Long-acting dog / cat interleukin 11 fusion protein as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a long-acting dog / cat interleukin 11 fusion protein as well as a preparation method and application thereof. The dog / cat IL-11 fusion protein with high activity, high expression quantity and long half-life period is screened by adopting different combination modes of dog / cat IL-11 truncated peptide, connecting Linker, CSA / FSA truncated peptide and histidine tag; the selected CSA / FSA truncated peptide can also be applied to development and research of pet long-acting medicines. The fusion expression long-acting dog / cat IL-11 mutant fusion protein can obviously prolong the half-life period and maintain the biological activity, can be efficiently expressed in pichia pastoris and escherichia coli expression systems, and is beneficial to processing, purification and industrial production; the invention fills the market blank of long-acting dog / cat IL-11 related biological products in preparation for treating platelet quantity reduction and other possible related diseases, and also provides certain guiding significance for the development of dog / cat long-acting medicines.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a long-acting canine / feline interleukin 11 fusion protein and a preparation method and application thereof. Background Art

[0002] Interleukin 11 (IL-11) is a member of the IL6 cytokine family, a multifunctional cytokine produced by stromal cells such as fibroblasts, epithelial cells and osteoclasts, and produced by stromal cells in the hematopoietic microenvironment. In 1990, PaμLSR et al. found in the process of studying the mechanism of hematopoietic microenvironment regulating hematopoiesis that a large amount of growth factors were produced in the immortalized primate bone marrow-derived stromal cell line PU-34, which could stimulate the proliferation of the interleukin 6 (IL6)-dependent mouse plasmacytoma cell line T1165. The cDNA encoding plasmacytoma-activated proliferation was isolated by functional expression cloning in mammalian cell lines and named interleukin 11. Subsequently, Morris, JC et al. successfully cloned the original 1L11 DNA. The nucleotide sequence contained a single long reading frame of 597 nucleotides and encoded a precursor protein composed of 199 amino acids. After removing the 21 amino acid sequences at the N-terminus, it became a monomer with a molecular weight of 19KD composed of 178 amino acids. The protein structure was a type I four-helix bundle. IL11 had no cysteine ​​residues or disulfide bonds to stabilize the structure, nor did it have aspartic acid-related sugar chain sites.

[0003] Interleukin 11 (IL-11) is expressed in a variety of tissues, including the thymus, lungs, bones, connective tissue, and the central nervous system. IL-11 plays an important regulatory role in hematopoiesis by stimulating the growth of myeloid, erythroid, and megakaryocyte progenitor cells. It also regulates bone metabolism, inhibits the production of proinflammatory cytokines, and protects the gastric mucosa from damage. IL-11 can stimulate plasma cell proliferation and T cell-dependent B cell development; promote the formation and maturation of megakaryocytes and increase the number of peripheral blood platelets; synergize with IL-3 and IL-4 to stimulate the proliferation of resting hematopoietic stem cells; affect the production and differentiation of erythrocytes; regulate the expression of plasma protein genes in hepatocytes and induce the production of acute phase proteins. IL-11 is normally involved in many physiological processes, including hematopoiesis, bone development, and immune response. However, with age, the level of IL-11 in the body gradually increases, especially in the liver, adipose tissue, and skeletal muscle. This increase is associated with many pathological changes associated with aging, such as metabolic disorders, chronic inflammation, and cellular senescence.

[0004] At present, through literature search, the research on canine / cat interleukin 11 and its application in the field of pets are relatively lacking; currently, patent CN114686487A discloses a method for efficient expression of canine / cat interleukin (IL-11) in Pichia pastoris and its application, and the nucleotide sequence of canine / cat interleukin 11 involved in it has been optimized, and can be efficiently expressed in Pichia pastoris by constructing a vector. In the clinical practice of pets, there are still no related products approved for marketing for IL-11 drugs for dogs / cats, and the scientific research of canine / cat IL-11 and related long-acting drugs are still blank. With the rapid development of the domestic pet market, the demand for canine / cat IL-11 in the treatment of thrombocytopenia and other diseases in pets is increasing day by day, and the development of a long-acting canine / cat IL-11 has good economic benefits and application market. Summary of the invention

[0005] In view of the above problems, the object of the present invention is to provide a long-acting canine / feline interleukin-11 fusion protein and a preparation method and application thereof.

[0006] The technical contents of the present invention are as follows:

[0007] The present invention provides a long-acting canine / feline interleukin 11 fusion protein, wherein the structure of the fusion protein is a combination of canine / feline interleukin 11 (IL-11) protein and canine / feline serum albumin (CSA / FSA protein);

[0008] The combination comprises canine / feline serum albumin (CSA / FSA protein) located at the N-terminus or C-terminus of canine / feline interleukin 11 (IL-11) protein;

[0009] The long-acting canine / feline interleukin-11 fusion protein is expressed in an Escherichia coli expression system or a Pichia pastoris expression system;

[0010] The canine / feline interleukin 11 (IL-11) protein includes an amino acid sequence with NCBI accession number of XM_003997398, XM_038655939, or an amino acid sequence having more than 80% (80%, 81%, 82%, 83% .... 99%) homology thereto;

[0011] The amino acid sequence of the NCBI accession number XM_003997398 and XM_038655939 is as shown in SEQ ID NO.1, the nucleic acid sequence after Escherichia coli codon optimization is as shown in SEQ ID NO.2, and the nucleic acid sequence after Pichia pastoris codon optimization is as shown in SEQ ID NO.3;

[0012] The canine / feline interleukin 11 (IL-11) protein includes a truncated peptide of the canine / feline interleukin 11 (IL-11) protein;

[0013] The truncated peptide of canine / feline interleukin 11 (IL-11) protein includes an N-terminally truncated canine / feline interleukin 11 (IL-11) protein; the N-terminus of the canine / feline interleukin 11 (IL-11) protein sequence is rich in proline and is a protein that is difficult to express. After sequence analysis, the amino acid sequence is modified without affecting the activity and spatial structure; the N-terminus truncation modification includes truncating the N-terminus of the canine / feline interleukin 11 (IL-11) protein by n amino acids, n=1-10, preferably, n=1, 3, 4, 7, 8;

[0014] The amino acid sequence of the truncated peptide of the canine / feline interleukin 11 (IL-11) protein includes SEQ ID NOs. 4 to 8, the nucleic acid sequence optimized by Escherichia coli is shown in SEQ ID NOs. 9 to 13, and the nucleic acid sequence optimized by Pichia pastoris codon is shown in SEQ ID NOs. 14 to 18;

[0015] Combined with the high homology of canine / feline interleukin 11 (IL-11), truncated peptides with 100% homology to canine / feline serum albumin (CSA / FSA protein) were selected after sequence alignment and structural analysis for the preparation of a universal canine / feline interleukin 11 (IL-11) drug that can be injected into dogs and cats and has no immunogenicity.

