A novel subunit vaccine antigen delivery vehicle prepared by bacterial morphological change and application thereof

By preparing filamentous BLP particles as a vaccine carrier, the problem of BLP vaccines requiring repeated immunizations was solved, achieving a highly efficient systemic and mucosal immune response with a single oral immunization, improving vaccine stability and duration of immunity, and reducing costs.

CN119685193BActive Publication Date: 2025-11-28NORTHEAST AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411299541.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-18
Publication Date
2025-11-28
Estimated Expiration
2044-09-18

AI Technical Summary

Technical Problem

Existing BLP-based vaccines require repeated immunizations and adjuvants to achieve the desired immune response, and oral administration is ineffective, limiting their widespread deployment and cost-effectiveness.

Method used

Elongated BLP particles (fBLP) were prepared using filamentous lactobacillus F23017. The bacteria were treated by boiling in an acidic solution to form a peptidoglycan layer that did not contain proteins or nucleic acids. The filamentous bacteria were then cultured in combination with cisplatin treatment to form filamentous BLP particles that displayed subunit vaccine antigens, serving as delivery carriers for oral immunization.

Benefits of technology

It achieves 100% protection with a single oral immunization, activates a strong systemic and mucosal immune response, prolongs the duration of immunity, improves vaccine stability and antigen absorption in the gastrointestinal tract, and reduces the number of immunizations and costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119685193B_ABST
    Figure CN119685193B_ABST
Patent Text Reader

Abstract

The application discloses a novel subunit vaccine antigen delivery carrier prepared by utilizing bacterial morphological change and application thereof, and belongs to the technical field of novel subunit vaccine antigen delivery carriers. The purpose of the application is to overcome the obstacles encountered in oral subunit vaccines, develop a new vaccine delivery system, improve oral immunity and reduce the number of immunizations, and achieve the expected immunization effect through single immunization. The application provides a filamentous bacterium, wherein the filamentous bacterium is Lactobacillus brevis F23017, the preservation number is CCTCC M 20241795, and the preservation date is August 16, 2024. The filamentous BLP is a simple, safe, effective and low-cost platform, and can be used for developing an oral administration platform of subunit vaccines.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of novel subunit vaccine antigen delivery vector technology, specifically relating to a novel subunit vaccine antigen delivery vector prepared by bacterial morphological modification and its application. Background Technology

[0002] Vaccination is one of the most effective methods for preventing and controlling serious and potentially fatal infectious diseases. It has revolutionized public health, bringing deadly diseases such as smallpox, polio, and measles to the brink of extinction or complete eradication. However, traditional pathogen vaccines require longer production times, carry a higher risk of reversion to virulence, and require tailored development to combat emerging or rapidly evolving pathogens. Subunit vaccines are a special type that includes active pathogen fragments to trigger a protective immune response. Subunit vaccines offer advantages such as excellent purity, stability, safety, ease of manufacture, and precise induction of immune responses. While highly purified recombinant subunits derived from pathogens are considered safe, they lack immunogenicity because they cannot replicate, participate in various innate immune signaling pathways, or persist. Therefore, adjuvants are needed to enhance immunogenicity and establish durable immunity. Furthermore, the small subunit antigen fragments lack the tertiary structure of proteins, making them susceptible to degradation in vivo. Adding adjuvants or delivery carriers during subunit preparation can prevent antigen degradation and enhance their immunogenic potency.

[0003] Particulate vaccines utilize various methods, including chemisorption, encapsulation, conjugation, or bioassembly, to attach antigens to microcarriers, thereby improving delivery and triggering effective immune responses. Particulate carriers can simultaneously deliver adjuvants and multiple antigens to antigen-presenting cells (APCs). Some particulate carriers can also act as adjuvants, inducing and enhancing immune responses. Bosma et al. introduced a novel technique for displaying lactic acid bacteria surfaces, called bacterial-like particles (BLPs) or Gram-positive enhancer matrices (GEMs). Prepared by boiling lactic acid bacteria in an acidic solution, the peptidoglycan (PGN) layer constituting the BLP contains no proteins or nucleic acids. Acid / heat treatment inactivates the bacteria, improving safety at the maximum administered dose. Due to the ligand properties of PGNs with Toll-like receptor 2 (TLR2), BLPs primarily participate in the innate immune system through TLR2 activation. Therefore, BLPs have been investigated as innovative adjuvants for vaccines against various infectious diseases. Furthermore, by using PGN-binding protein anchors (PAs) derived from the C-terminal region of Lactobacillus AcmA cell wall hydrolase, BLPs can also be used as carriers for binding antigens to their surface. This novel antigen presentation system offers a new strategy for the development of subunit vaccines. To date, BLP has been incorporated into more than 40 bacterial, viral, and parasitic vaccine formulations, providing comprehensive protection against certain pathogens.

[0004] While BLP significantly enhances the immunogenicity of subunit vaccines, its immunomodulatory capacity is limited by the effectiveness of the bacterial strain. Therefore, BLP-based vaccines typically require repeated immunizations and adjuvants to achieve the desired immune response. This need for multiple immunizations is time-consuming, labor-intensive, and costly for widespread vaccine deployment. Furthermore, to date, most studies on BLP-based vaccine delivery systems have focused on intranasal administration, with oral administration yielding unsatisfactory results. Oral administration is currently the gold standard for therapeutic drug delivery due to its convenience, non-invasiveness, and reduced reliance on trained professionals. Moreover, oral vaccination enhances immunity by triggering systemic and mucosal immune responses, preventing mucosal surface infections. As the first line of defense against foreign pathogens, the mucosal epithelium has the largest surface area in the body. Establishing prophylactic immunity at the site of infection can prevent infectious diseases. Therefore, how to position BLP as an oral antigen delivery system to improve oral immunity and reduce the number of immunizations, thereby achieving the desired immune effect with a single immunization, is a question worthy of exploration. Summary of the Invention

[0005] The purpose of this invention is to overcome the obstacles encountered in oral subunit vaccines and develop a new vaccine delivery system that improves oral immunity and reduces the number of immunizations, achieving the desired immune effect with a single immunization.

[0006] This invention provides a filamentous bacterium, namely Lactobacillus brevis F23017, with accession number CCTCC M 20241795 and accession date of August 16, 2024.

[0007] The present invention provides a microbial preparation containing the above-mentioned filamentous bacteria.

[0008] The present invention provides the use of the above-described filamentous bacteria or the above-described microbial preparations in the preparation of filamentous BLP particles or as antigen delivery carriers.

[0009] Further specifying, probiotic lactobacillus was added to MRS medium containing cisplatin and cultured at a concentration of 10-300 μg / ml.

[0010] The present invention provides filamentous BLP particles, wherein the filamentous BLP particles comprise the filamentous bacteria described above or the filamentous bacteria obtained by the above method.

[0011] This invention provides the application of the above-mentioned filamentous BLP particles in displaying subunit vaccine antigens or as an adjuvant for subunit vaccines.

[0012] The present invention provides the use of the above-mentioned filamentous bacteria, the above-mentioned microbial preparation, or the above-mentioned filamentous BLP particles in the preparation of a medicine for preventing or treating diseases caused by pathogenic bacteria.

[0013] The present invention provides a method for preparing the above-mentioned filamentous BLP particles. The specific steps of the preparation method are as follows: collect 5 volumes of the above-mentioned filamentous bacteria, add 1 volume of 10% trichloroacetic acid and boil for 45 minutes, obtain the precipitate, wash it with phosphate buffered saline and resuspend it in PBS to obtain filamentous BLP particles.

[0014] This invention provides a filamentous BLP particle vaccine of Clostridium perfringens type A, which is prepared by displaying the antigen of Clostridium perfringens type A on the surface of filamentous BLP particles; the sequence of the antigen of Clostridium perfringens type A is shown in SEQ ID NO.1.

[0015] This invention provides the use of the above-mentioned filamentous BLP particle vaccine in the preparation of a medicament for the prevention or treatment of diseases caused by Clostridium perfringens type A.

