A serum-free adipogenic differentiation method of porcine fat precursor cells
By using serum-free adipogenic induction and maintenance differentiation media and specific cell culture cofactors to replace serum components, the problems of low differentiation efficiency and poor reproducibility of mammalian adipocyte precursor cells have been solved, enabling the efficient industrialization of cell-cultured meat.
Patent Information
- Application Number
- CN202510109524.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-23
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2045-01-23
AI Technical Summary
Existing technologies have low efficiency and poor reproducibility in the adipogenic differentiation of mammalian adipocyte precursor cells, which hinders the industrialization of cell-cultured meat. Furthermore, the use of serum raises safety, ethical, and cost concerns.
Serum-free adipogenic induction and maintenance differentiation media, containing specific concentrations of cell culture cofactors such as insulin, biotin, pantothenic acid, dexamethasone, IBMX, rosiglitazone, sodium oleate, and transferrin, were used to replace serum components in traditional culture media for the differentiation of porcine adipocyte precursor cells.
It achieves highly efficient serum-free adipogenic differentiation, with a cell differentiation efficiency of over 80%. The chemical composition is clearly defined, which facilitates industrialization and solves the safety and ethical issues associated with serum.
Smart Images

Figure CN119685251B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of mammalian cell differentiation, and particularly relates to a serum-free adipogenic induction and differentiation method of porcine fat precursor cells. BACKGROUND
[0002] Cell-cultured meat is a new product similar to traditional animal meat, which is produced by extracting muscle and fat stem cells from livestock and poultry, proliferating the stem cells and differentiating them into muscle or fat in a bioreactor, and then collecting and processing the cells. Fat provides tenderness and juiciness to meat, affecting the texture and taste of meat. In cell-cultured meat, fat cells are differentiated from fat stem cells, and the fat content and composition in cell-cultured meat can be more precisely controlled compared to traditional meat.
[0003] Fat cell differentiation is a complex process that involves the transformation of undifferentiated fat precursor cells (adipose stem cells) into mature fat cells rich in lipid droplets. This process is crucial for normal adipose tissue development and function. Fat cell differentiation is a multi-step process that includes cell proliferation, exit from the cell cycle, lipid droplet formation, and lipid droplet maturation. Fat cell differentiation is regulated by various factors, including transcription factors, hormones, nutrients, and others.
[0004] Serum is often added to cell culture medium to provide nutrients required for cell growth and proliferation. However, there are some potential hazards associated with the use of serum. Serum is derived from animal blood, and there are significant differences between different batches of serum, which can lead to variability in cell culture results and affect reproducibility. Serum can contain microbial, viral, and mycoplasma contamination, which can harm cells and cause culture failure or have adverse effects on the safety of cell cultured meat. Serum contains growth inhibitory factors that can inhibit cell proliferation and hinder the efficiency of cell culture. The heterologous proteins in serum can trigger an immune response and activate immune receptors in cells. The acquisition of serum usually involves the collection and slaughter of animals, which affects animal welfare and raises ethical concerns. In addition, serum is expensive, which is not conducive to reducing the cost of cell cultured meat. To solve the above problems caused by serum, a serum-free adipogenic differentiation method is a feasible means, such as the patent application file with publication number CN117721074A discloses a serum-free adipogenic induction method for poultry, which avoids the use of fetal bovine serum in poultry fat precursor cells with a specific formula. However, there are essential differences between poultry and mammalian fat precursor cells in adipogenic differentiation. From the perspective of fat synthesis pathways in mammals and poultry, mammals mainly synthesize triglycerides (fat) in adipose tissue, while poultry mainly synthesize triglycerides in the liver. The main fat synthesis pathway for mammalian adipocytes is de novo lipogenesis, which involves the conversion of glucose to fatty acids and triglycerides, requiring the participation of multiple enzymes and coenzymes, especially high levels of fatty acid synthase. In contrast, the fat synthesis pathway in avian adipocytes is mainly lipid regeneration, which involves the re-esterification of free fatty acids into triglycerides and storage in adipocytes. In terms of induction steps, the adipogenic differentiation process of poultry fat precursor cells usually takes about 6 days in a single culture medium, while the adipogenic differentiation process of mammalian fat precursor cells uses different culture media at different stages for induction and differentiation, such as the patent application file with publication number CN117625527A discloses a porcine precursor adipocyte induction and differentiation process, which takes a total of 8 days, including three stages of culture: the first two days in an adipogenic differentiation medium, the next two days in a maintenance differentiation medium, and the last four days in a complete medium. It can be seen that the adipogenic differentiation processes of poultry and mammalian fat precursor cells are difficult to learn from each other. Although there are serum-free induction methods for adipogenic differentiation of poultry fat precursor cells, it is still unknown whether the adipogenic differentiation process of mammalian fat precursor cells can be successfully carried out in a serum-free medium.
