Bifidobacterium longum subspecies FB1-1 and application thereof

Abstract

The invention discloses a bifidobacterium longum subspecies FB1-1, and the bifidobacterium longum subspecies FB1-1 is preserved in the Guangdong Microbial Culture Collection Center, the preservation number is GDMCC (China General Microbiological Culture Collection Center) No.63774, and the preservation date is September 7, 2023. The invention further discloses a preparation method of the bifidobacterium longum subspecies FB1-1. The bifidobacterium longum subspecies FB1-1. The bifidobacterium longum subspecies FB1-1 disclosed by the invention can inhibit the drug resistance function of carbapenemase-resistant bacteria, and the strain is separated from excrement of a baby fed with breast milk and is a recognized edible strain; the strain especially has a good inhibition effect on the growth of carbapenemase-resistant klebsiella pneumoniae, the expression of drug-resistant genes, the horizontal transfer of drug-resistant plasmids and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and in particular to Bifidobacterium longum subspecies FB1-1 and applications thereof. Background Art

[0002] Klebsiella pneumoniae can grow and colonize in different parts of the human body or other organisms, and can persist on environmental surfaces. Therefore, this type of pathogen is a pathogen of a type of hospital-acquired infection, mainly including severe pneumonia, wound infection, urinary tract infection and sepsis. Klebsiella pneumoniae is usually transmitted between medical staff and patients in the hospital environment. β-lactam antibiotics are the main drugs for treating this type of pathogen. However, Klebsiella pneumoniae gradually produces genetic mutations and can secrete a β-lactamase after long-term growth and reproduction in the environment of this type of antibiotics, which hydrolyzes β-lactam antibiotics and makes them lose their therapeutic effect. Horizontal transfer of mobile genetic elements (especially transposons encoded on insertion sequences and plasmids) is considered to be the main reason for the widespread spread of carbapenem-resistant Klebsiella pneumoniae. The bla_KPC gene is often carried on a transferable plasmid in the conservative Tn3 family transposon Tn4401, which causes the persistent and effective spread of Klebsiella pneumoniae resistance through horizontal transfer. In recent years, the more advanced methods for treating drug-resistant pathogens mainly include phage therapy, gene editing and antibody therapy. However, the toxicity of phages themselves has long made the safety of phage therapy controversial. In addition, the high cost and high off-target rate of gene editing and the high production cost and short shelf life of antibody therapy have greatly limited the practical application of these two types of therapies. Therefore, there is an urgent need to find new and safe alternative therapies for drug-resistant pathogens. Summary of the invention

[0003] In view of the problems existing in the prior art, the first aspect of the present invention is to provide Bifidobacterium longum subspecies FB1-1, which is achieved through the following technical solutions:

[0004] Bifidobacterium longum subsp. longum FB1-1, the Bifidobacterium longum subsp. longum is deposited in Guangdong Provincial Microbiological Culture Collection Center, with the deposit number: GDMCC No: 63774, and the deposit date is September 7, 2023.

[0005] Preferably, the Bifidobacterium longum subspecies FB1-1 has at least one or more of the following characteristics:

[0006] Ⅰ) The morphology of the bacteria displayed by scanning electron microscopy includes one or more of the following: rod-shaped, spherical, V-shaped, and Y-shaped;

[0007] Ⅱ) Gram-positive bacteria;

[0008] III) Colony characteristics: the colonies are tiny white, moist, and have neat edges;

[0009] IV) The growth characteristics are anaerobic growth at 36°C-38°C and entering the stable phase after 16h-20h of cultivation.

[0010] The second aspect of the present invention is to provide the application of the Bifidobacterium longum subspecies FB1-1, which has at least one or more of the following applications:

[0011] 1) Preparation of functional foods;

[0012] 2) Preparation of drugs for preventing or treating carbapenemase-resistant bacteria;

[0013] 3) preparing cleaning products;

[0014] 4) preparing feed;

[0015] 5) Prepare additives.

[0016] Preferably, the Bifidobacterium longum subspecies FB1-1 has the function of inhibiting the drug resistance function of carbapenemase-resistant bacteria.