[0016] Beneficial effects: This study aimed to elongate the morphology of BLP vectors, prepare a novel filamentous BLP (fBLP) vector, and evaluate its oral immunogenicity. To this end, 1) the optimal cisplatin concentration and incubation time were determined by measuring the bacterial OD value and microscopic observation, and filamentous Lactobacillus brevis 23017 was successfully cultured with a filamentous proportion greater than 80%; 2) the successful preparation of fBLP was confirmed by transmission electron microscopy, nucleic acid electrophoresis, SDS-PAGE, and NanoDrop microspectrophotometry. Safety was verified both in vitro and in vivo; 3. The model antigen CPMEA successfully bound to the fBLP surface, as shown by SDS-PAGE, WB, and immunofluorescence; 4. Transmission electron microscopy revealed that fBLP remained essentially stable in gastric acid, and increased vaccine uptake in Pell's aggregate lymph nodes (PP) was observed in frozen sections; 5. The prolonged phagocytosis time of fBLP by phagocytes demonstrated the persistent retention of fBLP in vivo; 6. In a mouse model, the fBLP delivery system enhanced the protective effect of a single oral immunization to 100% and induced a strong and balanced systemic immune response and an effective mucosal immune response; 7. Furthermore, we verified that fBLP, as an antigen delivery platform, can effectively prolong the duration of immunity; 8. Transcriptome analysis elucidated the mechanism by which fBLP exerts its immunomodulatory effect; 9. The effectiveness of this oral delivery platform was verified in broiler animal experiments. This study provides a novel, safe, and effective antigen delivery platform for the development of oral subunit vaccines.

[0017] A morphologically elongated BLP was prepared as a novel antigen delivery system. This delivery system exhibited good biocompatibility and successfully loaded antigens. Furthermore, compared to conventional BLP, fBLP remained largely stable in the gastrointestinal tract after oral immunization in mice and increased the uptake of antigens by intestinal protein receptors (PPs), thereby activating the MHC class II antigen presentation pathway and further activating robust systemic and mucosal immunity. In a mouse model, a single oral dose of the fBLP-based vaccine provided 100% protection. In addition, we found that macrophages prolonged the phagocytic time of fBLP in vitro, and in vivo experiments in mice demonstrated that fBLP, as an antigen delivery system, can prolong the duration of immunity. Finally, animal experiments in chickens demonstrated that the fBLP-based Clostridium perfringens multiepitope vaccine effectively prevented necrotizing enteritis in chickens. This study emphasizes that fBLP is a simple, safe, effective, and low-cost platform for the development of oral administration platforms for subunit vaccines.

[0018] [Biological Preservation Information] Lactobacillus brevis F23017, accession number CCTCC M20241795, deposited on August 16, 2024, is deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan. Attached Figure Description

[0019] Figure 1 The results of determining the optimal concentration and incubation time of cisplatin are shown in the following figures: a and b show the changes in bacterial length and OD value of Lactobacillus brevis 23017 after culturing with nine different concentrations of cisplatin (0, 10, 20, 40, 100, 150, 200, 250, 300 μg / ml) for 24 hours; c and d show the changes in bacterial length and OD value after adding Lactobacillus brevis 23017 to MRS medium containing the optimal concentration of cisplatin and culturing for 24, 48, 72, and 96 hours, respectively.

[0020] Figure 2 The figures show the characterization results of fBLP; a) Morphological observation of BLP and fBLP by negative staining transmission electron microscopy, scale bar: 2μm; 5μm; b) Internal structure of BLP and fBLP observed by transmission electron microscopy of ultrathin sections, scale bar: 200nm; 500nm; c) Agarose gel electrophoresis image, M: DL10,000 DNA Marker, 1: Lactobacillus filamentosa 23017 genomic DNA, 2: fBLP genomic DNA; d) SDS-PAGE image, M: protein Marker, 1: Lactobacillus filamentosa 23017 protein, 2: fBLP protein; e) Quantitative results of DNA, RNA and protein in fBLP after hot acid treatment.

[0021] Figure 3Figure 1 shows the safety verification results of fBLP; Figure 2 shows the cell survival rate (%) of IPEC-J2 cells after exposure to fBLP for 6 and 24 hours; Figure 3 shows the weight changes of mice orally administered PBS and fBLP on days 0, 2, 4 and 6; Figure 4 shows representative H&E staining images of major organs of mice orally administered PBS and fBLP on days 0, 2, 4 and 6, scale bar: 100 μm (six mice per group).

[0022] Figure 4 Figure 1 shows the preparation and identification results of the FCOB17 vaccine; Figure 2 shows the synthesis of BLP and fBLP subunit vaccines using the CPMEA pattern antigen; Figure 3 shows the SDS-PAGE image, M: protein marker, 1: fBLP, 2: CPMEA-OACD-fBLP; Figure 4 shows the WB image, M: protein marker, 1: fBLP, 2: CPMEA-OACD-fBLP; Figure 5 shows the immunofluorescence detection of CPMEA-OACD-BLP and CPMEA-OACD-fBLP, scale bar: 10 μm.

[0023] Figure 5 Figure 1 shows the stability and absorption results of fBLP and BLP in SGF; Figure 2 shows the stability results of fBLP and BLP in SGF; Figure 3 shows the absorption results of fBLP and BLP in PPs.

[0024] Figure 6 Fluorescence microscopic images of RAW 264.7 macrophages (DAPI, blue) phagocytizing GFP-PA-BLP and GFP-PA-fBLP after co-incubation for 4 hours and 24 hours, respectively. Scale bar: 100 μm.

[0025] Figure 7 Figure 1 shows the evaluation results of humoral and cellular immunity in mice after oral immunization; Figure 2 shows the changes in mouse body weight, DAI score, and survival rate after challenge; Figures 3 and 4 show the titers of specific IgG and high-affinity specific IgG antibodies in serum; Figures 5 and 6 show the results of specific IgG1 and IgG2a antibodies in mouse serum on day 28 after immunization; Figure 7 shows the levels of immune-related cytokines in the spleen on day 28 after immunization. Before challenge, n=6; after challenge, n=4. *, P≤0.05; **, P≤0.01.

[0026] Figure 8Figure 1 shows the results of evaluating the mucosal immunization effect of orally immunized mice and the pathological observation of the ileum after challenge. Figure 2 shows the titer of specific SIgA antibodies in feces. Figure 3 shows the concentration of total SIgA in intestinal mucus on day 28 after immunization. Figure 4 shows the serum levels of SIgA-related cytokines on day 28 after immunization. Figure 5 shows the pathological changes detected in ileal tissue samples collected on day 28 after immunization (magnification 10×). Before challenge, n=6; after challenge, n=4. *, P≤0.05; **, P≤0.01; ***, P≤0.001.

[0027] Figure 9 The graph shows the results of rapid and sustained immune protection validation; ab shows the changes in body weight of challenged mice 3 and 60 days after immunization; cd shows the DAI scores of challenged mice 3 and 60 days after immunization; ef shows the survival rate of challenged mice 3 and 60 days after immunization; gh shows the titers of specific IgG antibodies in serum and specific SIgA antibodies in feces measured on days 3 and 60 after immunization (n=6; ***, P≤0.001).

[0028] Figure 10 For transcriptome analysis of the duodenum of mice 3 days after vaccination, differentially expressed genes were identified by two criteria: (1) log2 (fold change)|>1; (2) p value<0.05; a is the PCA analysis result; b is the volcano plot analysis result of differentially expressed genes; c is the heatmap of differentially expressed genes;

[0029] Figure 11 Figure 1 shows the results of bioinformatics analysis; a) shows the KEGG and GO enrichment analysis of the identified DEGs; e) shows the close relationships between the proteins encoded by the DEGs; f) shows the identification of Hub genes from the PPI network.

[0030] Figure 12 The results of IgY levels in chicken serum in each group are shown in the figure. Blood samples were collected on day 7 (day 28) after the last immunization and on day 33 before euthanasia for ELISA detection. Asterisks indicate significant differences between groups (**P<0.01).

[0031] Figure 13 The graph shows the changes in body weight in each group before (day 28) and after (day 33) the virus challenge.

[0032] Figure 14 The graph shows the intestinal lesion scores of chickens in each group; the horizontal bar represents the average lesion score of each group, and the asterisk indicates that the difference between the groups is significant (*P<0.05; ***P<0.001; ****P<0.0001). Detailed Implementation

[0033] Cisplatin (cisdichlorodiammineplatinum) was purchased from Aladdin Biochemical Technology Co., Ltd. (Shanghai, China).

[0034] MRS broth was purchased from Solarium Technology Co., Ltd. (Beijing, China).

[0035] Trichloroacetic acid was purchased from Zhiyuan Chemical Reagent Co., Ltd. (Tianjin, China).