[0016] The canine / feline serum albumin (CSA / FSA protein) includes a truncated peptide of canine / feline serum albumin (CSA / FSA protein);

[0017] The canine / feline serum albumin (CSA / FSA protein) truncated peptide comprises the amino acid sequence shown in SEQ ID NOs. 19 to 21;

[0018] The fusion protein further comprises a Linker flexible connecting peptide (GGGGS) n structure, n=1-10, preferably, n=1-3, and the Linker flexible connecting peptide (GGGGS) n structure is located between the canine / feline interleukin 11 (IL-11) protein and the canine / feline serum albumin (CSA / FSA protein);

[0019] The long-acting canine / feline interleukin-11 fusion protein includes the amino acid sequences shown in SEQ ID NOs.22 to 29, the nucleotide sequences after Escherichia coli codon optimization are shown in SEQ ID NOs.30 to 37, and the nucleic acid sequences after Pichia codon optimization are shown in SEQ ID NOs.38 to 45.

[0020] The present invention also provides a method for preparing a long-acting canine / feline interleukin-11 fusion protein, comprising the following steps:

[0021] After the above canine / feline interleukin 11 (IL-11) protein is optimized for host bacteria codons, an expression vector is constructed on a plasmid, and the target fragment of the vector is cloned after double enzyme digestion, and a linker flexible connecting peptide, canine / feline serum albumin (CSA / FSA protein) and a group tag are constructed on the plasmid to obtain a recombinant plasmid, which is transferred into a prokaryotic expression competent species, and the target protein, i.e., a long-acting canine / feline IL-11 fusion protein, is obtained through resistance screening, expansion culture, induction expression, bacterial lysis, and chromatography purification;

[0022] The host bacteria include Escherichia coli host bacteria and Pichia pastoris host bacteria;

[0023] The Escherichia coli host bacteria include BL21, cBL21, BL21 (DE3), BL21 codon plus (DE3), BL21 Star (DE3), B834 (DE3), Tuner (DE3), Rosetta (DE3), Rosetta2 (DE3), Arctic Express (DE3), Origami (DE3), Origami2 (DE3), OrigamiB (DE3), SHuffle T7, ER2566, OverExpressC43 (DE3), BLR (DE3), HMS174 (DE3), GT115, MG1655, NovaBlue (DE3) and related modified strains, preferably BL21 (DE3);

[0024] The plasmids of the Escherichia coli include pET-3a, pET-11a, pET-12a, pET-14b, pET-15b, pET-16b, pET-17b, pET-19b, pET-20b, pET-21a, pET-22b, pET-23a, pET-24a, pET-25b, pET-26b, pET-27b, pET-28a, pET-29a, pET-30a, pET-31b, pET-32a, pET-33b, pET-34b, pET -35b, pET-37b, pET-39b, pET-40b, pET-41a, pET-42a, pET-43.1a, pET-44a, pET-45b, pET-47b, pET-48b, pET-49b, pET-50b, pET-51b, pET-52b, pETDuet-1, pACYCDuet-1, pCDFDuet-1, pRSFDuet-1, pColaDuet-1 and related modified vectors, preferably pET-30a;

[0025] In the induced expression, Escherichia coli is used to induce the expression of the target gene through IPTG or other lactose structural analogs;

[0026] The Pichia host bacteria include one of X33, GS115, KM71, SMD1168, SMD1168 H, SMD1165, SMD1163, MP-36, MC100-3, MS105, JC100 and related modified strains, preferably X33;

[0027] The plasmid of Pichia pastoris includes one of pPICZαA, pPICZαB, pPICZαC, pGAPZαA, pPIC9K, pPIC9, pHIL-S1, pJL-SX, pBLHIS-SX, pYAM75P, pAOX1, pAOX2, pPICZA, pPICZB, pPICZC, pGAPZA, pPIC3K, pPIC3.5K, pHIL-D2, pJL-IX, and pBLHIS-IX, preferably one of pPICZαA, pPICZαB, and pPICZαC.

[0028] The present invention also provides the use of the above-mentioned long-acting canine / feline interleukin 11 fusion protein in the preparation of pet medicine, which includes canine / feline interleukin 11 injection or lyophilized powder, and preparations made of conventional auxiliary materials, and is used in the treatment of thrombocytopenia and other possible related diseases in dogs and cats.

[0029] The present invention also provides the use of the CSA / FSA truncated peptide in the preparation of pet medicine, and the use is in the research and production of long-acting dog / cat pharmaceutical preparations.

[0030] The beneficial effects of the present invention are as follows:

[0031] The long-acting canine / feline interleukin-11 fusion protein of the present invention has significant differences in the expression amount, biological activity and half-life of the long-acting canine / feline IL-11 fusion protein by using different combinations of canine / feline IL-11 truncated peptides, linkers, CSA / FSA truncated peptides and histidine tags, and a canine / feline IL-11 fusion protein with high activity, high expression amount and long half-life is screened;

