Preparation method of phage-like pseudovirus particles

Abstract

The invention provides a preparation method of a bacteriophage-like pseudovirus particle, the pseudovirus particle comprises an MS2 bacteriophage packaging system, a scale nucleic acid sequence and a target virus nucleic acid sequence, the pseudovirus particle can quantify target nucleic acid by using national or international standards, and the pseudovirus particle plays an important role in standardization of nucleic acid detection.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for preparing bacteriophage-like pseudovirus particles. Background Art

[0002] RNA viruses are one of the main pathogens that cause human diseases. To control the spread of RNA viruses, it is necessary to strengthen the monitoring of these viruses. Accurate and reliable detection results are an important guarantee for virus monitoring.

[0003] Molecular biological detection methods based on nucleic acid sequences are currently the most commonly used methods for detecting RNA viruses, and are also known as the "gold standard" methods for RNA virus detection, such as reverse transcription polymerase chain reaction (RT-PCR) or real-time fluorescence reverse transcription polymerase chain reaction (real-time RT-PCR). To ensure the accuracy of the test results, the above methods all require the use of quality control products or standard substances in the test. Currently, common RNA virus detection quality control products or standard substances include the following three types: (1) naked DNA or RNA fragments; (2) whole virus particles; (3) pseudovirus particles. Among them, the exposed DNA or RNA fragments are easily affected by the environment and degraded, and the whole extraction process of the virus cannot be monitored, which makes it difficult to meet the requirements of RNA virus detection for quality control products or standard materials; although the whole virus particles as quality control products or standard materials have overcome the defects of exposed DNA or RNA fragments, they are easy to cause biosafety problems during use, are not suitable for operation in ordinary laboratories, and their application scope is greatly limited; pseudovirus particles mainly refer to phage-like pseudovirus particles, which are virus-like particles with good stability and no biosafety hazards. The preparation principle of phage-like pseudovirus particles is to clone the capsid protein gene sequence containing the phage and the target virus nucleic acid fragment sequence into a plasmid vector by genetic engineering methods, transcribe it into recombinant RNA through the plasmid vector, and use the capsid protein gene of the phage on the plasmid vector to synthesize the recombinant capsid protein, and assemble the recombinant RNA into a spherical RNA virus-like particle structure. Therefore, phage-like pseudovirus particles have the advantages of strong stability and few biosafety hazards, and are currently the best way to solve the dilemma of quality control products or standard materials for RNA virus detection. However, there are two major "bottleneck" problems in the preparation process of phage-like pseudovirus particles, which affect the widespread use of phage-like pseudovirus particles. The first problem is that the recombinant capsid protein of phage-like pseudovirus particles can encapsulate a limited number of bases of the target viral nucleic acid target sequence. Most phage-like pseudovirus particles can only encapsulate 500bp to 800bp of the target virus base sequence, which limits the application scope of phage-like pseudovirus particles as quality control products or standard substances; the second problem is that the phage-like pseudovirus particles prepared by different laboratories have large differences in the assignment results, and the lack of a unified quantitative "ruler" leads to large differences in the virus quantification results between laboratories, and the test results between different laboratories cannot be compared and analyzed.

[0004] In order to solve the defects of the above-mentioned phage-like pseudovirus particles in practical application, the present invention increases the number of nucleic acid bases of the target virus wrapped by the recombinant capsid protein of the phage-like pseudovirus particles by performing base mutation on the packaging site of the phage-like pseudovirus particles; at the same time, a "ruler" sequence is added to the phage-like pseudovirus particles, that is, an RNA virus nucleic acid sequence with an international standard or a national standard, and the "ruler" sequence is used to compare with the corresponding RNA virus international standard or national standard to assign a value to the phage-like pseudovirus particles. Then, the phage-like pseudovirus particles with the assigned value are used as quality control products or standard substances to quantify other target viruses. The quantitative results obtained can be traced back to the RNA virus national standard or international standard, thereby ensuring the consistency and comparability of the test results among various laboratories. Summary of the invention

[0005] The invention provides a pseudovirus particle and a preparation method thereof.

[0006] In one aspect, the present invention provides a pseudovirus particle, comprising: an MS2 bacteriophage packaging system, a ruler nucleic acid sequence and a target virus nucleic acid sequence.

[0007] In one embodiment, the ruler nucleic acid is a nucleic acid having a national standard or an international standard for viral RNA.

[0008] In one embodiment, the ruler nucleic acid is a viral nucleic acid having a national standard for RNA viral nucleic acid or an international standard for RNA viral nucleic acid.

[0009] In one embodiment, the ruler nucleic acid sequence is the viral nucleic acid sequence of the hepatitis C virus RNA national standard, and the ruler nucleic acid sequence is shown as SEQ ID No.5.

[0010] In one embodiment, the target virus is an RNA virus.

[0011] In one embodiment, the target virus is the new coronavirus.

[0012] In one embodiment, the target viral nucleic acid sequence is shown in any one of SEQ ID No.6-11.

[0013] In one embodiment, the target viral nucleic acid sequence length is 306bp, 606bp, 637bp, 1006bp, 1306bp, or 1606bp.