[0036] Clostridium perfringens type A (C57-8) was obtained from the China Veterinary Drug Administration, and IPEC-J2 (porcine small intestinal epithelial cells) was donated by Professor Wei Zhanyong of Henan Agricultural University;

[0037] The strain Lactobacillus brevis 23017 is described in the article Ren Hongkun. Construction of a novel bacterial particle surface display platform and its application in displaying multi-epitope antigens [D]. Heilongjiang: Northeast Agricultural University, 2023.

[0038] Female Kunming mice, aged 4 to 6 weeks, were purchased from Liaoning Changsheng Biotechnology Co., Ltd. Mice were housed under controlled environmental conditions (25±1℃ and 65% humidity) with food and water provided after a 12-hour light / dark cycle. After acclimatization to the laboratory environment for one week, the mice were randomly assigned to groups.

[0039] Eighty one-day-old broilers were purchased from Liaodian Hongyan Breeding Plantation in Acheng District, Harbin City. Upon arrival, the broilers were weighed individually and randomly assigned to cages. They were fed an antibiotic-free basal diet from 0 to 22 days.

[0040] Example 1. Obtaining filamentous bacteria

[0041] I. Culture of filamentous bacteria

[0042] Single colonies of *Lactobacillus brevis* 23017 were immersed in 5 ml of MRS medium and cultured overnight at 37°C in a shaker. Subsequently, they were added to cisplatin-supplemented MRS medium at a ratio of 1 / 100 (1 ml of bacterial culture added to 100 ml of medium). The optimal cisplatin concentration and culture time were investigated. Eight cisplatin concentrations (10, 20, 40, 100, 150, 200, 250, and 300 μg / ml) were used to culture the bacteria, and the culture time was monitored at 24, 48, 72, and 96 hours. The proportion of filamentous bacteria was observed under a microscope, and the optical density (OD) value was measured to determine the bacterial growth status, thus identifying the optimal cisplatin concentration and culture time.

[0043] Result: As Figure 1As shown in Figure a, eight different concentrations of cisplatin (10, 20, 40, 100, 150, 200, 250, 300 μg / ml) were selected to culture *Lactobacillus brevis* for 23017 hours. Microscopic observation was performed to observe the characteristic changes in the proportion of filamentous bacteria with cisplatin concentration. Simultaneously, the changes in bacterial OD values ​​were measured. The results showed that with increasing cisplatin concentration, the bacterial OD value gradually decreased. Figure 1 (b) From this, the cisplatin concentration that has a proportion of filamentous bacteria of more than 80% under a microscope, a relatively high OD value, and can meet the needs of subsequent vaccine vector preparation is selected as the optimal cisplatin concentration, which is 200 μg / ml.

[0044] To determine the optimal culture time, *Lactobacillus brevis* were cultured in MRS medium containing the optimal cisplatin concentration for 23017 to 24 hours, 48 ​​hours, 72 hours, and 96 hours, respectively. The optimal culture time was finally selected by measuring OD values ​​and microscopic observation. Figure 1 (c) and (d) in the figure, the changes in OD value and bacterial length of Lactobacillus brevis 23017 were observed after culturing in MRS medium containing 200 μg / ml cisplatin for 24, 48, 72, and 96 hours. 48 hours was ultimately selected as the optimal culture time, at which point the bacterial OD value was higher and the proportion of filamentous bacteria was larger.

[0045] The filamentous bacteria obtained under the optimal cisplatin concentration and culture time of 200 μg / ml cisplatin for 48 h were named Lactobacillus brevis F23017, with accession number CCTCC M 20241795, accession date August 16, 2024, and deposited at the China Center for Type Culture Collection.

[0046] II. Preparation and Characterization of Filamentous Bacterial-like Particles (fBLP)

[0047] Filamentous bacteria (obtained in step one, cultured with MRS containing 200 μg / ml cisplatin for 48 h using Lactobacillus brevis 23017) were collected from 100 mL of freshly prepared overnight culture and washed with sterile distilled water to obtain a bacterial precipitate. The precipitate was then resuspended in 20 mL of 10% trichloroacetic acid and boiled for 45 minutes to obtain a precipitate. The precipitate was then washed three times with 20 mL of sterile phosphate-buffered saline (PBS), and finally resuspended in 10 mL of PBS. The precipitate was then stored at -80°C to obtain filamentous bacterial-like particles (fBLP).

[0048] Morphological changes in fBLP were detected by transmission electron microscopy (TEM). Bacterial genomic DNA was extracted using a DNA isolation kit according to the manufacturer's protocol (Takara BioInc., Dalian, China). Total RNA was extracted using TRIzol reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Subsequently, the extracted DNA samples were electrophoresed on a 1% agarose gel. In addition, the samples were sonicated for 30 min to release proteins, and protein content was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Finally, the DNA, RNA, and protein content were analyzed using a NanoDrop microspectrophotometer.

[0049] Results: Negative staining transmission electron microscopy showed that fBLP accounted for more than 80% of the total, and its length was 10-20 times that of conventional BLP. Figure 2 (a) To verify whether fBLP was successfully prepared, ultrathin section transmission electron microscopy showed that the internal structure of fBLP was hollow. Figure 2 (b) Subsequently, to demonstrate that fBLP does not contain any nucleic acid or protein components that could potentially endanger biosafety, agarose gel electrophoresis showed that, compared to *Lactobacillus filamentosa* 23017, fBLP contained no DNA bands. Figure 2 (c) Furthermore, SDS-PAGE showed that the protein bands in fBLP had disappeared ( Figure 2 (d) NanoDrop micro-spectrophotometry indicates that fBLP contains negligible amounts of DNA, RNA, and protein. Figure 2 (e in the text)

[0050] III. Toxicity Testing

[0051] 1. In vitro cytotoxicity assay

[0052] The in vitro cytotoxicity of fBLP was tested in IPEC-J2 cells. IPEC-J2 cells were seeded in 96-well plates (Thermo Fisher Scientific, China) with 5000 cells / well added to DMEM medium. Next, the culture was mixed with a concentration of 1×10⁻⁶ cells / well. 9 2×10 9 3×10 9 and 4×10 9Incubate with 100 μL of fBLP solution (CFU / mL) for 6 hours and 24 hours. Cells treated with DMEM but without fBLP serve as control wells. Wells containing both DMEM and fBLP (cell-free) serve as blank wells. Then, add 10 μL of CCK8 solution and incubate at 37°C for another 30 minutes. Record the OD450 value of the cultures. Cell viability (%) = (sample wells - blank wells) / (control wells - blank wells) × 100%.

[0053] 2. In vivo toxicity assessment

[0054] Female Kunming mice (4-6 weeks old) were divided into two groups of 6 mice each. On days 0, 2, 4, and 6, mice were orally administered PBS and 1×10⁻⁶ ppm of PBS, respectively. 8 CFU fBLP. Mouse weight was monitored daily. On day 10, the mice were euthanized, and their major organs were collected for H&E staining and histopathological evaluation at Wuhan Saiwei Biotechnology Co., Ltd.

[0055] Results: fBLP exhibited high safety. The cytotoxicity of fBLP in IPEC-J2 cells was assessed using the CCK8 assay. Figure 3 As shown in a, IPEC-J2 cells were treated with different concentrations of fBLP (1×10⁻⁶). 9 2×10 9 3×10 9 and 4×10 9 After incubation in fBLP (CFU / mL) for 6 hours and 24 hours respectively, cell viability exceeded 90%, indicating that the cytotoxic effect of fBLP was negligible.

[0056] Furthermore, in mouse models, there were no significant differences in body weight and pathological sections of major organs between fBLP-treated mice and healthy mice. Figure 3 (b, c) All these results indicate that fBLP does not cause any adverse side effects.

[0057] Example 2. Preparation and Identification of an Antigen Display System Based on fBLP

[0058] 1. Expression of the fusion protein CPMEA-OACD to promote the binding of CPMEA protein to the surface of fBLP (CPMEA is an epitope of a key antigen of Clostridium perfringens type A; OACD is a novel anchoring protein that can link the model antigen CPMEA to the surface of BLP). The recombinant CPMEA protein refers to CPMEA-OACD. The CPMEA antigen is a multi-epitope antigen of Clostridium perfringens (CPMEA sequence), and OACD is an anchoring protein that assists CPMEA in binding to the surface of fBLP.