[0017] Preferably, the carbapenemase-resistant bacteria is drug-resistant Klebsiella pneumoniae.

[0018] Preferably, the drug for preventing or treating drug-resistant Klebsiella pneumoniae includes but is not limited to drugs for preventing or treating pneumonia, drugs for preventing or treating meningitis, drugs for preventing or treating peritonitis, drugs for preventing or treating endophthalmitis, drugs for preventing or treating wound infection, drugs for preventing or treating urinary tract infection, and drugs for preventing or treating sepsis. Preferably, the Bifidobacterium longum subspecies FB1-1 inhibits drug-resistant Klebsiella pneumoniae by inhibiting the expression of drug resistance genes and / or virulence genes of drug-resistant Klebsiella pneumoniae.

[0019] Preferably, the drug resistance gene is bla_KPC, and the virulence gene is uge.

[0020] Preferably, the Bifidobacterium longum subspecies FB1-1 has the effect of inhibiting plasmid conjugative transfer.

[0021] Preferably, the minimum inhibitory concentration of Bifidobacterium longum subspecies FB1-1 is 125 μL / mL.

[0022] Preferably, the drug for preventing or treating carbapenemase-resistant bacteria is an injection or an oral agent.

[0023] Preferably, the pharmaceutical composition for preventing or treating carbapenemase-resistant bacteria contains Bifidobacterium longum subspecies FB1-1 according to claim 1 to claim 7, or a pharmaceutically acceptable salt thereof, or a solvate thereof.

[0024] Preferably, the drug for preventing or treating carbapenemase-resistant bacteria further comprises a pharmaceutically acceptable carrier.

[0025] The third aspect of the present invention is to provide a bacterial agent, wherein the active ingredients contain one or more of the long Bifidobacterium subspecies FB1-1 living cells, cultures thereof, lysates thereof, and extracts thereof as described in claims 1 to 7. For example, cell culture suspensions, cell-free extracts, cell-free supernatants, etc. The fourth aspect of the present invention is to provide a composition, wherein the ingredients contain one or more of the long Bifidobacterium subspecies FB1-1 living cells, cultures thereof, lysates thereof, and extracts thereof as described in claims 1 to 7. For example, cell culture suspensions, cell-free extracts, cell-free supernatants, etc.

[0026] The characteristics and beneficial effects of the present invention are:

[0027] The Bifidobacterium longum subspecies FB1-1 described in the present invention can inhibit the drug resistance function of carbapenemase-resistant bacteria. The strain is isolated from the feces of breastfed infants and is a recognized edible fungus species. The strain has a good inhibitory effect on the growth of carbapenemase-resistant Klebsiella pneumoniae, the expression of drug resistance genes and the horizontal transfer of drug resistance plasmids.

[0028] The Bifidobacterium longum subsp. longum described in the present invention is deposited in the Guangdong Provincial Microbial Culture Collection Center, Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with a deposit number of GDMCC No: 63774 and a deposit date of September 7, 2023. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0030] Figure 1 This is a morphological diagram of Bifidobacterium longum subspecies FB1-1 provided in an embodiment of the present invention.

[0031] Figure 2 The phylogenetic tree of Bifidobacterium longum subspecies FB1-1 provided in the embodiments of the present invention was constructed.

[0032] Figure 3 This is a diagram showing the antibacterial effect of the cell-free supernatant of Bifidobacterium longum subspecies FB1-1 provided in an embodiment of the present invention on CRKP.

[0033] Figure 4 The minimum inhibitory concentration of the cell-free supernatant of Bifidobacterium longum subspecies FB1-1 provided in the embodiment of the present invention for inhibiting the growth of CRKP.

[0034] Figure 5 This is the growth curve of CRKP under the action of the cell-free supernatant of Bifidobacterium longum subspecies FB1-1 provided in the embodiment of the present invention.

[0035] Figure 6 The cell-free supernatant of Bifidobacterium longum subspecies FB1-1 provided in the embodiments of the present invention inhibits the expression of CRKP resistance genes and virulence genes.

[0036] Figure 7 Different concentrations of the cell-free supernatant of Bifidobacterium longum subspecies FB1-1 provided in the embodiments of the present invention affect the growth of the binders.