[0032] The preparation method of the long-acting canine / cat interleukin 11 fusion protein of the present invention optimizes the canine / cat IL-11 truncated peptide and its fusion protein sequence, including nucleotide sequence and protein sequence, according to the characteristics that natural canine / cat IL-11 protein N is rich in proline and difficult to express. Compared with the relatively low expression amount of natural canine / cat IL-11 in yeast system, the canine / cat IL-11 fusion protein sequence of the present invention can be efficiently expressed in Pichia pastoris and Escherichia coli expression systems, which is conducive to processing, purification and industrial production; different CSA or FSA truncated peptides are selected as amino acid fragments homologous to canine / cat serum albumin by sequence alignment, and the amino acid sequence of the IL-11 of the present invention in dogs / cats is completely homologous, and the canine / cat IL-11 fusion protein sequence is obtained by sequence alignment. The fragment homologous to serum albumin CSA / FSA can be used to fuse canine / feline IL-11 to significantly prolong its half-life and maintain biological activity, so that the long-acting canine / feline IL-11 of the present invention can act on dogs and cats at the same time, expanding its scope of use in the field of pet medicine; the selected CSA / FSA truncated peptide can also be applied to the development and research of pet medicines, with high stability, short molecular size, and fusion expression that is not easy to break. The long-acting canine / feline IL-11 mutant fusion protein fused and expressed in the present invention can significantly prolong its half-life and maintain biological activity, filling the market gap in long-acting canine / feline IL-11-related biological products, and providing certain guiding significance for the development of long-acting canine / feline drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the result of PCR identification of recombinant Escherichia coli bacterial solution;

[0034] Figure 2 This is the result of PCR identification of recombinant Pichia pastoris;

[0035] Figure 3 This is the SDS-PAGE analysis result of the recombinant E. coli induced expression sample;

[0036] Figure 4 This is the SDS-PAGE analysis result of the recombinant Pichia pastoris induced expression sample;

[0037] Figure 5 This is the Western Blot analysis result of the recombinant E. coli induced expression sample;

[0038] Figure 6 This is a diagram showing the results of Western Blot analysis of the recombinant Pichia pastoris induced expression sample. DETAILED DESCRIPTION

[0039] The present invention is further described in detail below through specific implementation cases and accompanying drawings. It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of protection of the present invention. After reading the present invention, various equivalent forms of modifications to the present invention by those skilled in the art are all within the scope of the claims attached to this application.

[0040] Unless otherwise specified, all raw materials and reagents of the present invention are raw materials and reagents from the conventional market.

[0041] Example

[0042] A preparation method of long-acting canine / feline interleukin 11 (IL-11)

[0043] 1. Synthesis of Canine / Feline IL-11 Gene

[0044] According to the natural canine / cat IL-11 gene sequence (amino acid sequence as shown in SEQ ID NO: 1) disclosed by NCBI, the natural canine / cat IL-11 amino acid sequence is translated and obtained, and the preferred codons of the expression host Escherichia coli and Pichia pastoris are optimized using the codon optimization online software (https: / / www.novopro.cn / tools / codon-optimization.htmL) to obtain the DNA sequence encoding the canine / cat IL-11 of the present invention. Preferably, by optimizing and shortening the length of the canine / cat IL-11 amino acid sequence, 1, 3, 4, 7, and 8 amino acid residues at the N-terminus are shortened respectively, to obtain the preferred canine / cat IL-11 DNA sequence of the present invention, which are named IL-11A, IL-11B, IL-11C, IL-11D, and IL-11E, respectively. The nucleic acid sequence after Escherichia coli codon optimization is shown in SEQ ID NO.2, and the nucleic acid sequence after Pichia pastoris codon optimization is shown in SEQ ID NO.3;

[0045] More preferably, the CSA / FSA homologous truncated peptides (amino acid sequences are shown in SEQ ID NOs. 19 to 21, respectively) are connected to the N-terminus or C-terminus of the above-mentioned canine / feline IL-11 and its variants through a flexible linker peptide (L1, L2, L3). In order to facilitate purification, a histidine tag (6×His) is preferably used for fusion expression. IL-11-L1-CSA / FSA1-H, IL-11A-L2-CSA / FSA1-H, IL-11B-L2-CSA / FSA1-H, IL-11C-L2-CSA / FSA2-H, IL-11D-L2-CSA / FSA2-H, IL-11D-L3-CSA / FSA2-H, IL-11E-L1-CSA / FSA3-H, and pET30a-CSA / FSA3-L1-IL-11E-H were synthesized by Nanjing GenScript Biotechnology Co., Ltd. The amino acid sequences of the obtained fusion proteins are shown in SEQ ID NOs. 22 to 29, respectively;

[0046] 2. Construction of vector containing canine / feline IL-11 gene

[0047] The first method: the canine / feline IL-11 after E. coli codon optimization of the above sequence was synthesized into the vector pET30a to obtain pET30a-IL-11-L1-CSA / FSA1-H, pET30a-IL-11A-L2-CSA / FSA1-H, pET30a-IL-11B-L2-CSA / FSA1-H, pET30a-IL-11C-L2-CSA / FSA2-H, pET30a-IL-11D-L2-CSA / FSA2-H, pET30a-IL-11D-L3-CSA / FSA2-H, pET30a-IL-11E-L1-CSA / FSA3-H, and pET30a-CSA / FSA3-L1-IL-11E-H, and the nucleotide sequences after E. coli codon optimization are shown in SEQ ID NOs. 30 to 37, respectively;

[0048] The second method: the canine / feline IL-11 after Pichia codon optimization of the above sequence was synthesized on the Pichia expression vector pPICZαA to obtain pPICZαA-IL-11-L1-CSA / FSA1-H, pPICZαA-IL-11A-L2-CSA / FSA1-H, pPICZαA-IL-11B-L2-CSA / FSA1-H, pPICZαA-IL-11C-L2-CSA / FSA2-H, pPICZαA-IL-11D-L2-CSA / FSA2-H, pPICZαA-IL-11D-L3-CSA / FSA2-H, pPICZαA-IL-11E-L1-CSA / FSA3-H, and pPICZαA-CSA / FSA3-L1-IL-11E-H. The nucleotide sequences after Pichia codon optimization are shown in SEQ ID Shown in NO.38~45.

[0049] 3. Transformation of host expression strains

[0050] 3.1 Heat stress transformation of prokaryotic expression host Escherichia coli

[0051] The above 8 recombinant plasmids were transformed into E. coli competent BL21 by heat stress. The heat stress transformation steps are as follows:

[0052] 1) Take out the expression competent cells (BL21(DE3)) from the -80℃ refrigerator, thaw them in an ice bath, add 1μL of the constructed plasmid and 10μL of competent cells to a new sterile 1.5mL EP tube at a volume ratio of 1:10, pipette gently to mix, and place on ice for 30min;

[0053] 2) Then heat stress at 42°C for 90 seconds, followed by an ice bath for 5 minutes;

[0054] 3) Add 200 μL of antibiotic-free LB liquid medium to the centrifuge tube and culture at 37°C with gentle shaking for 60 min;

[0055] 4) Spread the resuspended bacterial solution evenly on LB solid medium containing 50 μg / mL Kana, place it in a 37°C incubator and culture it on its front side for about 15 minutes. After all the liquid is absorbed, turn the plate upside down and culture it for 12-16 hours.