[0059] The recombinant plasmid obtained by ligating pet24a to the CPMEA-OACD sequence was transformed into *E. coli* Rosetta, and positive clones were selected for recombinant protein expression. Positive clones were amplified and cultured overnight at 37°C with shaking at 180 rpm in 5 ml of LB broth containing kanamycin. Subsequently, they were inoculated at a 1:100 ratio into 100 ml of LB broth containing kanamycin and cultured further. When the OD600 value reached 0.6, the bacteria were induced with IPTG at 22°C with shaking at 180 rpm for 13 h. After centrifugation, the induced bacteria were resuspended in 20 ml of PBS and sonicated in ice water at 200 W for 20 min. The supernatant obtained after sonication and centrifugation of the expressed bacteria contained soluble protein.

[0060] FCOB17: Add 4 ml of the prepared fBLP to 20 ml of CPMEA-OACD sonication supernatant for inducing soluble expression, and then gently shake at 37°C for 30 minutes. Wash the sample three times with PBS, resuspend in PBS, and then name it FCOB17. Store at -80°C for subsequent use.

[0061] CPMEA-OACD sequence: SEQ ID NO.1

[0062] CATATGACCATCTCTTACGAACAGCCGGACAAAAAAACCATCCAGCGGTAAAGACGACAAAAAAAAC

[0063] GGTGACAAAAACTTCACCGACGACCGTGACAAAAAAGGTGAAAAAGACGCTGGTACCAAAAAAACT

[0064] GAAAGACGAAAACCTGAAAATCGACGACAAAAAAATCTCTGGTAACTCTACCAAAAAAGAAATCCG

[0065] TCGTGACGGTAAAAAAGAATGCAAACAGCGTAACTACAACACCATGAAAAACAAAAAAAACGACA

[0066] AAAAAGTTACCCTGGCTTGCACCGAATGCAAACAGCGTAACTACAACACCATGAAAAAAGAACAGC

[0067] GTGAAAACGACGACGTTGTTATGGACAACGGTATCAAAATCAAAAAAATGCTGGACAACTCTGACA

[0068] AAGACGCTATCCGTATCAAAGCTTGCTCTAAAAAAGACGCTACCCTGGAATACAAAAACACCATCCT

[0069] GGGTAAAAAATTCAAAATCGCTGCTTACTACTCTATCGGTGGTAACATCTCTGTTGCTGCTTACAACG

[0070] AATTCATGTTCAAAATCAACTGGGCTGCTTACACCATCTCTTACGAACAGCCGGACTTCGCTGCTTAC

[0071] ATCCAGCGTAAAGACGACGCTAACCTGGCTGCTTACAACCTGGCTTCTTGGGACATCAAATTCGCTG

[0072] CTTACAAACTGAAAGACGAAAACCTGAAAATCGCTGCTTACGCTTACATCTCTACCTCTGGTGAAAA

[0073] AGCTGCTTACTCTAAAGACACCTACACCTTCAAACTGGCTGCTTACTACCTGAACGACCTGGCTATG

[0074] AACTACGCTGCTTACATGATGCCGCTGTTCTTCGAATCTAAAGCTGCTTACGAAGTTAACGCTCTGCA

[0075] GCCGACCCTGGCTGCTTACGAACGTCAGTTCCGTGAACGTGACTTCGCTGCTTACCACGAACTGGGT

[0076] CACAACTTCGACACCGCTGCTTACCACCTGGCTCAGCTGGCTCCGCTGTGGGCTGCTTACGTTGCTG

[0077] CTTCTGACGCTATGGAACTGGCTGCTTACGCTATGGAACTGGACCTGACCGAATTCGGTCCGGGTCC

[0078] GGGTATCGGTGGTAACATCTCTGTTGAAGGTAAAACCGCTGGTACCGGTATCGGTCCGGGTCCGGGT

[0079] GCTTCTTGGGACATCAAATTCGTTGAAACCAAAGACGGTTACAACGGTCCGGGTCCGGGTTCTGAAT

[0080] ACAACGAATTCATGTTCAAAATCAACTGGCAGGACCACGGTCCGGGTCCGGGTGACTACATGTACTT

[0081] CGGTATCAAAACCAAAGACGGTAAAACCCAGGGTCCGGGTCCGGGTTTCGAATCTAAATACAAAAC

[0082] CAAAACCCGTATCACCGACCAGAACATCTGGGGTCCGGGTCCGGGTCCGAAAGTTGGTCTGGACGA

[0083] CTACTCTAACAACGAACTGTACAACGGTCCGGGTCCGGGTCTGTGGCAGCTGTACCTGTACGACAAC

[0084] ACCTTCTACGGTAAATTCGGTCCGGGTCCGGGTAAAGGTGACGGTTTCACCGACAACGCTAAAGTTT

[0085] CTGTTTCTACCTCTGGTCCGGGTCCGGGTCTGCAGCCGACCCTGTCTGTTAACCCGGTTATCACCCTG

[0086] GCTCTGGGTGAAGCTGCTGCTAAATCTGAAGACGGTAACAACTTCCGTAAAAAAAAATGGGACGAC

[0087] TCTGGTTCTCTGAAAACCCTGAAATTCAACTCTAAAAAATCTGAAGCTGACCGTGACTACAAAGAAA

[0088] ACGCTGTTGACGGTGACGAAAACACCAAAAAACCGCGTCAGAACTCTCGTAACGGTCACAAAAAA

[0089] CGTCAGGACGCTCTGAACGGTTCTATCTCTAAATACGAAGAATTCGTCGACGGTGGTGGTTCTCCGG

[0090] ACAACGGCATGCTGAGCCTGGGTGTTTCCTACCGTTTCGGTCAGGGCGAAGCAGCTCCAGTAGTTGC

[0091] TCCGGCTCCAGCTCCGGCACCGGAAGTACAGACCAAGCACTTCACTCTGAAGTCTGACGTTCTGTTC

[0092] AACTTCAACAAAGCAACCCTGAAACCGGAAGGTCAGGCTGCTCTGGATCAGCTGTACAGCCAGCTG

[0093] AGCAACCTGGATCCGAAAGACGGTTCCGTAGTTGTTCTGGGTTACACCGACCGCATCGGTTCTGACG

[0094] CTTACAACCAGGGTCTGTCCGAGCGCCGTGCTCAGTCTGTTGTTGATTACCTGATCTCCAAAGGTATC

[0095] CCGGCAGACAAGATCTCCGCACGTGGTATGGGCGAATCCAACCCGGTTACTGGCAACACCTGTGACAACGTGAAACAGCGTGCTGCACTGATCGACTGCCTGGCTCTCGAG;

[0096] A normal-form BLP vaccine without elongation is called COB17: The preparation method of BLP is the same as fBLP. Add 4 ml of the prepared BLP to 20 ml of CPMEA-OACD sonicated supernatant for inducing soluble expression, and then slowly shake at 37°C for 30 min. Wash the sample three times with PBS and resuspend it in PBS, i.e., COB17.

[0097] Expression of the fusion protein GFP-PA bound to the fBLP surface (GFP-PA-fBLP): The soluble expression method of GFP-PA is the same as that of CPMEA-OACD. 4 ml of the prepared fBLP was added to 20 ml of GFP-PA sonicated supernatant for inducing soluble expression, and then slowly shaken at 37°C for 30 min. The sample was washed three times with PBS and resuspended in PBS, thus obtaining GFP-PA-fBLP.

[0098] Expression of the fusion protein GFP-PA bound to the surface of BLP (GFP-PA-BLP): 4 ml of the prepared BLP was added to 20 ml of GFP-PA sonicated supernatant for inducing soluble expression, and then the mixture was slowly shaken at 37°C for 30 min. The sample was washed three times with PBS and resuspended in PBS, i.e., GFP-PA-fBLP. The GFP-PA sequence is shown in SEQ ID NO.2.

[0099] To determine the binding of the antigen and fBLP, the fBLP of CPMEA was demonstrated by SDS-PAGE, WB, and immunofluorescence.

[0100] Results: The production process of fBLP-based subunit vaccines is as follows: Figure 4 As shown in Figure a, the CCMEA antigen is displayed at high density on the fBLP surface. SDS-PAGE and WB analyses were performed to confirm the successful preparation of FCOB17. Compared to the fBLP control, CCMEA-OACD (85 kDa) successfully bound to fBLP to form FCOB17 (…). Figure 4 (b) Meanwhile, bright green fluorescence was detected on the surface of fBLP by immunofluorescence assay. Figure 4 (c) These results indicate that the CPMEA antigen can successfully bind to fBLP, thus enabling the successful preparation of FCOB17. 2. Verification of the stability of fBLP in gastric acid.