[0014] In one embodiment, the target viral nucleic acid sequence length is not less than 50bp, not less than 100bp, not less than 150bp, not less than 200bp, not less than 250bp, not less than 300bp, not less than 306bp, not less than 400bp, not less than 500bp, not less than 600bp, not less than 606bp, not less than 637bp, not less than 700bp, not less than 800bp, not less than 900bp, not less than 1000bp, not less than 1006bp, not less than 1100bp, not less than 1200bp, no less than 1300bp, no less than 1306bp, no less than 1400bp, no less than 1500bp, no less than 1600bp, no less than 1606bp, no less than 1700bp, no less than 1800bp, no less than 1900bp, no less than 2000bp, no less than 3000bp, no less than 4000bp, no less than 5000bp, no less than 6000bp, no less than 7000bp, no less than 8000bp, no less than 9000bp, no less than 10000bp.

[0015] In one embodiment, the target viral nucleic acid sequence length is 50bp-10000bp; preferably, 50bp-5000bp; preferably, 50bp-2000bp; preferably, 100bp-2000bp; preferably, 200bp-2000bp; preferably, 306bp-1606bp; preferably, 606bp-1606bp; preferably, 1006bp-1606bp; preferably, 1306bp-1606bp.

[0016] In one embodiment, the total length of the ruler nucleic acid and the target viral nucleic acid sequence is 500bp, 800bp, 1200bp, 1500bp, or 1800bp.

[0017] In one embodiment, the total length of the ruler nucleic acid and the target viral nucleic acid sequence is not less than 50bp, not less than 100bp, not less than 150bp, not less than 200bp, not less than 250bp, not less than 300bp, not less than 306bp, not less than 400bp, not less than 500bp, not less than 600bp, not less than 606bp, not less than 637bp, not less than 700bp, not less than 800bp, not less than 900bp, not less than 1000bp, not less than 1006bp, not less than 1100bp , not less than 1200bp, not less than 1300bp, not less than 1306bp, not less than 1400bp, not less than 1500bp, not less than 1600bp, not less than 1606bp, not less than 1700bp, not less than 1800bp, not less than 1900bp, not less than 2000bp, not less than 3000bp, not less than 4000bp, not less than 5000bp, not less than 6000bp, not less than 7000bp, not less than 8000bp, not less than 9000bp, not less than 10000bp.

[0018] In one embodiment, the total length of the ruler nucleic acid and the target viral nucleic acid sequence is 50bp-10000bp; preferably, 50bp-5000bp; preferably, 50bp-2000bp; preferably, 100bp-2000bp; preferably, 200bp-2000bp; preferably, 500bp-2000bp; preferably, 800bp-1800bp; preferably, 1200bp-1800bp; preferably, 1500bp-1800bp.

[0019] In one embodiment, the ruler nucleic acid and the target viral nucleic acid sequence are connected by direct connection.

[0020] In one embodiment, the MS2 phage packaging system comprises a gene sequence encoding a mature enzyme of the MS2 phage, a gene sequence encoding a capsid protein of the MS2 phage, and a packaging site nucleic acid sequence.

[0021] In one embodiment, the MS2 phage mature enzyme encoding gene sequence, the MS2 phage capsid protein encoding gene sequence and the packaging site nucleic acid sequence are directly connected.

[0022] In one embodiment, the MS2 bacteriophage packaging system is directly linked to the ruler nucleic acid and target viral nucleic acid sequence.

[0023] In one embodiment, the pseudovirus particle is formed by directly connecting the MS2 bacteriophage packaging system, the ruler nucleic acid and the target virus nucleic acid sequence in sequence.

[0024] In one embodiment, the mature enzyme encoding gene sequence of the MS2 bacteriophage is shown as SEQ ID No.1.

[0025] In one embodiment, the MS2 phage capsid protein encoding gene sequence is shown as SEQ ID No.2.

[0026] In one embodiment, the MS2 phage packaging system comprises one or more (eg, two, three, four or five) packaging site nucleic acid sequences.

[0027] In one embodiment, the packaging site nucleic acid sequence is shown in any one of SEQ ID No.3-4.

[0028] In one embodiment, the packaging site nucleic acid sequence is shown as SEQ ID No.4.

[0029] On the other hand, the present invention provides a method for preparing the pseudovirus particles, wherein the method uses the MS2 bacteriophage packaging system to package the ruler nucleic acid sequence and the target virus nucleic acid sequence to obtain the pseudovirus particles.

[0030] In one embodiment, the method comprises the steps of: (1) Obtaining and amplifying the MS2 phage mature enzyme encoding gene sequence, MS2 phage capsid protein encoding gene sequence, packaging site nucleic acid sequence, ruler nucleic acid sequence and target virus nucleic acid sequence; (2) homologously recombine the sequence in (1) to obtain a homologous recombination vector; (3) Introducing the homologous recombination vector in (2) into the host bacteria to obtain recombinant bacteria; (4) inducing and culturing the recombinant bacteria; (5) Collecting the recombinant bacterial cells, disrupting them, and separating and purifying them to obtain the pseudovirus particles.

[0031] In one embodiment, the host bacteria is Escherichia coli.

[0032] In one embodiment, the host bacteria is Escherichia coli BL21 (DE3).

[0033] In one embodiment, the homologous recombination vector is a prokaryotic expression vector pET-28a(+).

[0034] In one embodiment, the method further comprises the step of assigning a value to the pseudoviral particles.

[0035] In one embodiment, the method of assigning values ​​is to assign values ​​to the pseudovirus particles using real-time fluorescence RT-PCR.

[0036] In one embodiment, the method of assigning values ​​is to obtain a standard curve of a national or international standard of a ruler nucleic acid by real-time fluorescence RT-PCR, and the concentration of the pseudovirus particles is calculated by substituting the Cq value of the pseudovirus particles into the standard curve, and the concentration of the target virus can be inferred based on the concentration of the pseudovirus particles.

