Antibacterial peptide from zebra fish

Abstract

The invention provides an antibacterial peptide derived from zebra fish, the amino acid sequence of the antibacterial peptide is SEQ ID NO: 1, and the sequence of coding nucleotide of the antibacterial peptide is SEQ ID NO: 2. The antibacterial peptide provided by the invention can be used for preparing products for preventing, treating and resisting bacteria. The zebrafish antibacterial peptide mP60-81 disclosed by the invention has a remarkable antibacterial effect on gram-positive bacteria and gram-negative bacteria, is wide in antibacterial spectrum, has great use value, and has better application in the aspect of developing and preparing antibacterial agents. The antibacterial peptide is derived from zebra fish, can be applied to aquaculture as a feed additive, and can also be developed into an antibacterial agent, an antibacterial drug and the like, so that the antibacterial peptide has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of antimicrobial peptides, and particularly relates to an antimicrobial peptide derived from zebrafish. Background Art

[0002] At present, the aquaculture industry uses antibiotics to control pathogenic bacteria in aquatic animals in order to increase the production of aquatic animals. However, excessive use of antibiotics will not only increase bacterial resistance, increase the cost of disease prevention and control, and weaken the effect, but also pollute the water environment, causing imbalance in the microecology inside and outside the aquatic animals. Antibiotics left in the water will also accumulate in the food chain and eventually endanger human health.

[0003] Antimicrobial peptides (AMPs) are a class of small molecule polypeptide substances widely found in natural organisms. They have a small relative molecular weight, generally 20 to 50 amino acid molecules; are positively charged under neutral conditions; have an isoelectric point generally greater than 7; have water-lipid amphiphilicity; have good thermal stability, acid-base stability and protease stability, and have a wide antibacterial spectrum. Antimicrobial peptides are an essential component of the innate immune system and are usually the first line of defense against pathogens.

[0004] It is generally believed that antimicrobial peptides have the effect of destroying the cell membrane structure, causing the substances in the cell to flow out, thereby achieving the effect of killing cells. However, a large number of studies have shown that destroying the cell membrane structure to achieve the effect of killing cells is not the only mechanism of action of antimicrobial peptides. Related studies have found that antimicrobial peptides can also produce antimicrobial effects in other ways, including inhibiting cell respiration, inhibiting cell wall formation, inhibiting protein or nucleic acid synthesis, etc. Some proline-rich antimicrobial peptides can also bind to heat shock proteins in cells to exert antimicrobial activity. In many studies, it has been found that antimicrobial peptides can bind to specific receptors on the cell membrane, mediating the cell to ingest the antimicrobial peptides into the body, and then the antimicrobial peptides will interfere with the normal physiological activities of the cell, thereby making the cell unable to work normally and killing it.

[0005] At present, the conventional method in aquaculture is to use antibiotics to control pathogenic bacteria in aquatic animals. Although there have been reports of antimicrobial peptides replacing antibiotics, the existing natural antimicrobial peptides themselves are not very stable in structure, are easily degraded, have weak antimicrobial activity, and require very high doses to be effective. Therefore, antimicrobial peptides can only be used on a small scale. Summary of the invention

[0006] The purpose of the present invention is to provide an antibacterial peptide derived from zebrafish, which has strong antibacterial activity and can be used for preparing antibacterial products.

[0007] The antimicrobial peptide derived from zebrafish provided by the present invention has an amino acid sequence of SEQ ID NO: 1 (ILVWRFIVIRKKKYFKRHII).

[0008] The encoding nucleotide sequence is as follows (SEQ ID NO: 2):

[0009] ATTCTGGTGTGGCGCTTTATTGTGATTCGCAAAAAAAAATATTTTAAACGCCATATTATT.

[0010] The present invention also provides a use of the antimicrobial peptide, which is the use in preparing a preventive and therapeutic antimicrobial product;

[0011] The present invention also provides another use of the antimicrobial peptide, which is use as a feed additive.