[0056] 3.2 Electroporation of Pichia pastoris

[0057] 3.2.1 Preparation of Pichia pastoris X33 competent cells

[0058] 1) Inoculate a single colony of yeast recipient bacteria on a YPD plate and culture at 30°C for 2 days;

[0059] 2) Pick a single colony from the plate and inoculate it into 10 mL YPD liquid culture medium and shake it overnight at 30°C;

[0060] 3) After overnight culture, inoculate about 1% of the inoculum into 100 mL YPD medium and shake culture until the OD value is 1.2-1.5;

[0061] 4) Centrifuge at 5000 rpm for 5 min at 4°C to collect the precipitated cells, and resuspend them in 100 mL of pre-cooled sterile water;

[0062] 5) Centrifuge at 4°C, 5000 rpm for 10 min to collect the precipitated cells, and resuspend them in 100 mL of pre-cooled sterile water;

[0063] 6) Centrifuge again at 4°C, 5000 rpm for 10 min to collect the precipitated cells, and resuspend the cells in 100 mL of pre-cooled sterile water;

[0064] 7) Wash once with 20 mL, 1 mol / L sorbitol;

[0065] 8) Dissolve the cells in 1 mL of 1 M pre-cooled sorbitol without glycerol and place at -80°C for several hours until transformation;

[0066] 3.2.2 Electroporation of linearized expression plasmid into Pichia pastoris X33 competent cells

[0067] 1) Prepare 80 mL of competent yeast and mix with 2 μg of linearized recombinant plasmid (precooled on ice for 15 min), quickly put into a 0.2 cm electric shock cup (precooled and sterilized on ice), and electroporate; the electroporation parameters are Voltage: 1500 V; Capacitance: 25 μF; Resistance: 200 Ω; Cuvette (mm): 2 mm;

[0068] 2) After the electroporation, add 1 mL of sorbitol (1 M) quickly, place on ice for 15 min, and then place in a 30°C incubator for 1 h. Add 1 mL of YPD liquid culture medium, shake and culture at 30°C, 200 r / min for 1 h, collect the cells by centrifugation at room temperature, 4 000 r / min, spread on a YPDS plate containing 100 μg / μL, and place at 30°C for 3 days.

[0069] 4. PCR Identification of Strains Producing Recombinant Canine / Feline IL-11 Fusion Protein

[0070] 4.1 PCR Identification of E. coli Strains Expressing Recombinant Canine / Feline IL-11 Fusion Protein

[0071] Use a sterilized pipette tip to carefully pick up single colonies with Kana resistance growing on the above LB plates, pick 3 colonies from each plate, pick the colonies into 2 mL LB liquid culture medium containing 50 μg / mL Kana, and activate and culture at 37°C, 200 r / min for 4 hours; perform PCR identification of the cultured bacterial solution according to the system and procedure in the table below;

[0072] Upstream primer (SEQ ID NO. 46): CGGTGATGCCGGCCACGATG;

[0073] Downstream primer (SEQ ID NO. 47): GGGTTATGCTAGTTATTGCTC.

[0074] Table 1 PCR identification system

[0075]

[0076] Table 2 PCR identification procedures for recombinant bacterial solution

[0077]

[0078] The results of PCR identification of recombinant E. coli culture were as follows Figure 1 (M: 2000 bp DNA Marker; 1-3: Recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11-L1-CSA / FSA1-H culture; 4-6: Recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11A-L2-CSA / FSA1-H culture; 7-9: Recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11B-L2-CSA / FSA1-H culture; 10-12: Recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11C-L2-CSA / FSA2-H culture; 13-15: Recombinant Escherichia coli BL21 (DE3) / pET30a -IL-11D-L2-CSA / FSA2-H culture; 16-18: recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11D-L3-CSA / FSA2-H culture; 19-21: recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11E-L1-CSA / FSA3-H culture; 22-24: recombinant Escherichia coli BL21 (DE3) / pET30a-CSA / FSA3-L1-IL-11E-H culture), it can be seen that the recombinant Escherichia coli for fusion expression of the preferred IL-11 truncated peptide of the present invention and the CSA / FSA homologous truncated peptide is successfully constructed.

[0079] 4.2 PCR Identification of Recombinant Canine / Feline IL-11 Fusion Protein in Yeast

[0080] Use a sterilized pipette tip to carefully pick the YPDS (Zeocin + ) single colonies with bleomycin resistance growing on the plate, pick 3 colonies from each plate, and add 2 mL of 100 μg / mL Zeocin + YPD liquid medium, 30℃, 200r / min for 24h; the cultured bacterial solution was identified by PCR according to the system and procedure in the table below;

[0081] Upstream primer α-factor (SEQ ID NO. 48): TACTATTGCCAGCATTGCTGC;

[0082] Downstream primer 3'Aox1 (SEQ ID NO. 49): CAAATGGCATTCTGACATCC.

[0083] Table 3 PCR identification system

[0084]

[0085]

[0086] Table 4 PCR identification procedures for recombinant bacterial solution

[0087]

[0088] The results of PCR identification of recombinant Pichia pastoris were as follows Figure 2(M: 2000 bp DNA Marker; 1-3: bacterial solution of recombinant Pichia pastoris X33 / pET30a-IL-11-L1-CSA / FSA1-H; 4-6: bacterial solution of recombinant Pichia pastoris X33 / pET30a-IL-11A-L2-CSA / FSA1-H; 7-9: bacterial solution of recombinant Pichia pastoris X33 / pET30a-IL-11B-L2-CSA / FSA1-H; 10-12: bacterial solution of recombinant Pichia pastoris X33 / pET30a-IL-11C-L2-CSA / FSA2-H; 13-15: bacterial solution of recombinant Pichia pastoris X33 / pET30a-IL-1 1D-L2-CSA / FSA2-H culture; 16-18: recombinant Pichia pastoris X33 / pET30a-IL-11D-L3-CSA / FSA2-H culture; 19-21: recombinant Pichia pastoris X33 / pET30a-IL-11E-L1-CSA / FSA3-H culture; 22-24: recombinant Pichia pastoris X33 / pET30a-CSA / FSA3-L1-IL-11E-H culture), it can be seen that the Pichia pastoris expressing the combination of the preferred IL-11 truncated peptide and the CSA / FSA homologous truncated peptide of the present invention was successfully constructed.