[0037] On the other hand, the present invention provides a nucleic acid detection kit, which contains the pseudovirus particles.

[0038] On the other hand, the present invention provides the use of the pseudovirus particles as quality control products, standard substances or reference products for target virus detection, or in the preparation of reagents for target virus detection.

[0039] Beneficial Effects The pseudovirus particles described in the present invention contain a ruler nucleic acid sequence, which can be assigned a value through a national standard product or an international standard product of viral RNA. When the pseudovirus particles are used as a quality control product or a standard substance for target viral nucleic acid detection, the target viral RNA can be quantified, and the quantitative result can be traced back to the national standard product or the international standard product of viral RNA, thereby ensuring the accuracy and comparability of the detection result. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 , schematic diagram of pET28a-MS2-COVID-19-HCV plasmid vector.

[0041] Figure 2 , pET28a-MS2-COVID-19-HCV plasmid vector map.

[0042] Figure 3 , electron microscopic identification results of phage-like pseudovirus particles.

[0043] Figure 4 , protein electrophoresis (SDS-PAGE) results of phage-like pseudovirus particles.

[0044] Figure 5 , schematic diagram of the pET28a-MS2-COVID-HCV wild-type packaging site plasmid vector.

[0045] Figure 6 , schematic diagram of the pET28a-MS2-COVID-19-HCV variant packaging site plasmid vector.

[0046] Figure 7 , the influence of packaging site on the expression level of phage-like pseudoviral particles.

[0047] Figure 8 , expression efficiency of different phage-like pseudoviral particles.

[0048] Fig. 9 , expression efficiency of different phage-like pseudoviral particles.

[0049] Fig.10 , fluorescence amplification curve of RNA extract of SARS-CoV-2 pseudoviral particles.

[0050] Fig.11 , fluorescence amplification curve of hepatitis C virus standard.

[0051] Fig.12 , calibration curve of HCV standards. DETAILED DESCRIPTION

[0052] The present invention is further described below in conjunction with the embodiments. The following description is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change it into an equivalent embodiment with equivalent changes. Any simple modification or equivalent change made to the following embodiments based on the technical essence of the present invention without departing from the content of the present invention falls within the protection scope of the present invention.

[0053] Example 1. Preparation of phage-like pseudoviral particles 1. Vector construction With reference to the MS2 bacteriophage genome sequence (accession number NC_001417.2), the hepatitis C virus HCV genome sequence (accession number AF333324.1) and the novel coronavirus genome sequence (accession number MN908947.3) in the Genbank database, an exogenous nucleic acid fragment (hereinafter referred to as MS2-novel coronavirus-HCV) is prepared by artificial synthesis, including the MS2 bacteriophage mature enzyme encoding gene (sequence as shown in SEQ ID No.1), the MS2 bacteriophage capsid protein encoding gene (sequence as shown in SEQ ID No.2), the variant packaging site nucleic acid sequence (sequence as shown in SEQ ID No.4), the "ruler" nucleic acid sequence (i.e., an RNA virus nucleic acid sequence with an international standard or a national standard, this patent takes the hepatitis C virus nucleic acid sequence as an example, but is not limited to the hepatitis C virus nucleic acid sequence, the hepatitis C virus nucleic acid sequence is shown in SEQ ID No.5) and the cDNA sequence corresponding to the target virus nucleic acid sequence fragment (this patent takes the novel coronavirus nucleic acid sequence as an example, but is not limited to the novel coronavirus nucleic acid sequence, the novel coronavirus nucleic acid sequence is shown in SEQ ID No.6); and the above exogenous nucleic acid fragment MS2-novel coronavirus-HCV was inserted into the pUC-19 vector to obtain an intermediate plasmid vector named pUC-MS2-novel coronavirus-HCV.

[0054] MS2 phage capsid protein encoding gene sequence (SEQ ID No.2): atggcttctaactttactcagttcgttctcgtcgacaatggcggaactggcgacgtgactgtcgccccaagcaacttcgctaacggggtcgctg aatggatcagctctaactcgcgttcacaggcttacaaagtaacctgtagcgttcgtcagagctctgcgcagaatcgcaaatacaccatcaaagtcgaggt gcctaaagtggcaacccagactgttggtggtgtagagcttcctgtagccgcatggcgttcgtacttaaatatggaactaaccattccaattttcgctacg aattccgactgcgagcttattgttaaggcaatgcaaggtctcctaaaagatggaaacccgattccctcagcaatcgcagcaaactccggcatctactaa; Packaging site nucleic acid sequence: ACATGAGGATTACCCATGT (SEQ ID No. 3) (wild-type packaging site), ACATGAGGATCACCCATGT (SEQ ID No. 4) (variant packaging site); Ruler nucleic acid sequence - Hepatitis C virus (AF333324.1) nucleic acid sequence (SEQ ID No.5): cagcggaaccggtgagtacaccggaattgccaggacgaccgggtcctttcttggatcaacccgctcaatgcctggagatttgggcgtgcccccgcga gactgctagccgagtagtgttgggtcgcgaaaggccttgtggtactgcctgatagggtgcttgcgagtgccccgggaggtctcgtagaccgtgcatc; Target virus-new coronavirus (MN908947.3) nucleic acid sequence (SEQ ID No.6): ; Using the intermediate plasmid vector pUC-MS2-COVID-19-HCV as a template, PCR amplification was performed to obtain the DNA fragment of MS2-COVID-19-HCV. According to the nucleic acid sequence at the 5' end and the nucleic acid sequence at the 3' end of the DNA fragment of MS2-COVID-19-HCV, primer pairs PF1 and PR1 were designed (see Table 1). In order to facilitate homologous recombination with the prokaryotic plasmid vector pET-28a(+), a partial homologous sequence of BamH I of the pET-28a(+) plasmid vector was added to the 5' end of primer PF1, and a partial homologous sequence of Xho I on the pET-28a(+) vector was added to the 5' end of primer PR1. The PCR reaction system and reaction procedure are shown in Tables 2 and 3 (Tiangen Biochemical Technology (Beijing) Co., Ltd., Super High-Fidelity PCR Kit II, KP213). After the PCR reaction, the PCR amplification product was recovered and purified, and the DNA fragment of MS2-COVID-19-HCV finally obtained was used for subsequent plasmid vector construction. The schematic diagram of the constructed vector is shown in Figure 1 As shown, the vector map is as Figure 2 shown.