[0005] Therefore, there is an urgent need to develop a serum-free adipogenic induction and differentiation method for mammalian fat precursor cells with clear chemical composition, low cost, and high differentiation efficiency, to solve the problem of low differentiation efficiency and poor reproducibility that hinders the industrialization process of mammalian cell cultured meat. SUMMARY
[0006] In order to solve the above problems in the prior art, the application provides a serum-free adipogenic differentiation method for porcine fat precursor cells, which provides a new idea for solving the problem that the low differentiation efficiency and poor repeatability of the adipogenic differentiation technology for mammalian fat precursor cells hinder the industrialization process of mammalian cell cultivation meat.
[0007] The technical scheme adopted by the application is as follows:
[0008] A serum-free adipogenic differentiation method for porcine fat precursor cells, wherein serum-free adipogenic induction differentiation medium and serum-free adipogenic maintenance differentiation medium are used in the adipogenic differentiation process of the porcine fat precursor cells, the serum-free adipogenic induction differentiation medium is composed of a basic medium and cell culture auxiliary factors, and the cell culture auxiliary factors are composed of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 0.25 mmol / L IBMX, 1 μmol / L rosiglitazone, 150 μmol / L sodium oleate and 10 μg / mL transferrin; the serum-free adipogenic maintenance differentiation medium is composed of a basic medium and cell culture auxiliary factors, and the cell culture auxiliary factors are composed of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 150 μmol / L sodium oleate and 10 μg / mL transferrin.
[0009] The application aims to provide an improved cell adipogenic induction / maintenance differentiation medium with clear chemical components for the in-vitro adipogenic differentiation of fat precursor cells, wherein the improved cell adipogenic induction / maintenance differentiation medium does not contain serum components. The serum-free means that no animal serum components, including fetal bovine serum, calf serum, chicken serum, duck serum and horse serum, are added. The improved cell adipogenic induction / maintenance differentiation medium is a fat precursor cell differentiation medium to which cell culture auxiliary factors are added, so as to replace the adipogenic inducers and serum components in the traditional fat precursor cell adipogenic induction / maintenance differentiation medium. The basic medium contains penicillin-streptomycin double-antibiotic solution.
[0010] Preferably, the basic medium is one of DMEM, DMEM / F12 medium containing penicillin-streptomycin double-antibiotic solution.
[0011] Further, the serum-free adipogenic differentiation method for porcine fat precursor cells comprises the following steps:
[0012] (1) take pig fat precursor cells and proliferate in vitro culture, grow to 100% confluence, continue to culture for 2d, discard the proliferation culture medium, add serum-free adipogenic induction differentiation culture medium, the day when the serum-free adipogenic induction differentiation culture medium is added is recorded as 0d, change the liquid every 1d, culture for 4d;
[0013] (2) remove the serum-free adipogenic induction differentiation culture medium, add serum-free adipogenic maintenance differentiation culture medium, continue to differentiate for 4d, change the liquid every 1d.
[0014] Further, the preparation process of the pig fat precursor cells is:
[0015] (1) take pig neck subcutaneous fat, cut into minced meat, add 1-3mg / mL collagenase solution, transfer to a tissue dissociation tube, use a tissue dissociator to dissociate and then place in a 37℃ water bath, digest for 60-90min, dissociate using the tissue dissociator every 15-20min; then add an equal volume of high-sugar DMEM containing 10% fetal bovine serum to terminate digestion, filter with a 70-150μm cell sieve, wherein the volume ratio of the minced meat to the collagenase solution is 1:5;
[0016] (2) centrifuge the digestion solution at a speed of 800-1500rpm at room temperature for 5-10min, discard the supernatant and retain the cell precipitate;
[0017] (3) add 3-5 times the volume of red blood cell lysis solution to the cell precipitate for resuspension, lyse at room temperature for 5-10min, then centrifuge, discard the supernatant and retain the cell precipitate;
[0018] (4) resuspend the cell precipitate using high-sugar DMEM containing 20% FBS, then inoculate into a cell culture dish, use high-sugar DMEM containing 10% FBS as the complete culture medium after subculture.