[0089] 5. Inducible expression of recombinant strains

[0090] 5.1 Inducible expression of recombinant canine / feline IL-11 fusion protein in Escherichia coli

[0091] The E. coli expressing the canine / feline IL-11 expression vector was inoculated into a kanamycin-resistant liquid LB medium, and cultured at 37°C and 220rpm in a constant temperature shaker for 14 to 16 hours to obtain a seed solution; the seed solution was expanded and cultured at a ratio of 1:100, and when OD600≈0.6, IPTG with a final concentration of 0.5mM was added to induce expression, and the culture was continued at 25°C and 220rpm for 4 hours; after the culture was completed, the cells were centrifuged at 4°C and 12000rpm in a low-temperature high-speed centrifuge for 10 minutes, and the supernatant medium was discarded to obtain the bacteria containing the target protein. The above bacteria were resuspended with 20mL PBS buffer, mixed thoroughly, and placed in an ice-water mixture, and the cells were broken using an ultrasonic disruptor, with a working power of 300W, ultrasonication for 5s and pause for 5s, and the total breaking time was 15min. If the breaking was incomplete, the breaking time could be appropriately extended. The broken bacterial solution was centrifuged in a low-temperature high-speed centrifuge at 4°C and 12000 rpm for 15 min, the supernatant was retained, and filtered with a 0.45 μM filter membrane. The filtered solution was the target protein solution.

[0092] 5.2 Inducible expression of recombinant canine / feline IL-11 fusion protein in yeast

[0093] 1) Use a sterilized pipette tip to carefully pick up the single colony with Zeocin resistance growing on the YPD plate, and place it in 20 mL of BMGY liquid medium for activation culture at 30°C, 200 rpm, and shake overnight until OD600 = 2-6, at which time the cells are in the logarithmic growth phase;

[0094] 2) Centrifuge at 3000 rpm for 5 min at room temperature to collect the precipitate, resuspend it in 1 mL of BMMY, wrap it with four layers of clean gauze and two layers of newspaper, and culture it in a 250 mL conical flask with shaking;

[0095] 3) Add 100% methanol every 24 hours to a final concentration of 1-1.5% for induction culture;

[0096] 4) After 72 hours of induction culture, samples were collected, centrifuged, and the supernatant was stored at -80°C for subsequent testing.

[0097] 6. SDS-PAGE Analysis of Expression Samples

[0098] 6.1 Sample preparation

[0099] Add 5× loading buffer to the protein solution of the E. coli supernatant and the induced expression supernatant of Pichia pastoris, and cook at 100°C for 10 min.

[0100] 6.2SDS-PAGE electrophoresis-stacking gel

[0101] Load the sample into the SDS-PAGE gel, add the diluted electrophoresis solution inside and outside, cover the electrodes and connect the electrophoresis instrument, and prepare to run the equipment. After running at 80V for 20 minutes, the sample is compressed into a line;

[0102] 6.3SDS-PAGE electrophoresis-separation gel

[0103] After concentrated gel electrophoresis, increase the voltage to 130V and run for 50-70 minutes. End the electrophoresis when the marker bands are clearly separated.

[0104] 6.4 Dyeing

[0105] After the electrophoresis is completed, remove the gel plate after electrophoresis, disassemble the gel plate with a small spatula, remove the concentrated gel, rinse the separation gel with tap water and then transfer it to Coomassie Brilliant Blue staining solution for staining, and accelerate the staining on a decolorizing shaker for 1-2 hours.

[0106] The results of SDS-PAGE analysis of the recombinant E. coli induced expression samples are shown in Figure 3(M: protein marker; 1: induced sample group of recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11-L1-CSA / FSA1-H; 2: induced sample group of recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11A-L2-CSA / FSA1-H; 3: induced sample group of recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11B-L2-CSA / FSA1-H; 4: induced sample group of recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11C-L2-CSA / FSA2-H; 5: induced sample group of recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11A-L2-CSA / FSA1-H The induction sample group of the recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11D-L2-CSA / FSA2-H is shown in Figure 6; 7: the induction sample group of the recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11D-L3-CSA / FSA2-H; 8: the induction sample group of the recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11E-L1-CSA / FSA3-H. It can be seen that the preferred IL-11 truncated peptide and the CSA / FSA homologous truncated peptide fusion protein of the present invention are both efficiently expressed in Escherichia coli.

[0107] The results of SDS-PAGE analysis of the recombinant Pichia pastoris induced expression samples are shown in Figure 4 (M: protein marker; 1: induced sample group of recombinant Pichia pastoris X33 / pET30a-IL-11-L1-CSA / FSA1-H; 2: induced sample group of recombinant Pichia pastoris X33 / pET30a-IL-11A-L2-CSA / FSA1-H; 3: induced sample group of recombinant Pichia pastoris X33 / pET30a-IL-11B-L2-CSA / FSA1-H; 4: induced sample group of recombinant Pichia pastoris X33) / pET30a-IL-11C-L2-CSA / FSA2-H; 5: induced sample group of recombinant Pichia pastoris X33 / pET30a-IL-11A-L2-CSA / FSA1-H. The induction sample groups of FIG. 1 and FIG. 2 are as follows: 1) induced sample group L-11D-L2-CSA / FSA2-H; 2) induced sample group L-11D-L2-CSA / FSA2-H; 3) induced sample group L-11D-L2-CSA / FSA2-H; 4) induced sample group L-11D-L2-CSA / FSA2-H; 5) induced sample group L-11D-L2-CSA / FSA2-H; 6) induced sample group L-11D-L3-CSA / FSA2-H; 7) induced sample group L-11D-L2-CSA / FSA2-H; 8) induced sample group L-11D-L2-CSA / FSA2-H; 9) induced sample group L-11D-L2-CSA / FSA2-H; 10) induced sample group L-11D-L2-CSA / FSA2-H; 11) induced sample group L-11D-L2-CSA / FSA2-H; 12) induced sample group L-11D-L3-CSA / FSA2-H; 13) induced sample group L-11D-L2-CSA / FSA2-H; 14) induced sample group L-11D-L2-CSA / FSA2-H; 15) induced sample group L-11D-L3-CSA / FSA2-H; 16) induced sample group L-11D-L2-CSA / FSA2-H; 17) induced sample group L-11D-L3-CSA / FSA2-H; 18) induced sample group L-11D-L2-CSA / FSA2-H; 19) induced sample group L-11D-L3-CSA / FSA2-H; 10) induced sample