[0101] To verify the stability of fBLP and BLP in gastric acid, we used TEM imaging (Hitachi, Japan) to visualize the morphological changes of fBLP and BLP after 3 hours of exposure to simulated gastric juice (SGF). fBLP and BLP were resuspended in 1 ml of SGF (simulated gastric juice) and incubated at 37°C for 3 hours. Subsequently, they were washed three times with deionized water, resuspended in PBS, and observed using TEM.

[0102] Results: fBLP remained stable in gastric acid. Transmission electron microscopy was used to study the stability of fBLP and BLP in SGF and to explore the morphological changes of fBLP and BLP after exposure to digestive tract solutions. Figure 5(a) The results showed that after 3 hours of incubation in SGF, some BLPs exhibited external structural damage, bacterial fragmentation, and content leakage. In contrast, fBLPs showed less morphological damage and largely maintained their original shape. This indicates that fBLPs can remain relatively stable in gastric juices in the digestive tract and successfully reach the intestines.

[0103] 3. Absorption of fBLP and BLP by intestinal PPs after oral immunization

[0104] Resuspend the GFP-PA-fBLP and GFP-PA-BLP solutions in PBS (1×10⁻⁶). 9 CFU / ml). Each mouse (n=3) was orally administered 1×10⁻⁶ CFU / ml. 8 CFU GFP-PA-fBLP and GFP-PA-BLP were administered. Mice were euthanized 24 hours after administration. Excised PPs were fixed in 4% paraformaldehyde (PFA) for 1 hour, then transferred to 20% sucrose solution for 1 hour. The fixed tissue was then embedded in OCT cryoembedding medium provided by the manufacturer (Servicebio, China) and rapidly frozen using liquid nitrogen. The frozen tissue was cut into 6 mm thick sections, then stained with Hoechst staining solution for nuclear staining (Solarbio, China), and images were observed using a fluorescence microscope (Leica, China).

[0105] Results: fBLP was absorbed more in PPs. To clarify the absorption of fBLP in PPs after oral administration, recombinant green fluorescent protein GFP-PA was bound to the surface of fBLP and BLP. Frozen sections of mouse PPs 24 hours after oral administration of GFP-PA-fBLP and GFP-PA-BLP were analyzed by fluorescence microscopy. Figure 5 (b) In the figure, compared with the GFP-PA-BLP group, the GFP-PA-fBLP group showed more green fluorescence in the PPs, indicating that they were absorbed more. Therefore, the results show that fBLP, as an antigen delivery platform, can more effectively target PPs and increase the absorption of antigens by PPs.

[0106] 4. Macrophage phagocytosis model

[0107] RAW264.7 macrophages were spaced at a density of 1 × 10⁶ cells per well. 6 Cells were seeded in six-well plates and treated with a concentration of 5 × 10⁻⁶ cells per well. 7 CFU / well of GFP-PA-fBLP and GFP-PA-BLP were incubated for 4 hours and 24 hours, respectively. Afterwards, nuclear staining was performed using Hoechst staining solution, and the localization of macrophages and vaccine vectors was observed using a fluorescence microscope (Shanghai BM Optical Instruments Manufacturing Co., Ltd., China).

[0108] Results: BLP prolonged macrophage phagocytosis time: To clarify whether fBLP could present antigens more effectively, we bound recombinant green fluorescent protein GFP-PA to the surfaces of fBLP and BLP. They were then co-incubated with macrophages, followed by nuclear staining and fluorescence microscopy examination. Figure 6 The results showed that after 4 hours of co-incubation, macrophages exhibited a higher uptake rate of GFP-PA-BLP than GFP-PA-fBLP, while after 24 hours of co-incubation, the uptake rate of GFP-PA-fBLP was even higher. Due to the differences in size and shape between fBLP and BLP, the latter is more easily degraded intracellularly, ultimately resulting in less fluorescence emitted by macrophages at a relatively long timeframe (24 hours). In contrast, fBLP is less readily absorbed by macrophages, leading to prolonged uptake and high retention by macrophages over 24 hours.

[0109] Example 3. Mouse animal experiment

[0110] Grouping, immunization, and challenge of laboratory animals:

[0111] Mice were randomly divided into three groups: (1) control group; (2) COB17 group; and (3) FCOB17 group. Each of the COB17 and FCOB17 groups consisted of 21 mice.

[0112] (1) Control group: 12 mice in total. Each mouse was orally administered 200 μL PBS on day 0. Six mice were normally fed until 28 days after immunization and then euthanized; six mice were normally fed until 60 days after immunization.

[0113] (2) Infection group: 18 mice in total. Each mouse was orally administered 200 μL PBS on day 0. On days 3, 21, and 60, 6 mice were randomly selected to be intraperitoneally injected with 2 × 10⁻⁶ PBS. 8 Clostridium perfringens CFU.

[0114] (3) COB17 group: 21 mice in total. Each mouse was orally administered 200 μL of COB17 containing 50 μg of CPMEA antigen on day 0. Three days after oral immunization, 3 mice were randomly selected for euthanasia, and duodenal samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for transcriptome sequencing; 6 mice were randomly selected for intraperitoneal injection of 2 × 10 8 Clostridium perfringens CFU. Six mice were randomly selected and injected intraperitoneally with 2×10⁻⁶ CFU at 21 and 60 days post-oral immunization. 8 CFU (clostridium perfringens)

[0115] (4) FCOB17 group: 21 mice in total. Each mouse was orally administered 200 μL of FCOB17 containing 50 μg of CPMEA antigen on day 0. Three days after oral immunization, three mice were randomly selected for euthanasia, and duodenal samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for transcriptome sequencing; six mice were randomly selected for intraperitoneal injection of 2 × 10 8 Clostridium perfringens CFU. Six mice were randomly selected and injected intraperitoneally with 2×10⁻⁶ CFU at 21 and 60 days post-oral immunization. 8 CFU (clostridium perfringens)

[0116] Changes in body weight, clinical symptoms, and survival rate were observed and recorded over the next seven days following oral immunization on days 3, 21, and 60. Furthermore, mice challenged on day 21 of oral immunization were euthanized seven days later. Serum, feces, spleen, ileum tissue, and jejunal mucus samples were collected for further investigation.

[0117] Serum and stool samples were collected on days 3, 7, 14, 21, 28, and 60 after vaccination to track antibody response.

[0118] ELISA detection of antibodies:

[0119] Following the methods outlined in previous studies, approximately 3 mg / ml of purified recombinant CPMEA protein was used as the antigen and coated overnight at 4°C. After three washes, the plates were blocked with 5% skim milk at 37°C for 2 hours. Subsequently, diluted serum samples were added and incubated for 1.5 hours. After washing, peroxidase-conjugated anti-mouse IgG antibody (Beyotime Biotechnology Co., Ltd., Shanghai), HRP anti-mouse IgG1 antibody (AIBOTEK Biotechnology Co., Ltd., Wuhan), HRP anti-mouse IgG2a antibody (AIBOTEK Biotechnology Co., Ltd., Wuhan), and peroxidase-conjugated anti-mouse IgA antibody (ImmunoWay Biotechnology Company) were added and incubated for 1 hour. The plates were then washed finally, treated with TMB solution for 30 minutes, and the reaction was terminated by adding 2M H2SO4. The optical density (OD) was then measured at 450 nm. Furthermore, the amount of total intestinal mucus SIgA was determined using an ELISA kit obtained from Shanghai Sangon Biotech Co., Ltd.

[0120] ELISA was used to measure high-affinity antibody responses, following a previously established protocol. After incubation with the primary antibody-diluted serum sample, urea (4 mM) was added, and the plate was incubated at room temperature for 30 minutes to eliminate low-affinity antibodies bound to the antigen. The remaining ELISA steps followed the procedure described earlier.

[0121] Measurement of SIgA-related cytokines:

[0122] According to the manufacturer's instructions, TGF-β and IL-5 levels in serum samples on day 28 post-immunization were assessed using a commercially available ELISA kit (Boster Bioengineering Co., Ltd., Wuhan).