[0019] A serum-free adipogenic induction differentiation culture medium for pig fat precursor cells, the serum-free adipogenic induction differentiation culture medium is composed of a basic culture medium and cell culture auxiliary factors, the cell culture auxiliary factors are composed of 66nmol / L insulin, 33μmol / L biotin, 17μmol / L pantothenic acid, 0.1μmol / L dexamethasone, 0.25mmol / L IBMX, 1μmol / L rosiglitazone, 150μmol / L sodium oleate, and 10μg / mL transferrin.
[0020] A serum-free adipogenic maintenance and differentiation culture medium for porcine fat precursor cells, which is composed of a basic culture medium and cell culture auxiliary factors, and the cell culture auxiliary factors are composed of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 150 μmol / L sodium oleate and 10 μg / mL transferrin.
[0021] In summary, compared with the prior art, the present application has the following advantages and beneficial effects:
[0022] 1. The serum-free adipogenic induction / maintenance and differentiation culture medium for porcine fat precursor cells has good adipogenic differentiation effect, and after 8 days of in-vitro induction and differentiation of fat precursor cells by using the improved cell adipogenic induction / maintenance and differentiation culture medium, almost all the cells have lipid droplets, and the cell differentiation efficiency is more than 80%.
[0023] 2. The present application provides a serum-free adipogenic differentiation culture medium and induction method suitable for porcine fat precursor cells, which has important significance for the research on the mechanism of fat development of pigs and even mammals and the preparation of meat production.
[0024] 3. The serum-free adipogenic induction / maintenance and differentiation culture medium for porcine fat precursor cells does not contain any serum components, and the chemical components are clear, which is convenient for promoting the industrialization process of cell culture meat. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 It is a micrograph of the prepared porcine fat precursor cells in Example 1;
[0026] Figure 2 It is a micrograph of the porcine fat precursor cells after 8 days of serum-free adipogenic differentiation in Example 2;
[0027] Figure 3 It is an oil red O staining micrograph of the porcine fat precursor cells after 8 days of serum-free adipogenic differentiation in Example 2;
[0028] Figure 4 It is a statistical diagram of triglyceride content of the porcine fat precursor cells after 0, 2, 4, 6 and 8 days of serum-free adipogenic differentiation in Example 2;
[0029] Figure 5 It is a statistical diagram of fluorescence quantitative PCR results of the porcine fat precursor cells after 0, 2, 4, 6 and 8 days of serum-free adipogenic differentiation in Example 2;
[0030] Figure 6 It is a Western blot result diagram of the porcine fat precursor cells after 0, 2, 4, 6 and 8 days of serum-free adipogenic differentiation in Example 2. DETAILED DESCRIPTION
[0031] The present application will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present application will be more clearly presented thereby. It should be understood by those skilled in the art that these specific embodiments and examples are used to illustrate the present application, not to limit the present application.
[0032] Throughout the specification, unless otherwise specifically indicated, the terms used herein are to be understood as having the meanings commonly used in the art. Thus, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. If there is a conflict between the present specification and the prior art, the present specification takes precedence.
[0033] Unless otherwise specifically indicated, various materials, reagents, instruments and equipment used in the present application can be purchased on the market or can be prepared by existing methods.
[0034] The present application will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present application will be more clearly presented thereby. It should be understood by those skilled in the art that these specific embodiments and examples are used to illustrate the present application, not to limit the present application.
[0035] Example 1
[0036] This example explores the isolation and culture of porcine fat precursor cells, and the specific operation is as follows:
[0037] (1) Obtain the subcutaneous fat of the neck of a pig, cut into minced meat, add 1-3 mg / mL collagenase solution, transfer to a tissue dissociation tube, and use a tissue dissociator to dissociate and then place in a 37°C water bath for 60-90 min, dissociate every 15-20 min; then add an equal volume of high-sugar DMEM containing 10% fetal bovine serum to terminate digestion, and filter with a 70-150 μm cell sieve, wherein the volume ratio of minced meat to collagenase solution is 1:5;
[0038] (2) Centrifuge the digestion solution at a speed of 800-1500 rpm at room temperature for 5-10 min, discard the supernatant, and retain the cell pellet;
[0039] (3) Add 3-5 times the volume of red blood cell lysis solution to the cell pellet to resuspend, lyse at room temperature for 5-10 min, then centrifuge, discard the supernatant, and retain the cell pellet;
[0040] (4) Resuspend the cell pellet with high-sugar DMEM containing 20% FBS, then inoculate into a cell culture dish, and after subculture, use high-sugar DMEM containing 10% FBS as the complete culture medium.