[0055] Table 1. PCR primers

[0056] Table 2. Composition of PCR reaction system

[0057] Table 3. PCR reaction program

[0058] Linearized plasmid vector: In this experiment, pET-28a(+) vector was used as an example. The pET-28a(+) vector was double-digested with restriction endonucleases BamH I and Xho I, and the linearized pET-28a(+) vector obtained after enzyme digestion was recovered and purified. Then, the amplified DNA fragment of MS2-new coronavirus-HCV was homologously recombined into the linearized pET-28a(+) vector by recombinase (e.g., ClonExpressII One Step Cloning Kit produced by Nanjing Novogene Biotechnology Co., Ltd.), and the recombinant vector pET28a-MS2-new coronavirus-HCV was obtained. The reaction system is shown in Table 4.

[0059] Table 4. Homologous recombination reaction system

[0060] 2. Expression and purification of phage-like pseudoviral particles The recombinant plasmid vector pET28a-MS2-COVID-HCV obtained in the above steps was transfected into Escherichia coli BL21 (DE3) competent cells, then spread on LB nutrient agar plates containing kanamycin (final concentration of 30 μg / mL) and cultured at 37°C for 20 hours.

[0061] A single colony was picked from the plate after culture and inoculated into 5 mL of LB culture medium containing kanamycin (final concentration of 30 μg / mL), and cultured overnight at 37°C and 180 rpm with shaking.

[0062] Inoculate the above-mentioned overnight cultured bacteria into liquid LB culture medium containing kanamycin (final concentration of 30μg / mL) at a ratio of 1:100, shake at 37°C and 180r / min for 2-4 hours, then add isopropylthiogalactoside (IPTG) to a final concentration of 50-750μg / mL to induce expression, continue to shake at 37°C and 180r / min for 4-36 hours, then centrifuge at room temperature and 5000rpm for 15min to collect the bacteria. Set E. coli BL21 (DE3) transfected with pET-28a(+) empty vector as a blank control, and culture and induce expression under the same conditions.

[0063] Collect the cells and wash them with PBS solution for 3 times, add 5-10mL ultrasonic treatment buffer, and vortex to mix. After the cells are ultrasonically disrupted, centrifuge at 4°C, 12000rpm for 30min, take the supernatant, add 5.0μL of 10U / μL DNaseI and 10μL of 10mg / mL RNase, respectively, and digest at 37°C for 12 hours.

[0064] Next, filter the digested liquid with 0.45μm and 0.22μm filters, and then quantify the volume of the liquid. Add a quarter of the volume of the above liquid 5×PEG 8000 / NaCl solution, mix thoroughly, and keep at 4°C overnight. Then, centrifuge at 4°C, 12000rpm for 45 minutes, discard the supernatant, add 0.5-1.0mL of PBS solution to suspend the precipitate, and then add the same volume of chloroform / n-butanol (1:1) mixture and mix thoroughly. Centrifuge at 4°C, 12000 rpm for 30 minutes, aspirate the upper aqueous phase, and then add CsCl to the filtrate at a ratio of 1g (or 1mL) of liquid to 0.6g of cesium chloride (CsCl), vortex mix thoroughly, and then use an ultra-high-speed refrigerated centrifuge at 4°C, 85000rpm for 4-6 hours. Aspirate the liquid containing the virus layer from the centrifuged liquid with a syringe.

[0065] The liquid drawn out was placed in a dialysis bag, which was then immersed in a PBS solution for 12 hours. Subsequently, the liquid in the dialysis bag was used as a stock solution of phage-like pseudoviral particles and dispensed into RNase- and DNase-free EP tubes. A total of four EP tubes were dispensed, marked as EP1, EP2, EP3, and EP4, and stored at -80°C for future use.

[0066] The phage-like pseudovirus particle stock solution of EP1 was negatively stained with 2% phosphotungstic acid, and then the phage-like pseudovirus particles were observed under a transmission electron microscope. A large number of phage-like pseudovirus particles with dense arrangement and uniform size and shape were observed, such as Figure 3 shown.

[0067] Take 10 μL of the phage-like pseudovirus particle stock solution of EP1, EP2, EP3 and EP4, dilute 10 times with ultrapure water, then take 40 μL of the diluted solution and 10 μL of 5×SDS loading buffer, mix thoroughly, boil in a boiling water bath for 10 minutes, and perform gel electrophoresis in 5% SDS-PAGE stacking gel and 12% SDS-PAGE separation gel. The results show that the phage-like pseudovirus particle test well has a clear band around 12.1 kD, which is consistent with the expected size of the target product, such as Figure 4 As shown ( Figure 4 M stands for marker).

