in the figure. HEX is the horizontal axis and FAM is the vertical axis. Each graph in the figure represents a sample of the test material. The blue square near the left indicates that the locus is homozygous genotype "CC"; the green triangle near the middle indicates that the locus is heterozygous genotype "CT"; and the orange dot near the right indicates that the locus is homozygous genotype "TT".

[0058] (4) Application of the molecular markers of the present invention in the association analysis of marker traits of sheep growth traits

[0059] The experiment examined the polymorphism of 740 Hu sheep, determined their genotypes, and established the least squares model as described below to conduct association analysis between genotype and growth traits.

[0060] Y ijkl =μ+Genotype i +P j +F k +M l +ε ijkl

[0061] Among them, Y ijkl Here are the observed trait values, μ is the population mean, and Genotype. i For genotype effect, P j Due to the batch effect, F k Due to the paternal effect, M l Maternal effect, ε ijkl Assuming random error, let ε ijlmk They are mutually independent and follow N(0, σ). 2 )distributed.

[0062] Genotyping results showed that among 740 individuals, 375 had the CC genotype, 76 had the CT genotype, and 289 had the CC genotype. The results of the genotype-trait association analysis are shown in Table 1. Here, 80-day-old chest circumference refers to the length of the sheep's chest at 80 days of age, and 80-day-old cannon circumference refers to the length of the sheep's cannon circumference at 80 days of age; similarly, chest circumference is the vertical circumference of the chest measured at the posterior angle of the shoulder ribs, and cannon circumference is the horizontal circumference measured at the upper third of the left forearm bone.

[0063] Table 1. Association analysis of XPNPEP2 gene polymorphism and growth traits in sheep.

[0064]

[0065] Note: Different lowercase superscripts in the same row indicate significant differences (P<0.05), while the same superscript indicates no significant differences (P>0.05).

[0066] The results showed that the XPNPEP2 g.113699247C>T mutation site, specifically the C / T mutation site at position 95 bp shown in SEQ ID NO.1, was significantly correlated with sheep growth traits (birth weight, chest girth, and cannon bone circumference) (P<0.05). Individuals carrying the TT genotype had significantly higher chest girth and cannon bone circumference than those carrying the CC genotype. Chest girth and cannon bone circumference are important production performance indicators closely related to meat yield; larger chest girth and cannon bone circumference correlate with higher meat yield. Therefore, individuals with the TT genotype can be used as breeding stock to cultivate fast-growing, high-meat-yielding meat sheep with excellent meat quality.

Claims

1. The use of reagents for detecting molecular markers associated with different stages of growth traits in sheep in the selection of sheep of higher girth and pipe girth, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein Y at 95bp is C or T, and the mutation leads to C / T polymorphism of the molecular marker; the chest circumference and pipe circumference of the sheep individual carrying TT genotype at 80-180 days of age are significantly higher than those of the sheep individual carrying CC genotype, and the sheep is Lake sheep.

2. The primer pair for detecting the molecular marker related to the growth traits at different stages of Hu sheep is applied in screening the sheep with higher chest circumference and pipe circumference, characterized in that, The nucleotide sequences of the primer pairs are shown as SEQ ID NO. 2 and SEQ ID NO. 3; the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein Y at 95bp is C or T, and the mutation leads to C / T polymorphism of the molecular marker; the chest circumference and pipe circumference of the sheep individual carrying TT genotype at 80-180 days of age are significantly higher than those of the sheep individual carrying CC genotype, and the sheep is Lake sheep.

3. The use of AQP primer for detecting the molecular marker associated with different growth traits of different stages of sheep in claim 1 in screening sheep with higher chest and girth, characterized in that, The nucleotide sequences of the AQP primers are shown as SEQ ID NO. 4-SEQ ID NO. 6; the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein Y at 95bp is C or T, and the mutation leads to C / T polymorphism of the molecular marker; the chest circumference and pipe circumference of the sheep individual carrying TT genotype at 80-180 days of age are significantly higher than those of the sheep individual carrying CC genotype, and the sheep is Lake sheep.

4. Use of a kit for detecting the molecular marker associated with different stages of growth traits in sheep according to claim 1 in the selection of sheep with higher girth and pipe girth, characterized in that, The kit comprises ordinary PCR primer pairs or AQP primer pairs, the nucleotide sequences of the ordinary PCR primer pairs are shown as SEQ ID NO. 2 and SEQ ID NO. 3; the nucleotide sequences of the AQP primer pairs are shown as SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6; the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein Y at 95bp is C or T, and the mutation leads to C / T polymorphism of the molecular marker; the chest circumference and pipe circumference of the sheep individual carrying TT genotype at 80-180 days of age are significantly higher than those of the sheep individual carrying CC genotype, and the sheep is Lake sheep.

5. Use of the method for detecting the molecular marker associated with different growth traits in different stages of sheep according to claim 1 in screening sheep with higher chest and girth, characterized in that, It comprises the following steps: 1) using the ordinary PCR primer pairs, the AQP primer pairs or the kit comprising the above primer pairs according to claim 4 to amplify the sheep blood genomic DNA; 2) typing and identifying the polymorphic site of the amplification product obtained in step 1); The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein Y at 95bp is C or T, and the mutation leads to C / T polymorphism of the molecular marker; the chest circumference and pipe circumference of the sheep individual carrying TT genotype at 80-180 days of age are significantly higher than those of the sheep individual carrying CC genotype, and the sheep is Lake sheep.

6. The use according to claim 5, wherein the compound is ###0002### When the ordinary PCR primer pairs are used for amplification, the direct sequencing method is used to identify the polymorphic site of the amplification product.

7. The use according to claim 5, wherein the compound is ###0002### When the AQP primer pairs are used for amplification, the typing result is checked by detecting the fluorescence signal.

8. The use of a PCR primer pair or AQP primer pair or kit for detecting a molecular marker related to different stages of growth traits of sheep in sheep breeding, characterized in that, The breeding is for breeding sheep with higher chest girth and pipe girth, the nucleotide sequences of the PCR primer pair are shown in SEQ ID NO. 2 and SEQ ID NO. 3, the nucleotide sequences of the AQP primer pair are shown in SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6, the kit comprises the PCR primer pair or the AQP primer pair, the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, wherein Y at the 95th bp represents C or T, and the mutation causes C / T polymorphism of the molecular marker; the chest girth and pipe girth of the sheep individual carrying the TT genotype at the age of 80-180 days are significantly higher than those of the sheep individual with the CC genotype, and the sheep with the TT genotype are screened for breeding; The sheep is a Hu sheep.

Citation Information

Patent Citations

  • Molecular marker related to sheep body size as well as detection method and application thereof

    CN116064831A

  • Methods and reagents for determining desirable meat eating quality traits in ovine animals and use of same in animal breeding

    WO2024000008A1