[0041] The results observed under a microscope are shown in Figure 1 Figure 1 It can be seen that the above steps obtain irregular long shuttle-shaped porcine fat precursor cells.
[0042] Example 2
[0043] This example investigates the differentiation culture process of porcine fat precursor cells and the detection of related processes, and the specific operation of the culture process is as follows:
[0044] After the cell confluence reaches 100%, continue to proliferate and culture for 2d, remove the proliferation culture medium, add the porcine fat precursor cell serum-free adipogenic induction and differentiation culture medium, and the day when the induction and differentiation culture medium is added is recorded as 0d, the liquid is changed every 1d, and the induction and differentiation is performed for 4d, and then the maintenance differentiation culture medium is replaced, the liquid is changed every 1d, and the maintenance differentiation is performed for 4d. The induction and differentiation culture medium is composed of a basic culture medium and cell culture auxiliary factors, the basic culture medium is DMEM culture medium, and the cell culture auxiliary factors are composed of 66nmol / L insulin, 33μmol / L biotin, 17μmol / L pantothenic acid, 0.1μmol / L dexamethasone, 0.25mmol / L IBMX, 1μmol / L rosiglitazone, 150μmol / L sodium oleate, and 10μg / mL transferrin. The maintenance differentiation culture medium is composed of a basic culture medium and cell culture auxiliary factors, the basic culture medium is DMEM culture medium, and the cell culture auxiliary factors are composed of 66nmol / L insulin, 33μmol / L biotin, 17μmol / L pantothenic acid, 0.1μmol / L dexamethasone, 150μmol / L sodium oleate, and 10μg / mL transferrin.
[0045] The microscopic observation results are shown in Figure 2 Figure 2 It can be found that the porcine fat cells differentiated for 8d are filled with spherical lipid droplets, indicating that the results of adipogenic differentiation are relatively ideal, and the cell differentiation efficiency reaches more than 80%.
[0046] In order to further verify the differentiation effect of the porcine fat precursor cells in this example, the following steps are also detected:
[0047] (1) This step uses oil red O staining method to indicate the differentiation effect, and the specific operation is as follows:
[0048] After 8d of differentiation, the maintenance differentiation culture medium is removed, and PBS is washed once; 4% PFA is added for cell fixation for 30min. The fixing solution is removed, and the staining washing solution is immersed for 30s. The washing solution is removed, and the oil red O staining solution is added for staining for 15-20min. The oil red O staining solution is discarded, and PBS is added for washing 1-3 times; microscopic observation and photography are performed.
[0049] The microscopic observation results are shown in Figure 3 Figure 3 The lipid droplets in the cells differentiated for 8d were found to be dyed red, further proving that the effect of adipogenic differentiation was good.
[0050] (2) The content of triglyceride in different periods of porcine fat precursor cell differentiation was explored, and the specific operation was as follows:
[0051] The porcine fat cells differentiated for 0, 2, 4, 6 and 8d were collected, and the content of TAG was determined using the Cell Triglyceride (TAG) Assay Kit, and the statistical results were as shown in Figure 4 The content of TAG in the cells gradually increased with the increase of differentiation time, indicating that the fat cells gradually matured.
[0052] (3) The gene expression amount in different periods of porcine fat precursor cell differentiation was explored, and the specific operation was as follows:
[0053] The porcine fat cells differentiated for 0, 2, 4, 6 and 8d were collected, RNA was extracted using the Promega RNA Extraction Kit, reverse transcription was performed using the Nearshore Protein Reverse Transcription Kit, and the expression of differentiation-related genes was detected using the SYBR Fluorescence Quantitative Kit of abclonal.