[0123] Real-time quantitative PCR:

[0124] The expression of IL-4, IL-6, IL-10, IL-12, IL-1β, TNF-α, and IFN-γ in spleen tissue samples on day 28 post-immunization was detected using real-time quantitative PCR (RT-qPCR). The RT-qPCR kit was purchased from EnzyArtisan Technology Co., Ltd. (Shanghai) and used according to established methods. PCR conditions included pre-denaturation at 95℃ for 30 seconds, followed by cycles of 95℃ for 10 seconds, 60℃ for 15 seconds, and 72℃ for 30 seconds, for 39 cycles. Normalization was performed using the housekeeping gene β-actin, and the expression was analyzed using a 2... -△△Ct Technical calculations of relative mRNA levels.

[0125] Pathological and histological examination:

[0126] Ileal tissue samples from control, infected, and vaccine mice were stored in 10% paraformaldehyde at room temperature. Pathological sections were prepared and analyzed by Wuhan Saiwei Biotechnology Co., Ltd. (Wuhan, China).

[0127] Transcriptome analysis:

[0128] To ensure data integrity, we used MD5 validation software to verify the original data. Subsequently, we performed KEGG enrichment analysis, GO enrichment analysis, and differential expression analysis. We used the Cytoscape and STRING databases to analyze and construct a protein-protein interaction (PPI) network. Based on P < 0.05 and |log2(FC)| > 1, differentially expressed genes (DEGs) were identified.

[0129] Results: (1) fBLP, as an antigen delivery platform, achieved 100% single-dose oral immunization protection in mouse models: To verify whether fBLP, as an antigen delivery platform, could improve the oral immunization effect of antigens, we conducted in vivo experiments with oral immunization in mice. Figure 7As shown in Figure ac, mice in both the COB17 and FCOB17 groups initially showed weight loss on days 0–2 post-challenge with *Clostridium perfringens*, followed by weight recovery on days 3–7. Notably, the FCOB17 group exhibited a significantly faster weight recovery compared to the COB17 group. The DAI scores of both the COB17 and FCOB17 groups initially increased on days 0–1 post-challenge, then decreased from days 2–7, with the FCOB17 group showing a lower DAI score than the COB17 group. Furthermore, 70% of the mice vaccinated with COB17 survived, compared to 100% in the FCOB17 group. Therefore, FCOB17 demonstrates a superior oral immunization efficacy.

[0130] Furthermore, to determine whether fBLP induces a stronger systemic immune response, we assessed the concentrations of antigen-specific IgG antibodies in serum on days 7, 14, 21, and 28 post-immunization. Figure 7 As shown in d and e, on days 7, 14, 21, and 28 post-vaccination, the levels of IgG and high-affinity IgG in both the COB17 and FCOB17 groups steadily increased, with the FCOB17 group exhibiting the highest levels of both. Furthermore, on day 28 post-immunization, the levels of IgG1 and IgG2a in mice immunized in the FCOB17 group were significantly higher than those in the COB17 group. Figure 7 (f and h in the figure; P<0.05). Based on these conclusions, fBLP as an antigen delivery vector induces a stronger specific antibody response.

[0131] In addition, RT-qPCR was used to assess the mRNA expression of IL-4, IL-6, IL-10, IL-12, IL-1β, TNF-α, and IFN-γ in the spleen to examine changes in systemic immune-related cytokines. Figure 7 In the study, compared with conventional BLP, the fBLP-based vaccine significantly enhanced the production of IL-4, IL-6, IL-10, IL-1β, TNF-α, and IFN-γ in spleen cells. However, there was no significant difference in IL-12 concentration between the fBLP group and the BLP group.

[0132] In addition, specific SIgA levels in feces were assessed on days 7, 14, 21, and 28 post-vaccination, as well as total SIgA antibody levels in intestinal mucus and serum SIgA-related cytokine levels on day 28 to assess mucosal immune response. Specific SIgA levels in feces were elevated in both the COB17 and FCOB17 groups, with the FCOB17 group consistently showing the highest levels on days 7, 14, 21, and 28 post-immunization. Figure 8 a) in the example. Figure 8As shown in b and c, the total SIgA level in the mouse intestinal mucosa on day 28 post-inoculation was consistent with the above results, with the FCOB17 group showing the highest total SIgA level, significantly exceeding that of the COB17 group (P<0.01). Compared with the control group, the levels of IL-5 and TGF-β were increased in both the COB17 and FCOB17 groups, and the expression of TGF-β and IL-5 in the FCOB17 group was significantly higher than that in the COB17 group (P<0.05; P<0.01). These findings indicate that fBLP, as an antigen delivery carrier, stimulates a stronger mucosal immune response.

[0133] Histopathological analysis revealed that the intestinal villi of mice in the FCOB17 and COB17 groups remained relatively intact, and the connective tissue of the lamina propria and submucosa showed only a small amount of inflammatory cell infiltration. Figure 8 In d), there was no significant change compared to the control group.

[0134] (2) fBLP, as an antigen delivery platform, prolonged the duration of immunity in mice: To verify whether fBLP, as an antigen delivery system, could induce rapid protection, mice were challenged 3 days after oral immunization, and serum and feces were collected before challenge. Figure 9 As shown in a, 3 days after immunization, mice in the infection group and COB17 group gradually lost weight until death, while the FCOB17 group experienced a continuous decrease in weight from day 0 to day 3. Surviving mice gradually gained weight from day 3 to day 7. Furthermore, we found that the clinical scores of mice in the FCOB17 group were lower than those in the infection group and COB17 group. Figure 9 (c) All mice in the COB17 group died when challenged 3 days after immunization, while only one mouse survived in the FCOB17 group. This indicates that neither vaccine produced rapid immune protection. Figure 9 (e). In addition, we measured serum levels of antigen-specific IgG and fecal levels of antigen-specific SIgA three days post-immunization. Figure 9 As shown in g and h, the COB17 group mice had low levels of IgG and SIgA, with almost no antibody production, and the FCOB17 group mice also had low antibody levels. These results indicate that although fBLP as an antigen delivery platform failed to effectively induce rapid immune protection, its immunostimulatory effect was still superior to BLP 3 days after administration.

[0135] To demonstrate whether fBLP, as an antigen delivery system, can induce long-term protection, mice were challenged 60 days after oral immunization, and serum and feces were collected before challenge. Figure 9As shown in b, the infected mice gradually lost weight until death, while the surviving mice in the COB17 and FCOB17 groups lost weight from day 0 to 2 and gradually gained weight from day 3 to 7. Notably, the FCOB17 group mice experienced less weight loss compared to the COB17 group. This indicates that FCOB17 has a role in delaying weight loss in mice 60 days post-immunization. Furthermore, we found that the clinical scores of the FCOB17 group mice were lower than those of the infected and COB17 groups. Figure 9 (d) indicates that FCOB17 has a more significant protective effect in mice. Furthermore, at 60 days post-immunization, one mouse in the COB17 group survived, while four mice in the FCOB17 group survived, resulting in a survival rate of 66.7% (4 / 6). Figure 9 (f) In addition, the COB17 group mice had lower levels of IgG and SIgA, but the FCOB17 group mice had significantly higher levels of IgG and SIgA than the COB17 group (P<0.001); Figure 9 (g, h). These findings suggest that oral administration of FCOB17 prolongs the duration of antigen-specific immunity and produces long-term immune protection.

[0136] (3) Transcriptome analysis showed that the MHC class II antigen presentation pathway was activated: To verify the mechanism of FCOB17 in enhancing immunity, three mice were randomly selected three days after immunization for duodenal transcriptome analysis. Figure 10 As shown, PCA analysis revealed good separation between the COB17 and FCOB17 groups. Furthermore, volcano plot analysis showed 355 upregulated genes and 61 downregulated genes among the differentially expressed genes (DEGs). The differential clustering heatmap also illustrated the upregulation and downregulation of gene expression between the two groups.