[0037] Figure 8 The agarose gel electrophoresis diagram provided by the embodiment of the present invention. DETAILED DESCRIPTION

[0038] In order to facilitate understanding of the Bifidobacterium longum subspecies FB1-1 of the present invention, the Bifidobacterium longum subspecies FB1-1 of the present invention will be described in more detail below, and examples of the present invention are given, but the scope of the present invention is not limited thereby.

[0039] Bifidobacterium longum subspecies FB1-1 of the present invention:

[0040] It is deposited in Guangdong Microbiological Culture Collection Center, Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with the deposit number: GDMCC No: 63774 and the deposit date is September 7, 2023.

[0041] The Bifidobacterium longum subspecies FB1-1 has the following biological characteristics:

[0042] Ⅰ) The morphology of the bacteria displayed by scanning electron microscopy includes one or more of the following: rod-shaped, spherical, V-shaped, and Y-shaped;

[0043] Ⅱ) Gram-positive bacteria;

[0044] III) Colony characteristics: the colonies are tiny white, moist, and have neat edges;

[0045] IV) The growth characteristics are anaerobic growth at 36°C-38°C and entering the stable phase after 16h-20h of cultivation.

[0046] The Bifidobacterium longum subspecies FB1-1 has at least one or more of the following applications:

[0047] 1) Prepare food;

[0048] 2) Preparation of drugs for preventing or treating carbapenemase-resistant bacteria;

[0049] 3) preparing cleaning products;

[0050] 4) preparing feed;

[0051] 5) Prepare additives.

[0052] The strain of the present invention is separated from the feces of breast-fed infants and is a recognized edible fungus. Therefore, it is harmless to the human body, has good safety, and has no side effects and metabolic burden. It can be used in the fields of food, medicine, cleaning products, feed, additives, health products, etc. The food includes commercially available foods such as beverages, pasta, dairy products, and milk powder. The cleaning products include medical detergents and daily detergents, such as laundry detergents, soaps, and medical multi-enzyme washing liquids. The feed is animal feed for cattle, sheep, pigs, chickens, etc. Since Klebsiella pneumoniae can spread in animals, the feed prepared by adding Bifidobacterium longum subspecies FB1-1 can improve the disease resistance of animals. The additives are food additives, cleaning product additives, feed additives, etc., which are added to food, cleaning products, feed, etc. to play a certain antibacterial property.

[0053] Specifically, the Bifidobacterium longum subspecies FB1-1 has the effect of inhibiting the drug resistance function of carbapenemase-resistant bacteria.

[0054] Specifically, the carbapenemase-resistant bacteria is drug-resistant Klebsiella pneumoniae.

[0055] Specifically, the drug for preventing or treating drug-resistant Klebsiella pneumoniae includes but is not limited to drugs for preventing or treating pneumonia, drugs for preventing or treating meningitis, drugs for preventing or treating peritonitis, drugs for preventing or treating endophthalmitis, drugs for preventing or treating wound infection, drugs for preventing or treating urinary tract infection, and drugs for preventing or treating sepsis. Klebsiella pneumoniae can escape the normal protective mechanism of the human body. In addition to attacking organs such as the lungs and bladder, it also triggers an inflammatory response. When Klebsiella pneumoniae directly enters the human body, Klebsiella infection usually occurs. Once they enter the body and survive the defense of the immune system, they will affect various organs. The symptoms of the disease usually depend on the location where the infection begins. The signs and symptoms of Klebsiella infection vary with the different sites of infection, such as lung infection, nasal infection, eye infection, blood infection, meningitis, urinary tract infection, wound infection, suppurative liver abscess, etc. The long Bifidobacterium subspecies FB1-1 described in the present invention can inhibit drug-resistant Klebsiella pneumoniae, thereby achieving the prevention or treatment of the above-mentioned diseases.

[0056] Specifically, the Bifidobacterium longum subspecies FB1-1 inhibits drug-resistant Klebsiella pneumoniae by inhibiting the expression of drug-resistant genes and / or virulence genes of drug-resistant Klebsiella pneumoniae.

[0057] Specifically, the drug resistance gene is bla_KPC, and the virulence gene is uge.