[0054] The total reverse transcription system was 20μL, 2×NovoScript plus 1st Strand cDNA Synthesis SuperMix 10μL, RNA template 0.5μg, gDNA Purge 1μL, and the volume was made up to 20μL with RNA-free ddH2O, and then mixed and homogenized by blowing. The reaction program was 50℃ for 15min and 85℃ for 5s. The cDNA was stored at -20℃. The primers were designed using the pickprimer online website of NCBI webpage, and the specific primer information was shown in Table 1, and 18S was used as the internal reference gene. The cDNA stock solution was diluted 10 times and used for qPCR. The qPCR reaction was performed using the SYBR Fluorescence Quantitative Kit of abclonal company. The reaction system was: 2×Universal SYBR Green Fast qPCR Mix 10μL, forward and reverse primers each 0.5μL, cDNA template 2.0μL, ddH2O 7μL. The reaction program was: pre-denaturation at 95℃ for 3min, cycle reaction at 95℃ for 5s, 60℃ for 30s, a total of 40 cycles. The melting curve was the default setting of the instrument.
[0055] Table 1 Fluorescence Quantitative PCR Primer Sequences
[0056] Gene Upstream primer sequence-F (5'→ 3') Downstream primer sequence-R (5'→ 3') PPARγ CCAGCATTTCCACTCCACACTA GACACAGGCTCCACTTTGATG CEBPα AGCCAAGAAGTCGGTAGA CGGTCATTGTCACTGGTC DGAT1 CCCACCATCCAGAACTCCAT CGGTCTCCAAACTGCATGAG ACC TCAGAAGGAGGAGGAGGGAA ATGACGGGACTGTTTGGCTA SREBP1C TTTCTGACCCGCTTCTTCCT ACGGAACAACTGAGTCACCT DGAT2 CCCTCATAGCTGCCTACTCC GAGGAAAGACAGGACCCACT SCD CTTCCTGATCATTGCCAACA GCAAACCACCCTTCTCTTTG FASN CTGATCAAGGTGCTGCTGTC CGAAGGAGTTTATGCCCACG LPL GTTGAGGACACTTGCCATCT CCTCTTGTATAGGGCAGCCAC FABP4 AAGAAGTGGGAGTGGGCTTT TTCCTGGCCCAATTTGAAGG 18S GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG
[0057] The results are shown in Figure 5As shown, the expression of the adipogenic differentiation related genes gradually increased with the extension of differentiation time. This further indicated from the molecular level that the porcine fat precursor cells successfully underwent adipogenic differentiation and formed mature adipocytes.
[0058] (4) The expression amount of the differentiation related proteins in different differentiation periods of the porcine fat precursor cells was explored, and the specific operation was as follows:
[0059] (1) Cell protein extraction
[0060] Discard the culture solution, and wash once with PBS. Add an appropriate amount of RIPA lysis buffer containing protease inhibitors. Place on ice for 10 min. Scrape the cells from the bottom of the hole with a cell scraper. Collect the cell lysate in a 1.5 mL centrifuge tube, centrifuge at 12,000 rpm for 30 min at 4°C. Transfer the supernatant to a new 1.5 mL centrifuge tube. The supernatant is the cell protein. Store at -80°C for standby.
[0061] (2) Western blot
[0062] Take the protein out of the -80°C refrigerator and thaw on ice. Mix 20 μL of protein with 5 μL of 5× protein loading buffer and boil at 100°C for 10 min to denature the protein. Prepare SDS-PAGE gel. Add 10 μL of denatured protein to each lane, and add 5 μL of pre-stained protein marker to a lane. Set the electrophoresis conditions to 120V for 15 min and 200V for 40 min. After electrophoresis, use the wet transfer method, set the constant current to 400 mA, and transfer the PVDF membrane for about 30 min. Place the PVDF membrane in an antibody incubation box containing blocking solution (5% skim milk), and incubate at room temperature for 1 h. Add the primary antibody (1:5000 dilution) to the antibody incubation box, and incubate at 4°C overnight. Wash the membrane with TBST for 3 times, 10 min each time. Add the secondary antibody (1:5000 dilution) to the antibody incubation box, and incubate at room temperature for 1 h. Wash the membrane with TBST for 3 times, 10 min each time. Detect with ECL chemiluminescence solution, and take a photo using a chemiluminescence imaging system. The results are shown in Figure 6 As shown, the expression of the adipogenic differentiation related proteins gradually increased with the increase of differentiation time, and the results further indicated from the molecular level that the porcine fat precursor cells underwent adipogenic differentiation. Figure 6
[0063] The above-described embodiments only express the specific implementation of the present application, which is described in detail, but it cannot be understood as a limitation on the protection scope of the present application. It should be noted that for ordinary skilled persons in the art, without departing from the technical concept of the present application, a number of modifications and improvements can be made, which are all within the protection scope of the present application.