[0108] 7. Western Blot Analysis of Protein Solution

[0109] 7.1 Cut 6 pieces of PVDF membrane and filter paper according to the size of the gel, soak them in pure methanol for 1-2 minutes, and then incubate them in pre-cooled transfer buffer for 10 minutes;

[0110] 7.2 Assemble the transfer protein glue: sponge / 3 layers of filter paper / glue / membrane / 3 layers of filter paper / sponge. After each layer is placed, use a test tube to remove all bubbles;

[0111] 7.3 Place the transfer tank in an ice bath, put in the sandwich, with the membrane close to the anode and the gel close to the cathode, add transfer buffer, plug in the electrodes, 100V, 1h;

[0112] 7.4 After the transfer is completed, cut off the power supply and take out the membrane;

[0113] 7.5 Immune Response

[0114] 1) Open the clamp and cut the excess PVDF membrane according to the size of the glue;

[0115] 2) Move to the incubation box, rinse with TBST working solution, and quickly pour the blocking solution to cover the membrane surface. Incubate at room temperature, on a decolorizing shaker, at the lowest speed, or at 37°C, on a constant temperature shaker, at 40 rpm, for 2 hours;

[0116] 3) Pour off the blocking solution;

[0117] 4) Dilute the primary antibody with blocking solution, then pour the primary antibody solution into the incubation box. The solution must be >6mL;

[0118] 5) Incubate at room temperature for 1-2 hours or overnight at 4°C, with the shaker at the lowest speed for decolorization;

[0119] 6) Pour off the primary antibody solution, rinse with TBST, then pour in TBST, and place on a decolorizing shaker for treatment, a total of 5 times, 15 min / time, >30 mL / time, room temperature, speed see the scale of the equipment;

[0120] 7) Select the corresponding secondary antibody according to the project, dilute it with blocking solution and set aside.

[0121] 8) After washing the membrane, pour off the TBST and add the secondary antibody solution. The solution must be >6mL.

[0122] 9) Incubate at room temperature, on a decolorizing shaker at the lowest speed or at 37°C, 40 rpm, for 1 h.

[0123] 10) Pour off the primary antibody solution, rinse with TBST, then pour in TBST again and place on a decolorizing shaker for treatment, a total of 5 times, 15 min / time, >30 mL / time, room temperature, speed as indicated by the scale.

[0124] 11) Chemiluminescence

[0125] Wearing gloves, mix equal volumes of chemiluminescent solution A and B reagents, and perform chemiluminescent development and photography.

[0126] Western Blot analysis results of recombinant E. coli induced expression samples are shown in Figure 5 (M: protein marker; 1: induced sample group of recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11-L1-CSA / FSA1-H; 2: induced sample group of recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11A-L2-CSA / FSA1-H; 3: induced sample group of recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11B-L2-CSA / FSA1-H; 4: induced sample group of recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11C-L2-CSA / FSA2-H; 5: induced sample group of recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11A-L2-CSA / FSA1-H The induction sample group of the recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11D-L2-CSA / FSA2-H was shown in Figure 6; 7: the induction sample group of the recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11D-L3-CSA / FSA2-H; 8: the induction sample group of the recombinant Escherichia coli BL21 (DE3) / pET30a-IL-11E-L1-CSA / FSA3-H. The results show that the fusion protein of the IL-11 truncated peptide and the CSA / FSA homologous truncated peptide of the present invention can be efficiently induced for expression in Escherichia coli.

[0127] Western Blot analysis results of recombinant Pichia pastoris induced expression samples are shown in Figure 6(M: protein marker; 1: induced sample group of recombinant Pichia pastoris X33 / pET30a-IL-11-L1-CSA / FSA1-H; 2: induced sample group of recombinant Pichia pastoris X33 / pET30a-IL-11A-L2-CSA / FSA1-H; 3: induced sample group of recombinant Pichia pastoris X33 / pET30a-IL-11B-L2-CSA / FSA1-H; 4: induced sample group of recombinant Pichia pastoris X33) / pET30a-IL-11C-L2-CSA / FSA2-H; 5: induced sample group of recombinant Pichia pastoris X33 / pET30a-IL-11A-L2-CSA / FSA1-H. The results show that the fusion protein of the IL-11 truncated peptide of the present invention and the CSA / FSA homologous truncated peptide can be efficiently induced for expression in Pichia pastoris.

[0128] 8. Purification

[0129] The above target protein solution was loaded onto a balanced nickel column, and the target protein eluate was obtained by washing and eluting. The above protein eluate was concentrated using an ultrafiltration tube to obtain the target protein solution, which was measured by a BCA protein concentration determination kit. The results are shown in Table 5, and the protein concentrations are ranked from high to low as IL-11B-L2-CSA / FSA1-H>IL-11D-L2-CSA / FSA2-H>IL-11E-L1-CSA / FSA3-H>IL-11A-L2-CSA / FSA1-H>IL-11C-L2-CS A / FSA2-H>CSA / FSA3-L1-IL-11E-H>IL-11D-L3-CSA / FSA2-H>IL-11-L1-CSA / FSA1-H.

[0130] Table 5 Canine / feline interleukin 11 (IL-11) fusion protein purification concentration (mg / L)

[0131]

[0132] 9. Determination of canine / feline IL-11 fusion protein activity (B9-11 cells / MTT colorimetric method)

[0133] Preparation of standard solution: Take human interleukin-11 biological activity assay standard, reconstitute according to the instructions, and dilute with basal culture medium to 1000 units per 1mL or appropriate concentration. In a 96-well cell culture plate, make 4-fold serial dilutions, a total of 8 dilutions, and make 2 wells for each dilution. Keep 50μL of standard solution in each well, and discard the excess solution in the well. The above operations are performed under sterile conditions.