[0068] Example 2: Effect of packaging site on expression efficiency of phage-like pseudoviral particles According to the experimental method of Example 1, a plasmid vector containing the MS2 wild-type packaging site nucleic acid sequence (ACATGAGGATTACCCATGT) and a plasmid vector containing the MS2 variant packaging site nucleic acid sequence (ACATGAGGATCACCCATGT) were constructed. The schematic diagrams of the constructed vectors are shown in FIG. Figure 5 and Figure 6 The target viral nucleic acid fragments inserted into the two plasmid vectors have the same number of bases, that is, the target nucleic acid sequence of the new coronavirus is 306bp (as shown in SEQ ID No.7), the target nucleic acid sequence of the hepatitis C virus is 194bp (as shown in SEQ ID No.5), and the exogenous nucleic acid sequence inserted into the plasmid vector pET-28a(+) is 2085bp.

[0069] New coronavirus nucleic acid target sequence 306bp (SEQ ID No.7): aggattttgtgacttaaaaggtaagtatgtacaaatacctacaacttgtgctaatgaccctgtgggttttacacttaaaaacacagtctgtaccgtctgcggtatgtggaaaggttatggctgtagttgtgatcaactccgcgaacccat gcttcagtcagctgatgcacaatcgtttttaaaccgggtttgcggtgtaagtgagtaggggaacttctcctgctagaatggctggcaatggcggtgatgctgctcttgctttgctgctgcttgacagattgaaccagcttgagagcaaaatgtctg.

[0070] The experiment was divided into two groups, one of which was a plasmid vector containing a wild-type packaging site nucleic acid sequence, expressing phage-like pseudovirus particles; the other group was a plasmid vector containing a variant packaging site nucleic acid sequence, expressing phage-like pseudovirus particles. Ten parallel samples were made for each group to compare the difference in the concentration of phage-like pseudovirus particles between the two groups. The concentration of phage-like pseudovirus particles was measured by Qubit4.0 to measure the protein concentration in the phage-like pseudovirus particle stock solution. StatA8.0 was then used for statistical analysis, and the results are shown below. Figure 7 As shown. Figure 7 In the data, group1 is the value of the phage-like pseudovirion particles expressed by the plasmid vector containing the wild-type packaging site, and group2 is the value of the phage-like pseudovirion particles expressed by the plasmid vector containing the variant packaging site. Figure 7 It can be seen that the plasmid vector containing the mutant packaging site can express more phage-like pseudovirus particles under the same conditions, which is significantly different from the plasmid vector containing the wild-type packaging site.

[0071] Example 3: Effect of packaging site on the number of bases of target virus nucleic acid fragments encapsulated by phage-like pseudoviral particles According to the experimental method in Example 1, the following plasmid vector was constructed: A-1: Contains 1 MS2 wild-type packaging site and 306bp of SARS-CoV-2 nucleic acid sequence (SEQ ID No.7) and 194bp of HCV nucleic acid sequence (SEQ ID No.5) (the total length of SARS-CoV-2 and HCV nucleic acid sequences is 500bp); the sequence of the exogenous nucleic acid fragment inserted into the plasmid vector pET-28a(+) includes: SEQ ID No.1+SEQ IDNo.2+SEQ ID No.3+SEQ ID No.5+SEQ ID No.7.

[0072] A-2: Contains 1 MS2 wild-type packaging site and 606bp of SARS-CoV-2 nucleic acid sequence (SEQ ID No.8) and 194bp of HCV nucleic acid sequence (SEQ ID No.5) (the total length of SARS-CoV-2 and HCV nucleic acid sequences is 800bp); the sequence of the exogenous nucleic acid fragment inserted into the plasmid vector pET-28a(+) includes: SEQ ID No.1+SEQ IDNo.2+SEQ ID No.3+SEQ ID No.5+SEQ ID No.8.

[0073] A-3: Contains 1 MS2 wild-type packaging site and 1006bp of SARS-CoV-2 nucleic acid sequence (SEQ ID No.9) and 194bp of HCV nucleic acid sequence (SEQ ID No.5) (the total length of SARS-CoV-2 and HCV nucleic acid sequences is 1200bp); the sequence of the exogenous nucleic acid fragment inserted into the plasmid vector pET-28a(+) includes: SEQ ID No.1+SEQID No.2+SEQ ID No.3+SEQ ID No.5+SEQ ID No.9.

[0074] A-4: Contains 1 MS2 wild-type packaging site and 1306bp of SARS-CoV-2 nucleic acid sequence (SEQ ID No.10) and 194bp of HCV nucleic acid sequence (SEQ ID No.5) (the total length of SARS-CoV-2 and HCV nucleic acid sequences is 1500bp); the sequence of the exogenous nucleic acid fragment inserted into the plasmid vector pET-28a(+) includes: SEQ ID No.1+SEQID No.2+SEQ ID No.3+SEQ ID No.5+SEQ ID No.10.

[0075] A-5: Contains 1 MS2 wild-type packaging site and 1606bp of SARS-CoV-2 nucleic acid sequence (SEQ ID No.11) and 194bp of HCV nucleic acid sequence (SEQ ID No.5) (the total length of SARS-CoV-2 and HCV nucleic acid sequences is 1800bp); the sequence of the exogenous nucleic acid fragment inserted into the plasmid vector pET-28a(+) includes: SEQ ID No.1+SEQID No.2+SEQ ID No.3+SEQ ID No.5+SEQ ID No.11.