[0058] Specifically, the Bifidobacterium longum subspecies FB1-1 has the effect of inhibiting plasmid conjugative transfer.

[0059] Specifically, the minimum inhibitory concentration of the Bifidobacterium longum subspecies FB1-1 is 125 μL / mL.

[0060] Specifically, the drug for preventing or treating carbapenemase-resistant bacteria is an injection or an oral agent.

[0061] Specifically, the pharmaceutical composition for preventing or treating carbapenemase-resistant bacteria contains the Bifidobacterium longum subspecies FB1-1, or a pharmaceutically acceptable salt thereof, or a solvate thereof.

[0062] Specifically, the drug for preventing or treating carbapenemase-resistant bacteria further comprises a pharmaceutically acceptable carrier.

[0063] The following examples illustrate the technical scheme of the present invention from the perspectives of 16S rRNA identification of strains, the effects of the cell-free supernatant of Bifidobacterium longum FB1-1 on the growth of carbapenemase-resistant Klebsiella pneumoniae, the expression of resistance genes and related virulence genes, and the horizontal transfer of resistance plasmids. The specific contents are as follows.

[0064] Example 1: Activation of strains and identification of 16S rRNA of Bifidobacterium longum FB1-1

[0065] 1. Isolation and purification of Bifidobacterium

[0066] The collected infant fecal samples were diluted with sterile saline to a suitable concentration gradient and spread on a solid screening medium. The solid screening culture was then routinely cultured in a 37° ordinary incubator and a strict anaerobic incubator for 24-48 hours until colonies grew. Suspected bifidobacterium colonies were selected and streaked multiple times on their screening medium for purification. After multiple streaking, strains that still had suspected bifidobacterium colony characteristics were selected as target strains, and single colonies were selected for culture in liquid modified MRS liquid medium (MRSC) medium to prepare for subsequent molecular biological identification.

[0067] The preparation of bifidobacterium solid screening culture is as follows: 50 ml of filtered horse serum, 0.05% L-cysteine ​​hydrochloride and 0.05 mg / ml mupirocin are added per liter to the MRS medium, wherein L-cysteine ​​hydrochloride is filtered through a sterile filter membrane for sterilization, and mupirocin is added when the medium is cooled to 40-50° C. after high-pressure sterilization.

[0068] The modified MRS liquid culture medium (MRSC) is prepared as follows: 0.05% (w / v) L-cysteine ​​hydrochloride is added to the semi-synthetic liquid MRS culture medium to obtain the modified MRS liquid culture medium.

[0069] The purified strains of FB1-1 were subjected to physiological and biochemical experiments, such as Figure 1 As shown, the colonies are tiny white, moist, and have neat edges; Gram staining of the bacteria is positive under an optical microscope, and the strains have rod-shaped, V-shaped, and Y-shaped morphologies after primary division or subculture.

[0070] 2. Activation of Bifidobacterium and Preparation of Cell-free Supernatant

[0071] Bifidobacterium longum FB1-1 was inoculated into MRS medium containing 0.5 g / L L-cysteine ​​hydrochloride and cultured under strict anaerobism at 37° for 16-20 h, then the supernatant was collected by centrifugation at 8000 r / min for 5 min, and the supernatant was filtered through a 0.2 μm microporous filter to obtain a cell-free supernatant.

[0072] 3. Identification of strains

[0073] The bacterial solution cultured to the mid-logarithmic phase was centrifuged at 8000rpm for 5 minutes and washed several times with PBS to collect sufficient bacteria. The genomic DNA was extracted using a bacterial DNA extraction kit and the quality of the extracted DNA was tested for genome sequencing and bioinformatics analysis. The raw sequences at both ends obtained by Sanger sequencing were quality controlled to remove low-quality bases. After obtaining the clean sequence, they were spliced ​​to obtain the assembled sequence. The species information of the top 10 species similarity was obtained by blasting with the NT database, and the species with the highest similarity was selected as the result of bacterial identification. The MEGA software was used to select NJ (Neighbor-joining, neighbor method) to construct a phylogenetic tree. According to the analysis results, FB1-1 was confirmed to be Bifidobacterium longum, with a similarity of 99% with the subspecies of Bifidobacterium longum, and was further confirmed to be a subspecies of Bifidobacterium longum. Figure 2 shown.