[0134] Preparation of test solution: dilute the above target protein solution with basic culture medium to about 1000 units per 1mL or appropriate concentration. In a 96-well cell culture plate, make 4-fold serial dilutions, a total of 8 dilutions, and make 2 wells for each dilution. Keep 50μL of test solution in each well and discard the excess solution in the well. The above operations are performed under sterile conditions.

[0135] B9-11 cell lines were cultured with complete culture medium at 37°C and 5% carbon dioxide, and used for biological activity assays 24 to 72 hours after passage. The test solution was pre-warmed to 37°C. Sufficient B9-11 cell culture was collected by centrifugation, washed three times with RPMI 1640 culture medium, and then resuspended in basal culture medium to prepare 2.0×10 5 ~3.0×10 5 Prepare a cell suspension of 100 cells (the inoculation density can be adjusted appropriately according to the cell status) and place it at 37°C for use. Add 50 μL of cell suspension to each well of a 96-well cell culture plate with standard solution and test solution, and culture at 37°C and 5% carbon dioxide for 40 to 48 hours. Add 20 μL of MTT solution to each well and culture at 37°C and 5% carbon dioxide for 4 to 5 hours. The above operations are performed under sterile conditions. Add 100 μL of lysis solution to each well, mix well (SDS overnight) (when lysing with 10% SDS in 0.01 mol / HCl, it needs to be placed for an appropriate time), put it into an enzyme reader, use 630 nm as the reference wavelength, measure the absorbance at a wavelength of 570 nm, and record the measurement results. The experimental data is processed using a computer program or a four-parameter regression calculation method, and the results are calculated as follows:

[0136]

[0137] Where P r is the biological activity of the standard, U / mL; D s D is the pre-dilution multiple of the test product; r E is the pre-dilution multiple of the standard; s E is the dilution multiple of the test sample equivalent to the half-effective dose of the standard sample; r It is the dilution multiple of the half-effective dose of the standard.

[0138] Table 6 Biological activity of canine / feline interleukin 11 (IL-11) fusion protein (IU / mg)

[0139]

[0140] The IL-11 biological activity of the above-mentioned protein solutions was measured, and the ratio of biological activity to protein content was further calculated. The results can be seen from Table 6 that the specific activities of the above-mentioned proteins in the Escherichia coli expression system are ranked as follows: IL-11E-L1-CSA / FSA3-H>IL-11D-L2-CSA / FSA2-H>IL-11B-L2-CSA / FSA1-H=IL-11A-L2-CSA / FSA1-H>IL-11D-L3-CS A / FSA2-H>CSA / FSA3-L1-IL-11E-H>IL-11C-L2-CSA / FSA2-H>IL-11-L1-CSA / FSA1-H>IL-11 standard (human interleukin-11).

[0141] In the Pichia pastoris expression system, the relative activities of the above proteins are ranked as follows: IL-11E-L1-CSA / FSA3-H>IL-11D-L2-CSA / FSA2-H=IL-11D-L3-CSA / FSA2-H>IL-11B-L2-CSA / FSA1-H=CSA / FSA3-L1-IL-11E-H>IL-11A-L2-CSA / FSA1-H>IL-11C-L2-CSA / FSA2-H>IL-11-L1-CSA / FSA1-H>IL-11 standard (human interleukin-11).

[0142] Except for the IL-11 standard, the biological activity of IL-11 in the above groups was not less than 8.0×10 6 U, among which the biological activities of IL-11E-L1-CSA / FSA3-H, IL-11D-L2-CSA / FSA2-H, IL-11A-L2-CSA / FSA1-H, IL-11B-L2-CSA / FSA1-H, IL-11D-L3-CSA / FSA2-H, and CSA / FSA3-L1-IL-11E-H are relatively ideal and significantly better than the biological activity of the standard.

[0143] 10. Determination of the half-life of canine / feline IL-11 (B9-11 cells / MTT colorimetric method)

[0144] Based on the bioactivity assay scheme of Example 5 above, the time gradient of co-culture of B9-11 cells with standard solution or test solution was extended to 0h, 24h, 48h, 72h, and 96h. According to the proliferation rate of B9-11 cells, the time scale of action of the test product canine / feline IL-11 was intuitively determined.

[0145] Preparation of standard solution: Take human interleukin-11 biological activity assay standard, reconstitute according to the instructions, and dilute with basic culture medium to 1000 units or appropriate concentration per 1mL. Make 4-fold serial dilutions, a total of 8 dilutions, and make 10 wells of solution for each dilution. Make 2 wells for each dilution in a 96-well cell culture plate marked "0h, 24h, 48h, 72h, 96h", leave 50μL of standard solution in each well, and discard the excess solution in the well. The above operations are performed under sterile conditions.

[0146] Preparation of test solution: dilute the above target protein solution with basic culture medium to about 1000 units per 1mL or appropriate concentration. Make 4-fold serial dilutions, a total of 8 dilutions, 10 wells for each dilution, and 2 wells for each dilution in a 96-well cell culture plate marked "0h, 24h, 48h, 72h, 96h", leaving 50μL of test solution in each well, and discard the excess solution in the well. The above operations are performed under sterile conditions.

[0147] B9-11 cell lines were cultured with complete culture medium at 37°C and 5% carbon dioxide, and used for biological activity assays 24 to 72 hours after passage. The test solution was pre-warmed to 37°C. Sufficient B9-11 cell culture was collected by centrifugation, washed three times with RPMI 1640 culture medium, and then resuspended in basal culture medium to prepare 2.0×10 5 ~3.0×10 5 Cell suspension of 100 cells (the inoculation density can be adjusted appropriately according to the cell status) was placed at 37°C for use. 50 μL of cell suspension was added to each well of a 96-well cell culture plate marked with "0h, 24h, 48h, 72h, 96h" with standard solution and test solution, and cultured for 37°C and 5% carbon dioxide for 1 hour.

[0148] After the corresponding incubation time, the corresponding 96-well cell culture plate was taken out, 20 μL of MTT solution was added to each well, and the cells were incubated at 37° C. and 5% carbon dioxide for 4 to 5 hours. The above operations were performed under sterile conditions.