[0012] In yet another aspect, the present invention provides an antibacterial preparation, wherein the antibacterial preparation contains the above-mentioned antibacterial peptide in a pharmacologically effective concentration.

[0013] Zebrafish antimicrobial peptide mP of the present invention 60-81 It has significant antibacterial effects on both Gram-positive and Gram-negative bacteria, a broad antibacterial spectrum, and great use value. It has good application in the development and preparation of antibacterial agents. This antimicrobial peptide is derived from zebrafish and can be used in aquaculture as a feed additive, or developed into antibacterial agents and antibacterial drugs, etc., so it has a wide range of application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 : is the target peptide mP 60-81 The structural diagram of

[0015] Figure 2 : Target peptide mP 60-81 The effect of destroying bacterial cell walls.

[0016] Figure 3 : Target peptide mP 60-81 PGN binding effect diagram,

[0017] Figure 4 : Target peptide mP 60-81 The effect diagram of LPS binding is shown in Figure 2.

[0018] Figure 5 : Target peptide mP 60-81 The LTA binding effect diagram,

[0019] Figure 6 :The target peptide mP60-81 improves the survival rate of zebrafish infected with Vibrio anguillarum.

[0020] Figure 7 : Target peptide mP 60-81 Photograph showing the therapeutic effect on zebrafish infected with Vibrio anguillarum. DETAILED DESCRIPTION

[0021] The present invention performs mutation on the amino acid sequence of zebrafish PLEKHF2 protein to screen and obtain a target peptide mP with broad-spectrum antibacterial activity. 60-81 .mP 60-81 It has strong antibacterial activity, stability, and practical value, and has good application in the development and preparation of antibacterial agents. It can be used in aquaculture as a feed additive, and can also be developed into antibacterial agents and antibacterial drugs, etc., so it has broad application prospects.

[0022] The present invention is described in detail below in conjunction with embodiments and drawings.

[0023] Example 1: Screening of target peptide mP 60-81

[0024] Based on the verification that zebrafish PLEKHF2 protein has antibacterial activity, we extracted amino acid sequences from the domains with antibacterial activity on the protein with the help of bioinformatics analysis tools and the basic characteristics of antimicrobial peptides, screened out sequences that met the physicochemical properties of antimicrobial peptides, and subjected the screened peptides to multiple single-site mutations and amidation. Through structural comparison of the transformed peptides, we obtained the optimized peptide segment mP 60-81 , which has 20 amino acid residues, the amino acid sequence is ILVWRFIVIRKKKYFKRHII (SEQ ID NO: 1), and the encoding nucleotide sequence is as follows (SEQ ID NO: 2):

[0025] ATTCTGGTGTGGCGCTTTATTGTGATTCGCAAAAAAAAATATTTTAAACGCCATATTATT.

[0026] Zebrafish target peptide mP 60-81 The molecular weight is 2.657 kDa, the isoelectric point is 11.75, and the overall charge is +7. Figure 1 mP 60-81 Structural diagram of , where yellow represents non-polar hydrophobic amino acid residues, blue represents polar positively charged amino acid residues, and light blue represents polar uncharged basic amino acid residues.

[0027] Based on the obtained peptide sequence, polypeptide fragments were obtained through artificial chemical synthesis, and their antibacterial activity was preliminarily identified.

[0028] Example 2: Target peptide mP 60-81 Antimicrobial activity

[0029] 1. Prediction of antibacterial activity

[0030] The screened target peptide mP 60-81 The website was used to predict the antibacterial activity. The prediction results are shown in Table 1. 60-81 The probabilities of being antimicrobial peptides all exceeded 0.95, and one algorithm had a probability of 1, so they could be preliminarily used as antimicrobial peptides for subsequent experiments.

[0031] Table 1: Prediction of antibacterial activity of target peptides

[0032]

[0033] 2. Target peptide mP 60-81 Antimicrobial activity test

[0034] The strains involved in this embodiment include Gram-positive bacteria: Staphylococcus aureus (S.aureus, ATCC 6538), Micrococcus luteus (Bacillus subtilis, B.subtilis, ATCC 6633), Bacillus subtilus (Micrococcus luteus, M.luteus, ATCC 49732); Gram-negative bacteria: Escherichia coli (E.coli, ATCC 25922), Vibrio anguillarum (V.anguillarum, ATCC 43308), Aeromonas hydrophila (A.hydrophila, ATCC 35654).