[0074] Example 2: Determination of antibacterial activity of the cell-free supernatant of Bifidobacterium longum FB1-1 against drug-resistant Klebsiella pneumoniae

[0075] Carbapenemase-resistant Klebsiella pneumoniae (CRKP) BAA-1705 TM Provided by Beina Biotech BAA-1705 TM Inoculate into Luria-Bertani medium and culture at a constant temperature of 37°C and 200 rpm for 12-24 hours to activate it.

[0076] 1. Oxford Cup Test

[0077] First, the OD600 of the drug-resistant Klebsiella pneumoniae liquid was adjusted to 0.1-0.2 using LB broth culture medium, and 200 μL of the bacterial liquid was aspirated and spread on the agar plate. Then, Oxford cups were placed on the agar plate in sequence and the cell-free supernatant of Bifidobacterium longum FB1-1 grown to the logarithmic phase was added to each Oxford cup well. MRSC liquid culture medium was used as a control. After culturing in a 37° constant temperature incubator for 5-8 hours, the diameter of the inhibition zone was measured, and the test was performed in triplicate.

[0078] The antibacterial effect of the cell-free supernatant of Bifidobacterium longum FB1-1 on Klebsiella pneumoniae is shown in the figure Figure 3 As shown, compared with the control group, the experimental group supplemented with the cell-free supernatant of Bifidobacterium longum FB1-1 showed obvious inhibition zone, and the average diameter of the inhibition zone of three groups of parallel determinations was 19.90 mm. Therefore, the cell-free supernatant of Bifidobacterium longum FB1-1 has good antibacterial activity against drug-resistant Klebsiella pneumoniae.

[0079] 2. Minimum inhibitory concentration test

[0080] The minimum inhibitory concentration (MIC) of the cell-free supernatant of Bifidobacterium longum FB1-1 for drug-resistant Klebsiella pneumoniae was determined by broth microdilution method. First, 100 μL LB broth medium was added to all wells of the 96-well plate, and then 100 μL of the cell-free supernatant of Bifidobacterium longum FB1-1 was added to the A1-H1 wells. After mixing it with a pipette, 100 μL was drawn and diluted from A1-A8 in turn, and repeated in B1-H1. 100 μL of undiluted cell-free supernatant of Bifidobacterium longum FB1-1 was added to the A9-H9 wells as a negative control. Then, the OD600 of the drug-resistant Klebsiella pneumoniae liquid grown to the logarithmic phase was adjusted to 0.1-0.2 using LB broth medium, and 100 μL of the liquid was added to the A1-A8 wells in turn, and B1-H1 was carried out in sequence. Finally, 100 μL of bacterial solution was added to wells A10-H10 in sequence as a positive control.

[0081] The experimental results are as follows Figure 4 As shown, when the concentration of the cell-free supernatant of Bifidobacterium longum FB1-1 was 62.5 μL / mL, it had no obvious inhibitory effect on the growth of drug-resistant Klebsiella pneumoniae. Therefore, the minimum inhibitory concentration of the cell-free supernatant of Bifidobacterium longum FB1-1 on drug-resistant Klebsiella pneumoniae was 125 μL / mL.

[0082] 3. Growth Curve Determination

[0083] The cell-free supernatant of Bifidobacterium longum FB1-1 (the supernatant concentration is the minimum inhibitory concentration) was added to the Klebsiella pneumoniae cultured in fresh LB medium for 16 hours and cultured in a constant temperature shaker at 37°. The absorbance of the drug-resistant Klebsiella pneumoniae at OD600 was detected after 0, 8, 12, 14, 16, 20 and 24 hours of culture.

[0084] The experimental results are as follows Figure 5 As shown, the growth of drug-resistant Klebsiella pneumoniae in the experimental group was significantly inhibited compared with the control group without the addition of the cell-free supernatant of Bifidobacterium longum FB1-1 within the first 12 hours of culture. Therefore, the growth of drug-resistant Klebsiella pneumoniae can be significantly inhibited within 12 hours in the presence of the cell-free supernatant of Bifidobacterium longum FB1-1.