[0076] A-6: Contains 2 MS2 wild-type packaging sites and 1606bp of SARS-CoV-2 nucleic acid sequence (SEQ ID No.11) and 194bp of HCV nucleic acid sequence (SEQ ID No.5) (the total length of SARS-CoV-2 and HCV nucleic acid sequences is 1800bp); the sequence of the exogenous nucleic acid fragment inserted into the plasmid vector pET-28a(+) includes: SEQ ID No.1+SEQID No.2+SEQ ID No.3+SEQ ID No.3+SEQ ID No.5+SEQ ID No.11.

[0077] A-7: Contains 3 MS2 wild-type packaging sites and 1606bp of SARS-CoV-2 nucleic acid sequence (SEQ ID No.11) and 194bp of HCV nucleic acid sequence (SEQ ID No.5) (the total length of SARS-CoV-2 and HCV nucleic acid sequences is 1800bp); the sequence of the exogenous nucleic acid fragment inserted into the plasmid vector pET-28a(+) includes: SEQ ID No.1+SEQID No.2+SEQ ID No.3+SEQ ID No.3+SEQ ID No.3+SEQ ID No.5+SEQ ID No.11.

[0078] A-8: Contains 1 MS2 variant packaging site and 1606bp of SARS-CoV-2 nucleic acid sequence (SEQ ID No.11) and 194bp of HCV nucleic acid sequence (SEQ ID No.5) (the total length of SARS-CoV-2 and HCV nucleic acid sequences is 1800bp); the sequence of the exogenous nucleic acid fragment inserted into the plasmid vector pET-28a(+) includes: SEQ ID No.1+SEQID No.2+SEQ ID No.4+SEQ ID No.5+SEQ ID No.11.

[0079] A-9: Contains 2 MS2 variant packaging sites and 1606bp of SARS-CoV-2 nucleic acid sequence (SEQ ID No.11) and 194bp of HCV nucleic acid sequence (SEQ ID No.5) (the total length of SARS-CoV-2 and HCV nucleic acid sequences is 1800bp); the sequence of the exogenous nucleic acid fragment inserted into the plasmid vector pET-28a(+) includes: SEQ ID No.1+SEQID No.2+SEQ ID No.4+SEQ ID No.4+SEQ ID No.5+SEQ ID No.11.

[0080] A-10: Contains 3 MS2 variant packaging sites and 1606bp of SARS-CoV-2 nucleic acid sequence (SEQ ID No.11) and 194bp of HCV nucleic acid sequence (SEQ ID No.5) (the total length of SARS-CoV-2 and HCV nucleic acid sequences is 1800bp); the sequence of the exogenous nucleic acid fragment inserted into the plasmid vector pET-28a(+) includes: SEQ ID No.1+SEQID No.2+SEQ ID No.4+SEQ ID No.4+SEQ ID No.4+SEQ ID No.5+SEQ ID No.11.

[0081] A-11: Escherichia coli BL21 (DE3), used as blank control 1; A-12: pET-28a(+) empty vector, transfected into BL21(DE3), as blank control 2; The nucleic acid sequences of the MS2 wild-type packaging site and the MS2 variant packaging site are the same as those in Example 2.

[0082] Novel coronavirus nucleic acid sequence 606bp (SEQ ID No.8):

[0083] According to the method of Example 1, the expression and purification of phage-like pseudoviral particles were performed respectively, and finally phage-like pseudoviral particles expressed by different plasmid vectors were obtained. Then SDS-PAGE electrophoresis analysis was performed. The results are shown in FIG. Figure 8-9 shown.

[0084] exist Figure 8 In the figure, M is a marker, A-11 is a blank control 1, A-12 is a blank control 2, and A-1, A-2, A-3, A-4, and A-5 are phage-like pseudovirus particles with target virus nucleic acid fragments of 500 bp, 800 bp, 1200 bp, 1500 bp, and 1800 bp, respectively. Figure 8 It can be seen that one wild-type packaging site can encapsulate a target viral nucleic acid fragment of up to 1200 bp, and as the number of bases of the encapsulated target viral nucleic acid fragment increases, the expression efficiency of the phage-like pseudovirus particles decreases significantly.

[0085] exist Fig. 9 In the figure, M is a marker, and A-5, A-6, and A-7 are the expression efficiencies of different numbers (1, 2, and 3) of wild-type packaging sites for the 1800 bp target viral nucleic acid fragment. Fig. 9 It can be seen that increasing the number of wild-type packaging sites can increase the number of bases of the target viral nucleic acid fragments encapsulated by phage-like pseudovirus particles (taking the new coronavirus as an example, but not limited to the new coronavirus).

[0086] exist Fig. 9 In the figure, A-5 is the expression efficiency of a wild-type packaging site for a 1800bp target viral nucleic acid fragment, and A-8 is the expression efficiency of a variant packaging site for a 1800bp target viral nucleic acid fragment. It can be concluded that mutating the wild-type packaging site into a variant packaging site can significantly increase the number of bases of the target viral nucleic acid fragment encapsulated by the phage-like pseudovirus particles (taking the new coronavirus as an example, but not limited to the new coronavirus).

[0087] exist Fig. 9 In the figure, A-8, A-9, and A-10 are the expression efficiencies of 1, 2, and 3 variant packaging sites for the 1800 bp target viral nucleic acid fragment. Fig. 9 It can be seen that increasing the number of variant packaging sites can increase the number of bases of the target viral nucleic acid fragments encapsulated by phage-like pseudovirus particles (taking the new coronavirus as an example, but not limited to the new coronavirus).