Claims
1. A method for serum-free adipogenic differentiation of porcine fat precursor cells, characterized in that, Comprising the following steps: (1) Take porcine fat precursor cells and proliferate in vitro, grow to 100% confluence, continue to culture for 2 days, discard the proliferation culture medium, add serum-free lipogenic induction and differentiation culture medium, and the day when the serum-free lipogenic induction and differentiation culture medium is added is recorded as 0d, the liquid is changed every 1 day, and the culture is carried out for 4 days; wherein the serum-free lipogenic induction and differentiation culture medium is composed of a basic culture medium and a cell culture auxiliary factor, and the cell culture auxiliary factor is composed of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 0.25 mmol / L IBMX, 1 μmol / L rosiglitazone, 150 μmol / L sodium oleate, and 10 μg / mL transferrin; (2) Remove the serum-free lipogenic induction and differentiation culture medium, add serum-free lipogenic maintenance and differentiation culture medium, and continue to differentiate for 4 days, and the liquid is changed every 1 day; wherein the serum-free lipogenic maintenance and differentiation culture medium is composed of a basic culture medium and a cell culture auxiliary factor, and the cell culture auxiliary factor is composed of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 150 μmol / L sodium oleate, and 10 μg / mL transferrin.
2. The method for serum-free adipogenic differentiation of porcine fat precursor cells according to claim 1, characterized in that, The basic culture medium is one of DMEM, DMEM / F12 culture medium containing penicillin-streptomycin double-antibiotic solution.
3. The method for serum-free adipogenic differentiation of porcine adipocyte precursor cells as described in claim 1, characterized in that, The preparation process of the porcine fat precursor cells is as follows: (1) Take the subcutaneous fat of the neck of a pig, cut it into minced meat, add 1-3 mg / mL collagenase solution, transfer it to a tissue dissociation tube, use a tissue dissociator to dissociate, and then place it in a 37℃ water bath, digest for 60-90 min, dissociate every 15-20 min, then add an equal volume of high-sugar DMEM containing 10% fetal bovine serum to terminate digestion, filter with a 70-150 μm cell sieve, wherein the volume ratio of the minced meat to the collagenase solution is 1:5; (2) Centrifuge the digestion solution at a speed of 800-1500 rpm at room temperature for 5-10 min, discard the supernatant, and retain the cell precipitate; (3) Add 3-5 times the volume of red blood cell lysis solution to the cell precipitate for resuspension, lyse at room temperature for 5-10 min, then centrifuge, discard the supernatant, and retain the cell precipitate; (4) Resuspend the cell precipitate using high-sugar DMEM containing 20% FBS, then inoculate it into a cell culture dish, and use high-sugar DMEM containing 10% FBS as the complete culture medium after subculture.
4. A medium for serum-free adipogenic differentiation of porcine fat precursor cells, characterized in that, The serum-free adipogenic induction differentiation medium is composed of a basic medium and cell culture auxiliary factors, and the cell culture auxiliary factors are composed of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 0.25 mmol / L IBMX, 1 μmol / L rosiglitazone, 150 μmol / L sodium oleate and 10 μg / mL transferrin; and the serum-free adipogenic maintenance differentiation medium is composed of a basic medium and cell culture auxiliary factors, and the cell culture auxiliary factors are composed of 66 nmol / L insulin, 33 μmol / L biotin, 17 μmol / L pantothenic acid, 0.1 μmol / L dexamethasone, 150 μmol / L sodium oleate and 10 μg / mL transferrin.
Citation Information
Patent Citations
Poultry serum-free adipogenesis induced differentiation culture medium, induction method and application
CN117721074A
Method for separation, identification and adipogenic differentiation of mammal fat precursor cells, composition and application
CN117625527A
Serum-free culture medium for inducing bovine adipocyte differentiation and application of serum-free culture medium
CN118497116A
Efficient adipogenic differentiation adipose-derived stem cells and preparation method thereof
CN118792244A