[0085] Example 3: Inhibition of the expression of drug-resistant genes and virulence genes of drug-resistant Klebsiella pneumoniae by the cell-free supernatant of Bifidobacterium longum FB1-1

[0086] qPCR technology was used to detect the inhibition of the expression of drug-resistant genes of resistant Klebsiella pneumoniae by the cell-free supernatant of Bifidobacterium longum FB1-1. First, the OD600 of the drug-resistant Klebsiella pneumoniae culture grown to the logarithmic phase was adjusted to 0.1-0.2 using LB broth medium. Then, the cell-free extract CFEs of Bifidobacterium longum FB1-1 was adjusted to MIC and incubated with drug-resistant Klebsiella pneumoniae in a 37°C constant temperature incubator for 18-24 hours, and the control without CFEs was used as a control. Then, the total RNA of the co-culture and control group was extracted using an RNA extraction kit and reverse transcribed. Finally, the relative expression of drug-resistant genes and virulence genes of Klebsiella pneumoniae was determined by reverse transcription quantitative polymerase chain reaction (RT-qPCR).

[0087] The experimental results are as follows Figure 6 As shown, compared with the control group without the addition of Bifidobacterium longum FB1-1 cell-free supernatant, the expression of the drug-resistant Klebsiella pneumoniae resistance gene bla_KPC and its virulence gene uge in the experimental group was significantly inhibited. Therefore, the cell-free supernatant of Bifidobacterium longum FB1-1 has a significant inhibitory effect on the expression of the drug-resistant Klebsiella pneumoniae resistance gene bla_KPC and its virulence gene uge. The primers used for qPCR are shown in Table 1.

[0088] Table 1 List of primers used in qPCR

[0089]

[0090] Example 4: Effect of Bifidobacterium longum FB1-1 cell-free supernatant on plasmid conjugation transfer of drug-resistant Klebsiella pneumoniae

[0091] 1. Conjugative transfer of plasmids

[0092] Meropenem-resistant, rifampicin-intolerant Klebsiella pneumoniae BAA-1705 TMAs the donor strain, Escherichia coli EC600, which is tolerant to rifampicin and intolerant to meropenem, was used as the recipient strain. First, the donor bacteria and the recipient bacteria were inoculated into LB broth medium respectively, and activated and cultured for 14 hours in an environment with a constant temperature of 37°C and a rotation speed of 120rpm. Then, the cell-free supernatant of Bifidobacterium longum FB1-1 was gradiently diluted using LB broth medium to make its final concentrations 0, 31.25, 62.50, and 125 μL / mL, respectively. Subsequently, the activated donor bacteria and the recipient bacteria were inoculated into LB medium containing cell-free supernatant of Bifidobacterium longum FB1-1 with different concentration gradients at a ratio of 4:1, and were statically cultured in a constant temperature incubator at 37°C for 4 hours. After the culture was completed, the combined bacterial solution was diluted at a ratio of 1:100, and then spread on LB solid agar plates containing meropenem and rifampicin antibiotics using a coating rod to screen the conjugates. After the bacterial solution is fully absorbed, place the plate upside down in a 37°C constant temperature incubator for overnight culture for 18-24 hours and observe the colony morphology.

[0093] The experimental results are as follows Figure 7 As shown, the results showed that the cell-free supernatant of Bifidobacterium longum FB1-1 could significantly affect the conjugation and transfer of the plasmid, and the effect on the growth of the conjugates was concentration-dependent, that is, the higher the concentration of the supernatant, the fewer the number of conjugates successfully grown on the double-antibody plate.

[0094] 2. Plasmid extraction, PCR amplification and agarose gel electrophoresis detection

[0095] Plasmid DNA from the conjugated bacterial solution was extracted using a small plasmid extraction kit from Tiangen Biotechnology (Beijing, China). Plasmid bla_KPC DNA was amplified using a PCR kit from Ningbo Baichuan Biotechnology. Primers used for amplification (CGTCTAGTTCTGCTGTCTTG [forward] and CTTGTCATCCTTGTTAGGCG [reverse]) were synthesized by Beijing Qingke Biotechnology. The PCR program included initial denaturation at 94°C for 2 minutes, denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds and extension at 72°C for 30 seconds, and final extension at 72°C for 2 minutes. Finally, the amplified bla_KPC DNA was detected by 1% agarose gel electrophoresis.