[0088] exist Fig. 9In the figure, A-6 is the expression efficiency of 2 wild-type packaging sites for 1800bp target viral nucleic acid fragment, A-7 is the expression efficiency of 3 wild-type packaging sites for 1800bp target viral nucleic acid fragment, and A-8 is the expression efficiency of 1 variant packaging site for 1800bp target viral nucleic acid fragment. It can be concluded that the expression efficiency of 1 variant packaging site is significantly higher than that of 2 (or 3) wild-type packaging sites.

[0089] Example 4: Identification of novel coronavirus nucleic acid fragments in phage-like pseudoviral particles According to the method in Example 1, phage-like pseudovirus particles containing nucleic acid sequences of the new coronavirus and hepatitis C virus were prepared, and RNA in the phage-like pseudovirus particles was extracted. A virus extraction kit, such as the QIAamp ViralRNA Mini Kit, can be used. The extraction method is as follows: (1) 560 μL of AVL-carrier RNA buffer was pipetted into a 1.5 mL EP tube; (2) 140 μL of phage-like pseudovirus particle solution was added to the AVL-carrier RNA buffer. Mix with a vortex oscillator for 15 seconds; (3) The mixture was incubated at room temperature for 10 minutes; (4) 560 μL of anhydrous ethanol was added to the mixture and vortexed for 15 seconds. Then, the mixture was centrifuged briefly to remove droplets attached to the wall and lid of the centrifuge tube; (5) 630 μL of the mixture in step (4) was pipetted into the QIAamp Mini column, the lid of the QIAamp Mini column was covered, and the mixture was centrifuged at 10,000 rpm for 1 minute. Remove the QIAamp Mini column and place it in another 2 mL collection tube, discarding the collection tube containing the filtrate; (6) Carefully open the lid of the QIAamp Mini column and repeat step (5). (7) Carefully open the lid of the QIAamp Mini column and add 500 μL of AW1 buffer. Close the lid and centrifuge at 8,000 rpm for 1 minute. Place the QIAamp Mini column in another clean 2 mL collection tube and discard the original collection tube containing the filtrate; (8) Carefully open the lid of the QIAamp Mini column and add 500 μL of AW2 buffer. Close the lid of the QIAamp Mini column and centrifuge at 14,000 rpm for 3 minutes; (9) Place the QIAamp Mini column in another new 2 mL collection tube, discard the original collection tube and its filtrate, and centrifuge at 14,000 rpm for 1 minute; (10) Place the QIAamp Mini column in a clean 1.5 mL centrifuge tube and discard the original centrifuge tube and its filtrate. Carefully open the QIAamp Mini column and add 50 μl of AVE buffer. Close the lid and let it stand at room temperature for 1 minute. (11) Centrifuge at 8000 rpm for 1 minute. (12) Repeat steps (10) and (11) and add 30 μl of AVE buffer again. Close the lid and let it stand at room temperature for 1 minute. (13) Freeze the RNA extract at -80°C.

[0090] Detection of novel coronavirus nucleic acid: Take out the RNA extract, dilute it 10 times, and detect it by fluorescent RT-PCR method. See Table 5 for the primers and probes of novel coronavirus.

[0091] Table 5. Primer and probe sequences for SARS-CoV-2 fluorescent RT-PCR (Refer to the novel coronavirus nucleic acid detection primers and probe sequences provided by the Chinese Center for Disease Control and Prevention)

[0092] The FastKing one-step reverse transcription-fluorescence quantitative kit (FP314) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to detect the extracted phage-like pseudoviral particle RNA. At the same time, RNase Free ddH2O was used as a template and a negative control was set up.

[0093] The real-time fluorescence RT-PCR reaction system is shown in Table 6.

[0094] Table 6. Preparation of real-time fluorescence RT-PCR reaction system

[0095] The real-time fluorescence RT-PCR reaction procedure is shown in Table 7.

[0096] Table 7. Real-time fluorescence RT-PCR reaction procedure

[0097] Test results such as Fig.10 As shown, the RNA extract of the prepared phage-like pseudovirion stock solution and its 10-fold gradient dilution (10 1 -10 4 ) showed a typical "S" shape and had a good exponential growth period. The negative control non-fluorescent amplification curve using RNase Free ddH2O as a template showed that the prepared phage-like pseudovirus particles contained SARS-CoV-2 RNA fragments and could be used as a quality control product for SARS-CoV-2 nucleic acid detection.

[0098] Example 5: Assignment of phage-like pseudovirions The phage-like pseudovirion particles (A-8) obtained in Example 3 were assigned values. According to the operating steps of Example 4, the RNA nucleic acid fragments of the phage-like pseudovirion particles were extracted, and the extracted RNA nucleic acid fragments were diluted 10 times and then subjected to fluorescent RT-qPCR reaction. At the same time, the hepatitis C virus RNA standard (batch number: Z-HR-0008-02) was used for 10-fold gradient dilution to obtain different dilution concentrations, namely 5×10 7 IU / mL, 5×10 6 IU / mL, 5×10 5 IU / mL and 5×10 4IU / mL, under the same reaction conditions, the fluorescent RT-qPCR reaction was performed. The logarithmic value of the concentration of the serially diluted hepatitis C virus RNA standard was used as the horizontal axis, and the Cq value of the fluorescence amplification curve was used as the vertical axis to draw the standard curve. Then, according to the Cq value of the 10-fold dilution of the pseudovirion RNA, the concentration of the 10-fold dilution of the pseudovirion RNA was calculated through the standard curve, and then multiplied by the dilution multiple, the RNA concentration of the pseudovirion stock solution can be calculated, so that the phage-like pseudovirion stock solution can be assigned a value.