[0035] The specific antibacterial activity testing steps are as follows:

[0036] (1) Activate bacteria

[0037] ① Cultivate single colonies. Glycerol-preserved solid strains were cultured overnight at 37°C on solid culture medium.

[0038] ② Pick a single colony. Pick a single colony and place it in liquid culture medium.

[0039] ③Activation. Incubate the cells in a shaking incubator at 37°C overnight.

[0040] (2) Determine the concentration of bacterial solution. Calculate using the solid culture medium method.

[0041] (3) Configure target peptide mP 60-81 Solution and bacteria mixed system. Adjust the target peptide mP 60-81 The solution concentration gradient was constructed by double dilution method.

[0042] (4) Sample spotting. Add the mixed system to the microwells of a 96-well plate, and spot three wells of each system for parallel experiments. Immediately after spotting, measure the OD value at the corresponding wavelength using an ELISA reader.

[0043] (5) Cultivation: Place the loaded 96-well plate in a constant temperature incubator and incubate at room temperature for 24 h to measure the OD value.

[0044] (6) MIC determination: The minimum inhibitory concentration of the target peptide was obtained based on the measured OD value.

[0045] The results are shown in Table 2 below. 60-81 It has an antibacterial effect on both Gram-positive and Gram-negative bacteria, and the minimum inhibitory concentration is high. Vibrio anguillarum was selected for subsequent experiments.

[0046] Table 2: mPs screened from zebrafish PLEKHF2 60-81 Minimum inhibitory concentration (MIC) table

[0047]

[0048] Example 3: Target peptide mP 60-81 Destructive effect on bacterial cell walls

[0049] (1) Bacteria-protein binding. Mix Vibrio anguillarum and the target peptide solution in a centrifuge tube. Incubate the mixed system in a 25°C constant temperature incubator for 2 h.

[0050] (2) Washing and removing impurities: After the incubation, wash the system with phosphate buffer.

[0051] (3) Fixation: Add 2.5% glutaraldehyde for electron microscopy and fix at 4°C in the dark.

[0052] (4) Spotting. Place the fixed bacterial solution on the silicon wafer and keep it away from light.

[0053] (5) Observe and take photos using a scanning electron microscope.

[0054] The preparation method of the control group samples was the same as that of the target peptide group.

[0055] The results are as follows Figure 2 As shown, without target peptide mP 60-81 The surface of the treated Vibrio anguillarum was slightly concave, but the bacteria were intact, with no rupture of the cell wall or cell membrane. 60-81 The shape of the treated Vibrio anguillarum becomes irregular, the surface is rough, the bacteria are severely deformed and some cell walls (membranes) are even destroyed, the bacterial solutes flow out, and the bacteria die.

[0056] The above results indicate that the antimicrobial peptide mP 60-81It can destroy the cell wall of Vibrio anguillarum, causing the cell wall (membrane) to lose integrity and leak the intracellular lysate of the bacteria. This indicates that the antimicrobial peptide mP 60-81 It has the ability to kill bacteria directly.

[0057] Example 4: Target peptide mP 60-81 Binds to peptidoglycan, lipopolysaccharide and lipoteichoic acid

[0058] (1) Target peptide mP 60-81 and BSA biotinylation. The target peptide mP 60-81 The solution and the BSA solution were mixed with biotin and incubated at room temperature to obtain the biotinylated target peptide mP 60-81 and BSA solution.

[0059] (2) Peptidoglycan (PGN), lipopolysaccharide (LPS) and lipoteichoic acid (LTA) are bound to the plate. PGN, LPS or LTA solution is added to the wells of a 96-well plate and incubated at 25°C, followed by blocking with BSA solution.