[0149] Add 100 μL of lysis solution to each well, mix well (SDS overnight) (when using 10% SDS in 0.01 mol / HCl for lysis, place for an appropriate time), put into the microplate reader, use 630 nm as the reference wavelength, measure the absorbance at a wavelength of 570 nm, and record the measurement results. The test data is processed using a computer program or a four-parameter regression calculation method, and the results are calculated as follows:

[0150]

[0151] Where P r is the biological activity of the standard, U / mL; D s D is the pre-dilution multiple of the test product; r E is the pre-dilution multiple of the standard; s E is the dilution multiple of the test sample equivalent to the half-effective dose of the standard sample; r It is the dilution multiple of the half-effective dose of the standard.

[0152] According to the extension of the biological activity of IL-11 over time, the biological activity of IL-11 of different concentrations in each group was detected, the average value was calculated, and the time gradient curve of the biological activity of IL-11 in each group was drawn. The time when the biological activity on the curve decreased by half was recorded as the half-life of IL-11 in this group. The results are as follows:

[0153] Table 7 Half-life of canine / feline interleukin 11 (IL-11) fusion protein (h)

[0154]

[0155] As can be seen from Table 7, compared with the IL-11 standard, the canine / feline IL-11 fusion protein has a longer half-life. The half-lives of IL-11B-L2-CSA / FSA1-H, IL-11D-L2-CSA / FSA2-H, IL-11D-L3-CSA / FSA2-H, IL-11E-L1-CSA / FSA3-H, and CSA / FSA3-L1-IL-11E-H are all over 18 hours, which is significantly improved compared with the half-life of 6.5 hours in the control group.

Claims

1. A long-acting canine / feline interleukin-11 fusion protein, characterized in that: The structure of the fusion protein comprises a combination of canine / feline interleukin 11 protein and canine / feline serum albumin.

2. The long-acting canine / feline interleukin-11 fusion protein according to claim 1, characterized in that The canine / feline interleukin 11 protein includes amino acid sequences with NCBI accession numbers of XM_003997398 and XM_038655939 or amino acid sequences with more than 80% homology thereto.

3. The long-acting canine / feline interleukin-11 fusion protein according to claim 1, characterized in that The canine / feline interleukin 11 protein includes a truncated peptide of the canine / feline interleukin 11 protein; the truncated peptide of the canine / feline interleukin 11 protein includes an N-terminally truncated canine / feline interleukin 11 protein; The N-terminal truncation modification comprises truncating the N-terminal of the canine / feline interleukin 11 protein by n amino acids, where n=1-10.

4. The long-acting canine / feline interleukin-11 fusion protein according to claim 1, characterized in that The canine / feline serum albumin includes canine / feline serum albumin truncated peptides.

5. The long-acting canine / feline interleukin-11 fusion protein according to claim 1, characterized in that The fusion protein further comprises a Linker flexible linker peptide (GGGGS) n structure, where n=1-10.

6. A method for preparing the long-acting canine / feline interleukin-11 fusion protein according to any one of claims 1 to 5, characterized in that: The steps include: After the host bacteria codons are optimized, the canine / feline interleukin 11 protein is constructed on a plasmid to obtain an expression vector, and the target fragment of the vector is cloned after double enzyme digestion, and the linker flexible connecting peptide, canine / feline serum albumin and group tag are constructed on the plasmid to obtain a recombinant plasmid, which is transferred into a prokaryotic expression competent state, and the target protein, i.e., a long-acting canine / feline IL-11 fusion protein, is obtained through resistance screening, expansion culture, induction expression, lysis of bacteria, and chromatography purification; The host bacteria include Escherichia coli host bacteria and Pichia pastoris host bacteria.

7. The method for preparing the long-acting canine / feline interleukin-11 fusion protein according to claim 6, characterized in that: The E. coli host bacteria include BL21, cBL21, BL21 (DE3), BL21 codon plus (DE3), BL21 Star (DE3), B834 (DE3), Tuner (DE3), Rosetta (DE3), Rosetta2 (DE3), Arctic Express (DE3), Origami (DE3), Origami2 (DE3), OrigamiB (DE3), SHuffle T7, ER2566, OverExpressC43 (DE3), BLR (DE3), HMS174 (DE3), GT115, MG1655, NovaBlue (DE3) and related modified strains; The plasmids of the Escherichia coli include pET-3a, pET-11a, pET-12a, pET-14b, pET-15b, pET-16b, pET-17b, pET-19b, pET-20b, pET-21a, pET-22b, pET-23a, pET-24a, pET-25b, pET-26b, pET-27b, pET-28a, pET-29a, pET-30a, pET-31b, pET-32a, pET-33b, pET-34 b, pET-35b, pET-37b, pET-39b, pET-40b, pET-41a, pET-42a, pET-43.1a, pET-44a, pET-45b, pET-47b, pET-48b, pET-49b, pET-50b, pET-51b, pET-52b, pETDuet-1, pACYCDuet-1, pCDFDuet-1, pRSFDuet-1, pColaDuet-1 and their related modified vectors.

8. The method for preparing the long-acting canine / feline interleukin-11 fusion protein according to claim 6, characterized in that: The Pichia host bacteria include one of X33, GS115, KM71, SMD1168, SMD1168 H, SMD1165, SMD1163, MP-36, MC100-3, MS105, JC100 and related modified strains; The plasmid of Pichia pastoris includes one of pPICZαA, pPICZαB, pPICZαC, pGAPZαA, pPIC9K, pPIC9, pHIL-S1, pJL-SX, pBLHIS-SX, pYAM75P, pAOX1, pAOX2, pPICZA, pPICZB, pPICZC, pGAPZA, pPIC3K, pPIC3.5K, pHIL-D2, pJL-IX, and pBLHIS-IX, preferably one of pPICZαA, pPICZαB, and pPICZαC.

9. Use of the long-acting canine / feline interleukin-11 fusion protein according to any one of claims 1 to 5 in the preparation of pet medicine, characterized in that: The pet medicine includes canine / feline interleukin 11 injection or lyophilized powder, and preparations made from conventional auxiliary materials, and is used for treating thrombocytopenia in dogs and cats and other possible related diseases.

10. A use of the canine / cat serum albumin truncated peptide according to claim 4 in the preparation of pet medicine, characterized in that: The application is the application in the research and production of long-acting dog / cat pharmaceutical preparations.

Images