[0137] To investigate the regulatory function of FCOB17, we performed KEGG and GO enrichment analyses. The KEGG pathway, as shown in the figure... Figure 11 As shown in a. Among these pathways, we found significant enrichment in the intestinal immune network, B cell receptor signaling pathway, T cell receptor signaling pathway, and NF-κB signaling pathway, which are involved in IgA generation. Furthermore, the top 10 significantly enriched cellular components (CC) in the GO analysis were associated with MHC class II antigen presentation. Figure 11 In b), the top 10 significantly enriched molecular functions (MFs) are mostly related to the activation of immune receptors, cytokines and cytokine receptors, chemokines and chemokine receptors. Figure 11 In c), the top 10 significantly enriched biological processes (BP) were associated with the proliferation and differentiation of lymphocytes and monocytes. Figure 11 (d)

[0138] To further elucidate the key genes in DEGs, a PPI network was generated using the STRING database, demonstrating the close relationships between the proteins encoded by these genes. Figure 11 (e). Furthermore, using Cytoscape software, we identified Cd4 and Cd19 as focal genes acting as connection hubs (e). Figure 11 (f) CD4 is a T cell surface glycoprotein that primarily acts as a co-receptor for MHC class II molecules. CD19 is a co-receptor for the B cell antigen receptor complex (BCR) on B lymphocytes, triggering a B cell response to antigens. Antigenic peptides bind to MHC class II molecules, forming MHC II antigen peptide complexes. These complexes are then distributed on the cell surface and subsequently recognized by the TCR, leading to the release of CD4. + T cell activation. CD4 + T cell activation further initiates the activation of B cells and effector T cells, ultimately inducing robust humoral and cellular immunity.

[0139] Example 4. Chicken animal experiment

[0140] Grouping, immunization, and challenge of laboratory animals:

[0141] The experiment was divided into 4 groups, with 20 animals in each group. These included a control group, an infection group, a COB17 group (orally administered 0.5 ml of COB17 containing 50 μg of CPMEA recombinant protein antigen), and an FCOB17 group (orally administered 0.5 ml of FCOB17 containing 50 μg of CPMEA recombinant protein antigen).

[0142] Immunization: On day 7, broilers in the COB17 and FCOB17 groups were orally immunized with 0.5 ml of COB17 and FCOB17 containing 50 μg of antigen, respectively. A second oral immunization was administered on day 21. The chickens were fasted from water and food for 4 hours before oral immunization and fed 30 minutes after immunization.

[0143] Challenge: After 23 days, switch to a high-protein diet containing 40% fishmeal protein (as a susceptibility condition for Clostridium perfringens). On day 28, administer gavage twice daily, once in the morning and once in the afternoon. Chickens were fasted for 12 hours before the first challenge. Administer gavage twice daily, with 1×10 ml of the solution per ml. 8 CFU (clostridium perfringens) C57-8 was administered for 5 consecutive days. Chickens were challenged with feed by mixing overnight Clostridium culture with a high-protein diet containing 40% fishmeal at a ratio of 1:10 v / w. The feed was freshly prepared each morning and afternoon for 5 consecutive days. Feed trays were cleaned and leftover food discarded before each feeding. Chickens were euthanized the day after challenge.

[0144] Broilers were weighed before challenge and euthanasia. Serum was collected for ELISA testing 7 days after the last immunization, before euthanasia. Small intestines were collected after euthanasia for visual inspection.

[0145] lesion score:

[0146] After euthanasia, autopsy of the small intestine (duodenum to ileum) was performed. The severity of necrosis was assessed using a visual examination scale of 0-5 as described in the article by Kulkarni et al. The scoring was as follows: 0, no obvious lesions; 1, visible thinning, fragility, and breakage of the intestinal wall; 2, focal necrosis with a small amount of gas in the intestinal lumen; 3, numerous necrotic foci or punctate hemorrhages on the intestinal wall with significant gas filling the intestinal lumen; 4, severe and widespread necrosis with significant hemorrhage on the intestinal wall and a large amount of gas filling the intestinal lumen; 5, severe and frequent necrosis and death during the experiment.

[0147] Antibody testing:

[0148] The content of IgY in chicken serum was assessed using an indirect ELISA method. Following the method outlined in previous studies, purified CPMEA recombinant protein diluted with antigen coating buffer was added to each well of a 96-well plate (100 μL) and incubated overnight at 4°C. Then, 5% skim milk was added for blocking at 37°C for 2 h. Serum from immunized and control chickens was added, serially diluted with 5% skim milk, and incubated at 37°C for 1 h. Next, enzyme-labeled goat anti-chicken IgY (1:2000 dilution) was added, and incubation was continued at 37°C for 1 h. A TMB chromogenic reaction was initiated, followed by termination of the reaction with 2M H₂SO₄. The absorbance at 450 nm was measured using a microplate reader.

[0149] Statistical analysis

[0150] Statistical analysis was performed using GraphPad Prism 8.0.1 software. Experimental results are expressed as standard deviation ± mean. One-way or two-way ANOVA was used to assess the significance of differences between groups. Statistical significance was defined at four levels: *P<0.05, **P<0.01, ***P<0.001, and ****P<0.001.

[0151] Results: The fBLP-based Clostridium perfringens multi-epitope vaccine effectively prevented necrotizing enteritis in broilers. To verify the effect of FCOB17 in inducing antibody production in chickens, the level of anti-CPMEA IgY in chicken serum was detected by indirect ELISA. Figure 12 It was found that the serum anti-CPMEA antibody levels in chickens orally immunized with FCOB17 were significantly higher than those in the COB17 group on day 7 (day 28) after the last immunization and before euthanasia (day 33) (P<0.01), indicating that FCOB17 activated a more effective immune response.

[0152] The protective effect of FCOB17 against Clostridium perfringens infection in chickens was evaluated based on changes in body weight during challenge experiments. Figure 13 The results showed that after 5 days of gavage challenge, the infected chickens gained approximately 21.4% more body weight, while COB17 and FCOB17 increased their weight by approximately 40.6% and 50.3%, respectively. This indicates that the vaccine group played a role in delaying weight loss caused by challenge in mice, with the FCOB17 group showing the best effect.

[0153] The protective effect of FCOB 17 against Clostridium perfringens infection in chickens was evaluated based on small intestinal damage observed during necropsy. Figure 14 It was found that the infected chickens developed severe and frequent lesions. In contrast, oral administration of COB 17 (P<0.001) and FCOB17 (P<0.0001) had significant protective effects against Clostridium perfringens challenge, with a significant reduction in lesion scores. Furthermore, the FCOB17 group showed better results than the COB17 group (P<0.05).

[0154] Elongated Lactobacillus brevis 23017 can be formulated into filamentous BLPs. Studies have shown that bacteria can exhibit interesting morphological changes under environmental stress. During this period, their division ceases, but they continue to grow, resulting in an elongated appearance. BLPs are produced by heating and treating Lactococcus lactis under acidic conditions. They lack cytoplasmic proteins and DNA but still possess bacterial adjuvant properties. As carriers of vaccine antigens, BLPs can effectively bind antigens and display them on surfaces. These particles act as adjuvants by activating the innate immune system through interaction with Toll-like receptors. In this study, we successfully prepared fBLPs with a filamentous structure and observed their internal hollow structure using transmission electron microscopy. The absence of nucleic acids and proteins in fBLPs was confirmed by nucleic acid electrophoresis, SDS-PAGE, and NanoDrop microspectrophotometry. The successful binding of antigens and fBLPs was verified by SDS-PAGE, Western blotting, and immunofluorescence analysis. Furthermore, safety is always a top priority when creating new adjuvants and vaccines. BLPs have shown a high level of safety and represent a promising new antigen delivery platform. In this study, we demonstrated that fBLP contains no nucleic acid or protein components. IPEC-J2 cell viability was unaffected after 6 and 24 hours of incubation with fBLP. Furthermore, mice orally administered fBLP showed no significant differences in body weight or histopathological sections of major organs compared to healthy mice. These results indicate that morphologically elongated Lactobacillus brevis 23017 can be prepared as a novel BLP displaying antigens on its surface, and that fBLP exhibits satisfactory biological safety.

[0155] fBLP, as an antigen delivery platform, induces 100% protection through a single oral immunization. The search for a safe and effective oral delivery platform for subunit vaccines, addressing the need for multiple immunizations, has been a major focus. Poor patient compliance, the requirements for large-scale vaccination, and safety concerns (eliminating the risk of infection associated with reused needles) can be addressed through oral vaccination. In addition to inducing systemic IgG secretion, oral vaccination can generate local mucosal immunity (SIgA) at typical sites of viral and bacterial entry (such as the intestinal mucosa). This will prevent viral and bacterial infection. Currently, many subunit vaccines still require multiple doses to produce an optimal immune response. Multiple immunizations are both time-consuming and costly. In this study, using fBLP as a carrier to load antigens, followed by a single oral immunization of mice, the survival rate was 100% when challenged with Clostridium perfringens 21 days later. This demonstrates the great potential of fBLP in developing oral delivery systems for subunit vaccines.