[0060] (3) Washing: Use PBST washing solution for washing.

[0061] (4) Biotinylated target peptide mP 60-81 and BSA combined with PGN or LPS or LTA. Biotinylated target peptide mP was added to the microwells of a 96-well plate. 60-81 Incubate with BSA solution at room temperature. Wash as in step (3).

[0062] (5) Streptavidin labeling. Add streptavidin solution and incubate at room temperature. Wash according to step (3).

[0063] (6) Color development: Prepare the color developing solution and protect from light throughout the process.

[0064] Add OPD colorimetric solution under dark conditions, incubate in a light-proof 37°C incubator until a yellow gradient appears, and add sulfuric acid stop solution.

[0065] (7) Determination by microplate reader. The plate is placed on a microplate reader, the value corresponding to the wavelength is measured, and a curve is drawn based on the measured value.

[0066] The results showed that the control group BSA had a lower affinity for PGN, LPS and LTA, while the target peptide mP 60-81 PGN( Figure 3 ), LPS( Figure 4 ) and LTA( Figure 5 ) in a dose-dependent manner. This suggests that the target peptide mP 60-81 It can specifically interact with the characteristic molecules of bacteria, PGN, LPS and LTA, and it is speculated that the target peptide mP 60-81It may be a multivalent pattern recognition factor that destroys the cell wall of bacterial cells by binding to peptidoglycan, lipopolysaccharide or lipoteichoic acid, causing the bacterial cells to rupture and die.

[0067] Example 5: Target peptide mP 60-81 Improving zebrafish infection with Vibrio anguillarum

[0068] (1) Inject Vibrio anguillarum (1×10 6 CFU / mL), and 4×MIC of the target peptide mP was injected into the zebrafish peritoneum 30 min after infection. 60-81 The survival rate of zebrafish was recorded for 8 consecutive days ( Figure 6 ).

[0069] (2) Inject Vibrio anguillarum (1×10 6 CFU / mL), and 4×MIC target peptide mP was injected into zebrafish intraperitoneally 30 min after infection. 60-81 Treatment was performed and the external morphology of zebrafish was observed after treatment ( Figure 7 ).

[0070] The results are as follows Figure 6 Zebrafish infected with Vibrio anguillarum show expression of target peptide mP 60-81 The survival rate increased after treatment, which indicates that the target peptide mP 60-81 It has no cytotoxicity or hemolytic effect on zebrafish and has a certain therapeutic effect.

[0071] Figure 7 From left to right, they are the target peptide mP after infection with Vibrio anguillarum, PBS treatment after infection with Vibrio anguillarum, and 60-81 The target peptide mP 60-81 It can reduce the redness symptoms on the gills of zebrafish infected with Vibrio anguillarum.

[0072] It can be seen from the above examples that the zebrafish target peptide mP 60-81 It has significant antibacterial effects on both Gram-positive and Gram-negative bacteria; zebrafish target peptide mP 60-81 The target peptide mP of the present invention has good antibacterial effect and a broad antibacterial spectrum, has great use value, and has good application in the development and preparation of antibacterial agents. 60-81 It kills bacteria by combining with peptidoglycan, lipopolysaccharide or lipoteichoic acid on the cell wall, causing the bacterial surface to become rough, wrinkled, severely deformed or even ruptured.

Claims

1. An antimicrobial peptide, characterized in that: The amino acid sequence of the antimicrobial peptide is SEQ ID NO:

1.

2. A nucleic acid fragment, characterized in that The nucleic acid fragment is used to encode the antimicrobial peptide according to claim 1.

3. The nucleic acid fragment according to claim 2, characterized in that The sequence of the nucleic acid fragment is SEQ ID NO:

2.

4. Use of the antimicrobial peptide according to claim 1 in the preparation of preventive and therapeutic antimicrobial products.

5. Use of the antimicrobial peptide according to claim 1 as a feed additive.

6. An antibacterial product, characterized in that: The antibacterial preparation contains the antibacterial peptide according to claim 1 at a pharmacologically effective concentration.

Images