[0099] The primers and probes for hepatitis C virus fluorescent RT-PCR are shown in Table 8.

[0100] Table 8. Primer and probe sequences for fluorescent RT-PCR of hepatitis C virus

[0101] The FastKing one-step reverse transcription-fluorescence quantitative kit (FP314) from Tiangen Biochemical Technology (Beijing) Co., Ltd. was used for real-time fluorescence RT-PCR detection of the extracted phage-like pseudovirion RNA. At the same time, RNase FreeddH2O was used as a template and a negative control was set up.

[0102] The real-time fluorescence RT-PCR reaction system is shown in Table 6.

[0103] The real-time fluorescence RT-PCR reaction procedure is shown in Table 7.

[0104] Test results see Fig.11 and Fig.12 , Fig.11 is the fluorescence amplification curve of the hepatitis C virus RNA standard. Fig.12 The standard curve is calculated based on the Cq value of the fluorescence amplification curve (the horizontal axis is the logarithmic value of the concentration of the hepatitis C virus RNA standard, and the vertical axis is the Cq value of the corresponding fluorescence amplification curve). According to the slope of the standard curve and the intercept on the vertical axis, the equation of the standard curve can be obtained as follows: y=-3.324x+45.792, where y is the Cq value of the fluorescence amplification curve, and x is the hepatitis C virus standard, in IU / mL. From the experimental results, it can be seen that the Cq values ​​of the three parallel measurement tubes of the 10-fold dilution of the pseudovirus particle RNA extract are 22.92, 24.24 and 24.45, respectively. Substituting into the above formula, the concentration of the 10-fold dilution of the pseudovirus particle RNA is calculated to be (4.41±2.75)×10 6 IU / mL, and then multiply it by the dilution factor to calculate the concentration of pseudovirion stock RNA as (4.41±2.75)×10 7 IU / mL.

[0105] Since the RNA nucleic acid fragments of pseudovirion particles are directly connected by partial nucleic acid fragments of hepatitis C virus and partial nucleic acid fragments of novel coronavirus, once the concentration of hepatitis C virus RNA in pseudovirion particles is obtained, the concentration of novel coronavirus nucleic acid fragments in pseudovirion particles can be inferred. When we use this pseudovirion as a novel coronavirus nucleic acid standard, we can quantitatively analyze the novel coronavirus RNA in the sample based on the concentration of novel coronavirus nucleic acid fragments in pseudovirion particles and the standard curve of RT-qPCR.

[0106] The final result was: the amount of HCV RNA in the phage-like pseudovirus particles was (4.41±2.75)×10 7 IU / mL. The amount of hepatitis C virus RNA in phage-like pseudovirus particles is used as the amount of phage-like pseudovirus particles. In this way, when phage-like pseudovirus particles are used as quality control or standard products to quantify other viruses (such as the new coronavirus in this example), it can be ensured that the quantitative results can be traced back to the national standard product of hepatitis C virus.

[0107] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes may be made to the details according to all the teachings that have been published, and these changes are within the scope of protection of the present invention. The entire invention is given by the attached claims and any equivalents thereof.

Claims

1. A pseudoviral particle, characterized in that The pseudovirus particle comprises an MS2 bacteriophage packaging system, a ruler nucleic acid sequence and a target virus nucleic acid sequence.

2. The pseudovirion according to claim 1, characterized in that The ruler nucleic acid is a nucleic acid having a viral RNA national standard or a viral RNA international standard.

3. The pseudovirion according to claim 2, characterized in that The ruler nucleic acid sequence is the viral nucleic acid sequence of the hepatitis C virus RNA national standard, and the ruler nucleic acid sequence is shown in SEQ ID No.

5.

4. The pseudovirion according to claim 1, characterized in that The target virus is an RNA virus.

5. The pseudovirion according to claim 1, characterized in that The MS2 phage packaging system includes a MS2 phage mature enzyme encoding gene sequence, an MS2 phage capsid protein encoding gene sequence and a packaging site nucleic acid sequence. The MS2 phage packaging system includes one or more packaging site nucleic acid sequences, and the packaging site nucleic acid sequence is shown in any one of SEQ ID No. 3-4.

6. The method for preparing the pseudovirion according to any one of claims 1 to 5, characterized in that: The method adopts the MS2 bacteriophage packaging system to package the ruler nucleic acid sequence and the target virus nucleic acid sequence to obtain the pseudovirus particles described in any one of claims 1-5.

7. The method according to claim 6, characterized in that The method comprises the steps of: (1) Obtaining and amplifying the MS2 phage mature enzyme encoding gene sequence, MS2 phage capsid protein encoding gene sequence, packaging site nucleic acid sequence, ruler nucleic acid sequence and target virus nucleic acid sequence; (2) homologously recombine the sequence in (1) to obtain a homologous recombination vector; (3) Introducing the homologous recombination vector in (2) into the host bacteria to obtain recombinant bacteria; (4) inducing and culturing the recombinant bacteria; (5) Collecting the recombinant bacterial cells, disrupting them, and separating and purifying them to obtain the pseudovirus particles.

8. The method according to claim 7, characterized in that The method further comprises the step of assigning a value to the pseudoviral particles.

9. A nucleic acid detection kit, characterized in that: The kit contains the pseudovirus particles according to any one of claims 1-5.

10. Use of the pseudovirus particle according to any one of claims 1 to 5 as a quality control product, standard substance or reference product for target virus detection, or in the preparation of a reagent for target virus detection.

Images