[0156] fBLP, as an antigen delivery platform, can induce a longer duration of immunity. In vaccine development, besides efficacy, the persistence of induced immunity is a current focus. Compared to BLP, macrophages prolonged the phagocytic time of fBLP. We examined challenge protection, weight change, and clinical scores 60 days post-immunization, and the results all indicated that FCOB17 had better immunoprotective effects. Subsequently, we measured serum-specific IgG and fecal-specific SIgA levels, showing that even 60 days post-immunization, mice in the FCOB17 group maintained high antibody levels. Therefore, we conclude that fBLP further induces more durable and effective immunity by prolonging macrophage phagocytosis and increasing its retention time in vivo.

[0157] Increased fBLP absorption in PPs. During oral vaccination, the antigen crosses the gastrointestinal tract, one of the main lymphoid tissues in the tract, composed of well-tissued immune cells, typically containing B-cell-rich follicles shielded by a reticular structure similar to that produced by T cells, called the interfollicular region (IFR). M cells in the PP tissue transfer the immunogen to antigen-presenting cells after the vaccine reaches the small intestine. Dendritic cells then absorb and digest these substances, presenting antigen fragments on their surface to stimulate helper T (Th) cells, which in turn stimulate B cells and T cells. Sensitized B and T cells reach the mucosa via the bloodstream. B cells are stimulated by T cells and cytokines to produce IgA, promoting local mucosal immunity. In this study, the morphology of fBLP remained largely stable 3 hours after SGF treatment, indicating that it effectively resisted the adverse environment in the stomach and successfully reached the intestine. Furthermore, compared to BLP, we observed increased fBLP absorption in frozen sections of PP. This suggests that fBLP is absorbed more efficiently by PP, further inducing robust systemic and local mucosal immunity.

[0158] fBLP, as an antigen delivery platform, induced a robust and balanced systemic immune response. Host defense mechanisms were guided by the expression of IgG subsets, which reflected CD4+ expression. + The activity of Th cells (Th1 and Th2) was assessed. IgG1 is associated with antibody-driven Th2 immune responses, with Th2 cells primarily mediating humoral immunity. IgG2a represents Th1 immune responses, with Th1 cells primarily mediating cellular immunity. Results showed that the FCOB17 group had higher levels of specific IgG and high-affinity IgG than the COB17 group. Furthermore, the FCOB17 group exhibited elevated levels of IgG1 antibodies and cytokines IL-4, IL-6, and IL-10, which are associated with humoral immunity activation. Similarly, higher levels of cellular immunity-related IgG2a antibodies and cytokines IL-12, IL-1β, TNF-α, and IFN-γ were observed in the FCOB17 group. Therefore, the results indicate that fBLP-induced humoral and cellular immune responses are superior to those induced by conventional BLP.

[0159] fBLP, as an antigen delivery platform, induced a stronger mucosal immune response. Results showed that the titer of specific SIgA antibodies in feces gradually increased after immunization, reaching its highest level in the FCOB17 group. Similarly, 28 days post-immunization, the total SIgA in the intestinal mucus of the FCOB17 group was higher than that of the COB17 group. Furthermore, we evaluated serum mucosal immunity-related cytokines IL-5 and TGF-β. These cytokines stimulate SIgA synthesis and local mucosal immunity by acting on B cells at the mucosal surface. After vaccination, the levels of mucosal immunity-related cytokines in FCOB17 were higher than those in COB17. The results of mucosal antibody and cytokine detection indicate that fBLP, as an antigen delivery carrier, induced a stronger mucosal immune response.

[0160] Transcriptome analysis further validated the above experimental results. First, the top-ranked KEGG-enriched pathway was the "intestinal immune network producing IgA," indicating activation of mucosal immunity. Furthermore, the top 10 significantly enriched CC terms in GO analysis were associated with MHC class II antigen presentation, including phagocytic cuvettes and lysosomal activation. We screened the hub gene using Cytoscape software and identified it as CD4. CD4 is mainly expressed in Th cells, binds to the non-peptide regions of MHC class II molecules, and participates in the signal transduction of Th cell TCR antigen recognition, further suggesting activation of MHC class II antigen presentation. We believe this is due to increased uptake of fBLP by PP, which promotes macrophage phagocytosis, thereby activating this pathway. In addition, most of the top 10 significantly enriched MF terms were associated with the activation of cytokines and chemokines, indicating that fBLP triggers a stronger pro-inflammatory effect and enhances the immune response, consistent with previous studies. Finally, we found that the top 10 significantly enriched BP terms were associated with the proliferation of B cells and T cells, indicating the activation of humoral and cellular immunity, which corresponds to the results of previous in vivo experiments.

[0161] Therefore, we believe that increased uptake of fBLP by PP promotes macrophage phagocytosis, leading to enhanced phagosome and lysosomal activity and activation of the MHC II antigen presentation pathway. Subsequently, the binding of antigen peptides to MHC class II complexes further activates CD4. + Helper T cells subsequently activate B cells and effector T cells, triggering robust humoral and cellular immunity. Furthermore, with the help of cytokines such as IL-5 and TGF-β, B cells proliferate and develop into mature plasma cells, secreting polymerized immunoglobulin A (plgA). PlgA is transported across the membrane via epithelial cells to the mucosal surface, ultimately forming SlgA and activating mucosal immunity. Moreover, the filamentous morphology of fBLP leads to prolonged macrophage phagocytosis, further extending the duration of immunity.

[0162] Creating scalable and efficient production platforms for the large-scale production of functional vaccines is a significant challenge. BLPs are an effective delivery technology due to their numerous advantages, including ease of manufacture, excellent safety, stability, high loading capacity, and high mucosal delivery efficiency. Therefore, further refinement of this strategy may be able to address upcoming challenges. In this study, we prepared morphologically elongated fBLPs for the first time and demonstrated that these elongated fBLPs outperformed conventional BLPs. In mouse models, a single oral immunization induced 100% protection and prolonged the duration of immunity. Animal experiments in chickens demonstrated that the fBLP-based Clostridium perfringens multiepitope vaccine effectively prevented necrotizing enteritis in chickens. The design of this oral delivery platform provides a new and more efficient method for subunit vaccine oral administration systems. In future research, we will attempt to further analyze the mechanisms by which fBLP induces long-term immune protection.

Claims

1. A filamentous bacterium, characterized in that, The filamentous bacteria are Lactobacillus brevis ( Lactobacillus brevis F23017, accession number CCTCC M 20241795, accession date August 16, 2024.

2. A microbial preparation comprising the filamentous bacteria of claim 1.

3. Use of the filamentous bacteria of claim 1 or the microbial preparation of claim 2 in the manufacture of filamentous BLP particles or in the manufacture of an antigen delivery vehicle.

4. A filamentous BLP particle characterized in that, The filamentous BLP particles comprise the filamentous bacteria of claim 1.

5. Use of the filamentous BLP particles of claim 4 in the display of subunit vaccine antigens or in the manufacture of adjuvants for subunit vaccines.

6. Use of the filamentous bacteria of claim 1, the microbial preparation of claim 2 or the filamentous BLP particles of claim 4 in the manufacture of a medicament for the prevention of necrotic enteritis in infected chickens.

7. The method of claim 4, wherein the filamentous BLP particles are prepared by, The specific steps of the preparation method are as follows: 5 volumes of the filamentous bacteria of claim 1 are collected, added to 1 volume of 10% trichloroacetic acid and boiled for 45 minutes, the precipitate is washed with phosphate buffered saline and resuspended in PBS to obtain the filamentous BLP particles.

8. A filamentous BLP particle vaccine of Clostridium perfringens type A, characterized in that, The antigen of Clostridium perfringens type A is displayed on the surface of the filamentous BLP particles of claim 4 to obtain; the sequence of the antigen of Clostridium perfringens type A is shown in SEQ ID NO.

1.

9. Use of the filamentous BLP particle vaccine of claim 8 in the manufacture of a medicament for the prevention of diseases caused by infection with Clostridium perfringens type A.

Citation Information

Patent Citations

  • Chinese sucker artificial breeding method

    CN103734051A

  • Recombinant living subunit vaccine composition and process for its preparation

    WO1994016681A1