[0096] The experimental results are as follows Figure 8 As shown, compared with the negative control E. coli EC600 recipient strain in lane 1, the plasmid conjugate in lane 2 showed a bla_KPC DNA electrophoresis band at 750 bp, indicating that the plasmid DNA was successfully transferred into the recipient strain of E. coli EC600.

[0097] The 16s DNA sequence of Bifidobacterium longum FB1-1 of the present invention is as follows:

[0098]

[0099] It should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Bifidobacterium longum subspecies FB1-1, characterized in that The Bifidobacterium longum subsp. longum is deposited in Guangdong Provincial Microbiological Culture Collection Center with the deposit number: GDMCC No.63774 and the deposit date of September 7, 2023.

2. The Bifidobacterium longum subspecies FB1-1 according to claim 1, characterized in that The Bifidobacterium longum subspecies FB1-1 has at least one or more of the following characteristics: Ⅰ) The morphology of the bacteria displayed by scanning electron microscopy includes one or more of the following: rod-shaped, spherical, V-shaped, and Y-shaped; Ⅱ) Gram-positive bacteria; III) Colony characteristics: the colonies are tiny white, moist, and have neat edges; IV) The growth characteristics are anaerobic growth at 36°C-38°C and entering the stable phase after 16h-20h of cultivation.

3. The Bifidobacterium longum subspecies FB1-1 according to any one of claims 1 to 2 has at least one or more of the following applications: 1) Prepare food; 2) Preparation of drugs for preventing or treating carbapenemase-resistant bacteria; 3) preparing cleaning products; 4) preparing feed; 5) Prepare additives.

4. The use according to claim 3, characterized in that: The Bifidobacterium longum subspecies FB1-1 has the function of inhibiting the drug resistance function of carbapenemase-resistant bacteria.

5. The use according to claim 4, characterized in that: The carbapenemase-resistant bacteria is drug-resistant Klebsiella pneumoniae; The drug for preventing or treating drug-resistant Klebsiella pneumoniae includes but is not limited to a drug for preventing or treating pneumonia, a drug for preventing or treating meningitis, a drug for preventing or treating peritonitis, a drug for preventing or treating endophthalmitis, a drug for preventing or treating wound infection, a drug for preventing or treating urinary tract infection, and a drug for preventing or treating sepsis; The Bifidobacterium longum subspecies FB1-1 inhibits the drug-resistant Klebsiella pneumoniae by inhibiting the expression of drug-resistant genes and / or virulence genes of the drug-resistant Klebsiella pneumoniae; The drug resistance gene is bla_KPC, and the virulence gene is uge.

6. The use according to claim 5, characterized in that: The Bifidobacterium longum subspecies FB1-1 has the function of inhibiting plasmid conjugation transfer.

7. The use according to claim 4, characterized in that: The minimum inhibitory concentration of the Bifidobacterium longum subspecies FB1-1 is 125 μL / mL.

8. The use according to claim 4, characterized in that: The drug for preventing or treating carbapenemase-resistant bacteria is an injection or an oral agent; The pharmaceutical composition for preventing or treating carbapenemase-resistant bacteria contains the Bifidobacterium longum subspecies FB1-1 according to claim 1 to claim 7, or a pharmaceutically acceptable salt thereof, or a solvate thereof; The drug for preventing or treating carbapenemase-resistant bacteria further comprises a pharmaceutically acceptable carrier.

9. A bacterial agent, characterized in that The active ingredients contain one or more of the living cells, cultures, lysates and extracts of Bifidobacterium longum subspecies FB1-1 described in claims 1 to 7.

10. A composition, characterized in that The ingredients contain one or more of the living cells of Bifidobacterium longum subspecies FB1-1, the culture thereof, the lysate thereof, and the extract thereof as described in claims 1 to claim 7.

Images